awk‚ɂ‚˘‚ÄŒę‚éƒXƒŒ $2

•…‚Á‚Ä‚ŕ‘âH éuűű‚ŕ˜V‚˘‚Ä‚Íém”n‚É—ň‚éH
ŽOl‚̐׊w‚ސś‚ݏo‚ľ‚˝ƒXƒNƒŠƒvƒgŒžŒęAWK‚ɂ‚˘‚ÄŒę‚éƒXƒŒ

Ÿ ‘OƒXƒŒ
awk‚ɂ‚˘‚ÄŒę‚éƒXƒŒ
http://pc10.2ch.net/test/read.cgi/tech/1023556171/

Ÿ ŠÖŒWƒXƒŒ
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘Š’kŽş
http://pc10.2ch.net/test/read.cgi/tech/1112553783/
AWK‚ĹCGI
http://pc10.2ch.net/test/read.cgi/php/1171804314/
ysedzƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘‡@LINUX Part2yawkz
http://pc10.2ch.net/test/read.cgi/linux/1154578200/

Ÿ ŽQl
The AWK Programming Language (Brian Kernighan)F
ttp://cm.bell-labs.com/cm/cs/awkbook/index.html

GAWK (GNU Projedt):
ttp://www.gnu.org/software/gawk/

awking shoes

ƒI[ƒN
ƒI[ƒN
ƒI[ƒN

@‰œ‚ł‚ń

‘˝‚­‚ÍŒę‚é‚Ü‚˘B

Mawk - Mike' AWK
http://gnuwin32.sourceforge.net/packages/mawk.htm

‚˘‚â‘˝‚­‚đŒę‚Á‚Ä‚­‚ę

6ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/02/25(“ú) 06:34:37
ƒ[ƒJƒ‹•Ď”AB

7ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/02/27(‰Î) 21:39:18
ƒNƒ[ƒWƒƒ‚đŽ‚Á‚˝awkŽŔ‘•‚Ć‚Š‚Č‚˘‚Š‚Ë

8ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/02/27(‰Î) 23:45:59
ƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ĺ‚ż‚ĺ‚ż‚ĺ‚Á‚ĆŽg‚¤‚ą‚Ć‚Í•p”É‚É‚ ‚é‚Ż‚Ç
‹C‡‚˘“ü‚ę‚ăvƒƒOƒ‰ƒ~ƒ“ƒO‚ˇ‚é‚Á‚Ä‚Ě‚ÍĹ‹ß–ł‚­‚Č‚Á‚˝B

>>7
‘OƒXƒŒ‚ÉObjective awk‚ŞŽŔÝ‚ˇ‚é‚Š‚̂悤‚Č˜b‚Ş‚ ‚é‚Şƒlƒ^‚ž‚낤B
ŽŔ—pŤ‚𖳎‹‚ˇ‚ę‚ÎawkŽŠg‚ŏ‘‚­‚ą‚Ć‚ŕ•s‰Â”\‚Ĺ‚Í‚Č‚˘‚Š‚ŕ‚ľ‚ę‚Č‚˘B
‚¨–]‚݂Ɉę”Ô‹ß‚˘ŽŔ‘•‚́AŽŔ‚ÍJavaScript‚Ĺ‚Í‚Č‚˘‚Š‚ƁB
http://developer.mozilla.org/ja/docs/New_in_JavaScript_1.7

10ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/01(–Ř) 00:43:46
ƒgƒbƒpƒ“‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK‚ރuƒbƒNƒIƒt‚Ĺ105‰~‚Ĺ’@‚Ť”„‚ç‚ę‚Ä‚é‚Ě‚đŒŠ‚Ä
‚Č‚ń‚Š”ß‚ľ‚˘‹C•Ş‚É‚Č‚Á‚˝

11ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/01(–Ř) 16:01:47
>>10
‰´‚ŕƒIƒ‰ƒCƒŠ[‚́used & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOv–{‚ށA}‘ŠŮ‚́u–ł—ż‚ĹŽ‚Á‚Ä‚Ż[’Iv
‚É‚ ‚Á‚˝‚̂ŁA‘Ś GET ‚ľ‚˝B‚Ü‚ A‚Š‚Č‚čŒĂ‚˘–{i1991 ”Nj‚ž‚Ż‚ǁA“ŕ—e‚Í‚˘‚˘–{‚žB
’艿 \3800 ‰~‚ĚƒoƒJ‚–{‚ŁA ‚˝‚Ô‚ńAV‘‚Ĺ‚Í”ƒ‚í‚Č‚Š‚Á‚˝‚ž‚낤B

ƒgƒbƒpƒ“‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK‚Á‚āA‚˘‚‚˛‚ë‚Ě–{‚ž‚Á‚˝‚ŻB‚Ć‚č‚ ‚Ś‚¸A105‰~‚Č‚ç
—~‚ľ‚˘‚Á‚ˇB

12ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/01(–Ř) 21:49:42
>>11
Ô‚˘•\Ž†‚Ě‘ć‚P”Ĺ‚ž‚Ë‚Ť‚Á‚ƁB
—΂̕\Ž†‚Ě‘ć‚Q”Ĺ‚ŞŽčŒł‚É‚ ‚é‚Ż‚ǁAgawk‚ĹŠg’Ł‚ł‚ę‚Ä‚˘‚é
ł‹K•\Œť‚Ěŕ–ž‚Ć‚Š‘‚Ś‚Ä‚Ä‘ć‚Q”Ĺ‚Ě‚Ů‚¤‚Ş‚¨ŠŠ‚߁B
‚ż‚Ȃ݂ɒ艿‚S‚P‚O‚O‰~‚Č‚čB

13112007/03/01(–Ř) 23:52:54
>>12
> Ô‚˘•\Ž†‚Ě‘ć‚P”Ĺ‚ž‚Ë‚Ť‚Á‚ƁB
‚ť‚¤A‚ť‚ę‚ť‚ęB ‚Ů‚ń‚ŁA
gensub ‚Ş‚Č‚˘B‚ŕ‚ż‚ë‚ńA
/inet/..... |& ....@‚ŕ‚Č‚˘B

Ĺ‹ßA/inet/..... |& ....@‚Ş‚ ‚éigawk3.1 ‚Š‚çj‚ą‚Ć‚đ’m‚Á‚āAgawk ‚đŒŠ’ź‚ľ‚Ä‚˘‚éB
Žg‚˘ŽĚ‚Ä‚ĚƒvƒƒOƒ‰ƒ€‚Í gawk ‚ɏ`!!B

14ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/02(‹ŕ) 02:09:03
>>11
ƒgƒbƒpƒ“‚̍ŏ‰‚Ě–{‚Č‚çŠm‚Š1990”N‚̏t ‚ž‚Á‚˝‚ĆŽv‚¤B
ˆę‰žnawkƒŒƒxƒ‹‚Ě‹Lq‚Ě‚Í‚¸‚Č‚ń‚ŁAgawk‚Č‚ń‚Š‚ĚŒĹ—L‚Ě
Šg’Ł‚đœ‚Ż‚Ώ\•ŞŽg‚Ś‚é‚Ĺ‚ľ‚ĺB

105‰~‚́c‚ż‚Ɣ߂ľ‚˘‚Ż‚Ç‚˘‚˘l‚ɏE‚í‚ę‚Ä—~‚ľ‚˘‚Ë‚ŚB

15ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/02(‹ŕ) 02:27:22
>>13
gawk‚Ě /inet Šg’Ł‚Á‚ăCƒ}ƒCƒ`Žg‚˘‚Ă‚ç‚­‚Ë?

”Ä—p“I‚Č‚Ě‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁA‚¨ŽčŒy‚ÉhttpŒo—R‚Ĺwebƒy[ƒW‚Ě
“ŕ—eŽć‚ę‚ę‚΂˘‚˘‚Á‚Ä‚Ć‚Ť‚É‹Lq‚Ş–Ę“|B

16ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/04(“ú) 00:06:22
>>15
’Pƒ‚É

gawk '{print $0}' http://foo.org/index.html

‚Ć‚Š‚ĹƒV[ƒ€ƒŒƒX‚ɃAƒNƒZƒX‚Ĺ‚Ť‚é‚Ć‚˘‚¤‚Ů‚¤‚Ş•Ö—˜‚Č‚Ě‚Š‚Č?

17ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/04(“ú) 00:24:42
http://www.gnu.org/software/gawk/manual/gawkinet/gawkinet.html#Web-page
‚Š‚çAŠČ’P‚Č—áB

BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/www.yahoo.com/80"
print "GET http://www.yahoo.com" |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}

18ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/04(“ú) 00:38:54
awk‚ĹSQL‚Ěleftjoin‚Ý‚˝‚˘‚Č‚ą‚Ć‚Ĺ‚Ť‚éH

19ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/04(“ú) 01:55:43
>>17
‚Č‚ń‚ś‚á‚ą‚č‚áB
wget -O - http://www.yahoo.com/ ‚̏o—Í‚đ“Ç‚Ţ‚Ě‚Ć‘S‘R•Ď‚í‚ç‚ń‚ȁB

20152007/03/04(“ú) 03:46:24
>>16
‚Ü‚  wget‚Ć‚ŠcurlŽg‚Á‚Ä•W€“ü—Í‚Š‚çŽć‚ę‚ć‚Ć‚˘‚¤˜b‚ŕ‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁA
http://‚Ů‚°‚Ů‚° ‚Í“Á•Ęˆľ‚˘‚ľ‚Ä‚­‚ę‚é‚Ć‚¤‚ę‚ľ‚˘‚Č‚ ‚ĆŽv‚Á‚Ä‚éB

‚Ü‚ HTML“Ç‚ń‚Ĺ‚ť‚ę‚đ‰đÍ‚ˇ‚éŽčŠÔ‚ŞŽŸ‚É‘Ň‚Á‚Ä‚é‚Ż‚Ç‚łw

21ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/04(“ú) 03:55:11
ƒGƒ“ƒR[ƒfƒBƒ“ƒO‘Ήž‚Ć‚ŠFXl‚Ś‚é‚ƁAawk‚ĹHTML‚đˆ—‚ľ‚悤‚Ć‚ˇ‚é‚Ů‚¤‚Ş
–ł—‚Ş‚ ‚銴‚śB
‘f’ź‚ÉP‚Ĺ‚Í‚ś‚܂錞Œę‚Ć‚ŠŽg‚Á‚Ć‚Ż‚΁H‚Ý‚˝‚˘‚ȁB

22192007/03/04(“ú) 04:55:31
>>21
P‚Ć‚ŠRŽg‚Ś‚Á‚Ä‚Ě‚Í‚Ü‚ ‚ť‚¤‚Č‚ń‚ž‚Ż‚ǁAHTML‚Ě‘Ă“–Ť‚Ć‚ŠƒGƒ“ƒR[ƒfƒBƒ“ƒO‚đ‹C‚É‚ľ‚Č‚˘‚Ĺ
‚˘‚˘Žg‚˘“š‚ōl‚Ś‚Ä‚˝(ŒÂl“I‚É‚ť‚¤‚˘‚¤Žů—v‚Ş‚ ‚é)‚̂łˁB
HTML‚ÉŠÖ‚ľ‚Ä‚Í‚Ť‚ż‚ń‚Ć‚ľ‚˝ƒhƒLƒ…ƒƒ“ƒg‚Č‚çxgawk‚Ĺ‚Ç‚¤‚É‚Š‚Č‚é?



23ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/14(…) 16:26:36
ĚAFortranAC‚Ž‚炢‚ľ‚Š’m‚ç‚Č‚Š‚Á‚˝ŽžA
u‚Ś‚ÁA‚ą‚ń‚Ȑ”s‚ĹŒvŽZo—ˆ‚é‚́Hv
uƒvƒƒOƒ‰ƒ€“ŕ‚Ƀtƒ@ƒCƒ‹–ź‘‚Š‚Č‚­‚Ä—Ç‚˘‚́Hv
u‚ą‚̐”s‚ŁA‚ˇ‚×‚Ä‚Ěƒf[ƒ^‚ĚŒvŽZ‚ľ‚Ä‚­‚ę‚é‚́Hv
‚Á‚āA‹Á‚Ť‚Č‚Ş‚ç—Fl‚É‹ł‚Ś‚Ä‚ŕ‚炢‚Ü‚ľ‚˝B
Ą‚Č‚çAExcel‚Ĺ‚ˇ‚é‚悤‚ČŒvŽZ‚Í‚ˇ‚ׂÄawk‚Ĺ‚ľ‚Ä‚Ü‚ľ‚˝B
ƒAƒXƒL[‚Š‚ç256”{ƒVƒŠ[ƒY‚ޏo‚˝‚Ž‚炢‚ž‚Š‚ç
’–Ú‚ĚŒžŒę‚ž‚Á‚˝‚ń‚ž‚ć‚ˁB


24ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/03/14(…) 16:40:22
Visicalc‚Ć1-2-3‚Íawkƒu[ƒ€‚ć‚čĚ‚Š‚ç‚ ‚Á‚˝‚ń‚ž‚Ż‚ǂˁB
UNIX‚Á‚ĈӊO‚ĆŒĂ‚­‚Č‚˘‚ń‚ž‚ć‚ˁB

>10
”­sŠ‚ސV‹IŒłŽĐ‚́uƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKv‚đ2005”N‚ɒ艿3465‰~iĹžj‚Ĺ”ƒ‚˘‚Ü‚ľ‚˝B
‰œ•t‚Ɂu–{‘‚Í1989”N11ŒŽ‚ÉŠ”ŽŽ‰ďŽĐƒgƒbƒpƒ“‚ć‚č”­s‚ł‚ę‚Ü‚ľ‚˝B‚ą‚Ě“xAŠ”ŽŽ‰ďŽĐV‹IŒłŽĐ‚ć‚čAŒ´o”ŎЁA–óŽŇ‚Ě‹–‰Â‚đ“ž‚ÄÄ”­s‚˘‚˝‚ľ‚Ü‚ľ‚˝Bv‚Ə‘‚Š‚ę‚Ä‚˘‚Ü‚ˇB

V‹IŒłŽĐ‚Á‚ÄRPG‚Ě–{‚ľ‚Šo‚ľ‚Ä‚Č‚˘‚ĆŽv‚Á‚Ä‚˝‚Š‚çˆÓŠO‚žB

‘ĺĚ‚É’Ę‚Á‚Ä‚˝‚ę‚Ě“y–؍HŠw‰Č‚É‚Íawk‚ĚŽö‹Ć‚Ş‚ ‚Á‚˝
ŽŔŒą‚Ěƒf[ƒ^ˆ—‚É‚Ĺ‚ŕŽg‚Á‚Ä‚Ů‚ľ‚Š‚Á‚˝‚ń‚ž‚낤

28ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/04/16(ŒŽ) 17:34:08
>24
awkƒu[ƒ€‚́Aź—ď‚ž‚Ɖ˝”N ‚Ĺ‚ľ‚傤‚Š?

29ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/04/17(‰Î) 00:31:15
>>28
DOS––ŠúB256”{–{‚ޏo‚˝93”N ‚ރs[ƒN‚ł́B
Œă‚ĚPerl‚Ć‚Í”äŠr‚É‚Č‚ç‚Č‚˘ƒvƒ`ƒu[ƒ€‚ž‚Ż‚ǁB

30282007/04/17(‰Î) 08:45:33
>29
Œä‰ń“š‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

31ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/05/04(‹ŕ) 21:28:49
Ĺ‹ß‚̏î•ń‚́A‚ą‚ż‚çI
ttp://gauc.no-ip.org/

‹SŽÔawk‚đ’N‚Šě‚Á‚Ä‚­‚ę‚Č‚˘‚Š‚ȁ[

33ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/07/15(“ú) 03:17:40
>>32
‚˘‚˘‚ą‚ĆŒž‚¤‚Ë‚ĽB
Ž^Ź!

34ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/03(ŒŽ) 08:59:45
‚ ‚Ćƒ[ƒJƒ‹•Ď”‚Ş—~‚ľ‚˘‚Č

35ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/03(ŒŽ) 10:30:14
function‚Ě’†‚̓[ƒJƒ‹•Ď”‚É‚Č‚é‚ćB

36ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/04(‰Î) 00:12:17
‚˘‚‚Š‚çH–˘‚ž‚Ɉř”‚É•Ŕ‚ׂé‚ŕ‚ń‚ž‚ƁB

37ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/04(‰Î) 09:33:02
‚ [A‚˛‚ß‚ńAˆř”•Ŕ‚ׂ˝‚â‚‚ރ[ƒJƒ‹•Ď”‚É‚Č‚éB‚ž‚Á‚˝B
ć‚ɐ錞‚ˇ‚ę‚΂˘‚˘‚ń‚ž‚Š‚ç•Ę‚É‚ć‚­‚ˁH

38ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/09(“ú) 04:42:02
ƒLƒ‚‚˘‚â‚ńB‚ť‚Ě‚â‚č•űB

39ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/14(‹ŕ) 04:37:24
‚ą‚ę‚Š‚çawk‚đ•×‹­‚ľ‚Ü‚ˇB

40ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/14(‹ŕ) 09:05:13
awk‚đŠw‚Ô‚ą‚Ć‚É‚Č‚é‚Ĺ‚ľ‚傤B

41ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/15(“y) 01:03:04
‚Ý‚Č‚ł‚ńawk‚ÍŒę‚ç‚Č‚˘‚Ě‚Ĺ‚ˇ‚ˁB

‘D“Şawk‚ľ‚Ä‘DŽR‚É“o‚éB

43ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/16(“ú) 03:03:51
l‚ÉŒž‚Ś‚é‚Ů‚Çawk’m‚Á‚Ä‚é–ó‚Ĺ‚ŕ–ł‚˘‚ľ

44ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/16(“ú) 10:27:22
‚ž‚Ż‚ǐl‚Ě˜b‚Í•ˇ‚Ť‚˝‚˘‚ľ

45ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/17(ŒŽ) 18:12:15
awk‚Ú—˜’Ę

46cat.awk2007/09/19(…) 08:55:44
1

47ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 16:41:49
awk‚đ•×‹­‚ľ‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚ށAPerl‚ÉŠľ‚ę‚Ä‚˘‚é‚Š‚ç‚Š
awk‚Ĺ‚Ĺ‚Ť‚é‚ą‚Ć‚ÍPerl‚Ĺƒƒ“ƒ‰ƒCƒi[‚Ĺ‚â‚Á‚˝‚Ů‚¤‚Ş(­‚Č‚­‚Ć‚ŕŽŠ•Ş‚É‚Ć‚Á‚Ä‚Í)‘Ź‚˘‹C‚Ş‚ľ‚Ä‚Č‚č‚Ü‚š‚ńB
‚ą‚ę‚ɂ‚˘‚Äawkn—űŽŇ‚Ĺ‚ ‚éŠF—l‚Í‚˘‚Š‚Ş‚¨l‚Ś‚É‚Č‚č‚Ü‚ˇ‚ŠH
‚ą‚¤‚˘‚¤Žž‚Íawk‚Ě‚Ů‚¤‚Ş•Ö—˜I‚Ć‚˘‚¤—á‚É‚Í‚Ç‚ń‚Č‚ŕ‚Ě‚Ş‚ ‚č‚Ü‚ˇ‚ŠH

48ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 16:43:11
Ş‚ ‚Á‘Ź‚˘‚Ć‚˘‚¤‚̂́AƒR[ƒh‚đ‘‚­‚Ě‚Ş‘Ź‚˘‚Ć‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB

49ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 16:48:06
>>47
perl ‚Í‚Č‚­‚Ä‚ŕ awk ‚Č‚ç“ü‚Á‚Ä‚˘‚鎖‚Ş‚ ‚é

50ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 16:53:58
uƒR[ƒh‚đ‘‚­‚Ě‚Ş‘Ź‚˘v‚Ć‚˘‚¤Šî€‚ŁA
u‚ą‚¤‚˘‚¤Žž‚Íawk‚Ě‚Ů‚¤‚Ş•Ö—˜v‚Ć‚˘‚¤—á‚𑟐l‚É‹“‚°‚ł‚š‚Ä‚ŕA
‚ť‚ę‚Í‚ť‚̐lŠÔ‚É‚Ć‚Á‚Ä‚Ě‘Ź‚˘‹C‚Ş‚ˇ‚é•Ö—˜‚ł‚Ĺ‚ ‚Á‚āA
ˆÓ–Ą‚Ě‚ ‚éˆę”Ę“I‚Č‹c˜_‚É‚Č‚ç‚Č‚˘‚Ě‚Ĺ‚Í‚Č‚˘‚ŠH

51ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 16:57:51
Perl‚ŕRuby‚ŕPython‚ŕŽg‚¤‚Ż‚ǁA“Á’č‚ĚƒJƒ‰ƒ€‚ž‚Ż‚É‹ť–Ą‚Ş‚ ‚éƒP[ƒX‚Í
–łˆÓŽŻ‚Éawk‚đŽg‚¤‚ą‚Ć‚ŕ‚ ‚éB

perl -a ‚Ć‚Š cut‚ľ‚Äpaste‚Ć‚Š‚ŕ‚ ‚é‚Ż‚ǁB

52ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 18:19:27
>>49 ŠÂ‹Ť‚É‚ć‚炸“ü‚Á‚Ä‚˘‚é‚Ć‚˘‚¤‚ą‚Ć‚Ĺ‚ˇ‚ˁB

>>50@‚ť‚¤‚Ĺ‚ˇ‚ˁB
‚Č‚şawk‚Č‚Ě‚ŠA
ˆę”Ę“I‚É‚Í‚Ç‚¤‚˘‚¤Žž‚Éawk‚ŞŽg‚í‚ę‚é‚Ě‚ŠA
‚Ć‚˘‚¤‚Ě‚ŞƒCƒ}ƒCƒ`ŽŠ•Ş‚Ě‚Č‚Š‚Ĺ•Ş‚Š‚Á‚Ä‚˘‚Č‚˘‚Ě‚Ĺ‚ˇB

>>51 ­‚ľ•×‹­‚ľ‚˝ŒŔ‚č‚ł́AŠm‚Š‚ɃJƒ‰ƒ€‚ĚŽć‚čo‚ľ‚Íawk‚Ş•Ö—˜‚Č‚Ě‚Š‚ŕ‚ĆŽv‚˘‚Ü‚ľ‚˝B


53ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 19:55:33
>>52
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ě’†‚ŁA•nŽă‚ČƒVƒFƒ‹‚ĚŒvŽZ”\—Í‚đ
•â‚¤‚˝‚߂ɁAƒc[ƒ‹ƒ{ƒbƒNƒX‚Ěˆę‚‚Ƃľ‚ÄŽg‚í‚ę‚é‚ą‚Ć‚Ş‘˝‚˘B

‚̂ŁAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚đ‘‚­‹@‰ď‚Ş‘˝‚˘‚Ě‚Č‚çA‚â‚Á‚Ä‚¨‚˘‚Ä
‘š‚Í–ł‚˘‚ĆŽv‚¤‚ށAƒtƒbƒgƒvƒŠƒ“ƒg‚Ş‘˝­ƒfƒJƒC‚ą‚Ć‚Ć‚â‚âˆÚAŤ‚É
Œ‡‚Ż‚é‚ą‚Ć‚đ‹C‚É‚ľ‚Č‚Ż‚ę‚΁A•Ę‚ÉPerlŽg‚Á‚˝‚Á‚Ä‚˘‚˘‚í‚Ż‚ž
i‚Ç‚¤‚šĄ‚Č‚ç‘ĺ’ď‚ÍŽg‚Ś‚é‚ž‚낤‚ľAawk‚É‚ľ‚Ä‚ŕˆę‰žPosix•W€‚ž‚Ş
FX•ĎŽí‚Ş‚ ‚éjB

‚܁A’P‚É•Ö—˜‚ČƒXƒNƒŠƒvƒgŒžŒę‚Ş—~‚ľ‚˘‚ž‚Ż‚Č‚çAĄXawk‚đ‚â‚éˆÓ–Ą‚Í
‚Ů‚Ć‚ń‚Ç‚Č‚˘‚ž‚낤B
ƒtƒB[ƒ‹ƒh•ŞŠ„‚ž‚Ż‚Č‚çperl -a‚Ĺawk‚̐^Ž—‚Ş‚Ĺ‚Ť‚é‚ľ‚ȁB

54ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 20:06:52
>>53 ’š”J‚Č‚¨•ÔŽ–‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
ƒVƒFƒ‹‚ĚŒvŽZ‚Ě•â•‚Ĺ‚ˇ‚ŠB
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚đ‘‚­‹@‰ď‚Í‘˝­‚Í‚ ‚é‚̂ŁA‘˝­‚ÍŠo‚Ś‚Ä‚¨‚ą‚¤‚ĆŽv‚˘‚Ü‚ˇB

55ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 21:00:04
awk‚Ćper‚ŒAˆ—‘Ź“x‚Í‚Ç‚Á‚ż‚Ş‘Ź‚˘‚ń‚ž‚ëH
‚Á‚ăIƒ}ƒG‚ŞŽŽ‚š‚Á‚ÄŒž‚í‚ę‚ť‚¤‚ž‚Ż‚Ç‚Ó‚ĆŽv‚Á‚˝‚ń‚ŏ‘‚˘‚Ä‚Ý‚˝B

56ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 22:17:45
awk‚͏ˆ—Œn‘˝‚˘‚Š‚ç‚Č‚Ÿ
‰˝‚̏ˆ—‚Š‚É‚ŕ‚ć‚é‚ž‚낤‚ľ

57ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 23:45:00
‚Ç‚ż‚ç‚ŕ“žˆÓ‚Ć‚ˇ‚é’Pƒ‚ČƒeƒLƒXƒg‚ĚƒtƒBƒ‹ƒ^ƒŠƒ“ƒOˆ—‚Č‚çA
I/O‘Ź“x‚Ő§ŒŔ‚ł‚ę‚é‚Ě‚Ĺ‚Ç‚ż‚ç‚Ĺ‚ŕ(ˆ˝‚˘‚Ísed‚đŽ‚żo‚ľ‚Ä‚ŕ)‘ĺ‚ľ‚Ä•Ď‚í‚ç‚Č‚˘‚ĆŽv‚¤B

awk‚̐^œ’¸‚͈ęs–ě˜Y‚É‚ ‚é‚ĆŽv‚¤Ž„‚́A‚ą‚ń‚Č‚Ě‚đ‚ć‚­‘‚ŤŽĚ‚Ä‚éB
--
awk 'BEGIN {print 1+2*3-4;}'
ls -l /tmp|awk '$5>0'
ls -l |awk '{sum+=$5;} END{print sum;}'

58ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/19(…) 23:51:16
Perl‚É‚˝‚˘‚ˇ‚éAwk‚ĚŒťŽŔ“IƒƒŠƒbƒg‚̓ƒ‚ƒŠÁ”ď‚Ş­‚Č‚˘‚ą‚Ć‚­‚炢‚Ĺ
‚ą‚ę‚͍Ą‚ĚŒvŽZ‹@‚Ĺ‚Í”÷X‚˝‚é–â‘č‚žB
ESR‚ĚArt of UNIX Programming‚𗧂ż“Ç‚Ý‚ľ‚˝‚ç
Awk‚ރƒ‚ƒŠß–ń‚Ě‚˝‚ß‚ÉŽd—l‚đ§ŒŔ‚ľ‚˝‚ą‚Ć‚Ş
‘Šú‚É‹Ł‘ˆ—Í‚đ‚Č‚­‚ľ‚˝——R‚Ć˜_‚ś‚Ä‚˘‚˝B
ƒoƒbƒh‚ČŒžŒęÝŒv‚ĚŒŠ–{‚Á‚ÄŠ´‚ś‚ŁA‚ż‚Ć•s–ů‰ő‚ž‚Á‚˝

>>57
‰´‚ாX‚â‚éB
‚ť‚ĚŽž‚Í•Ö—˜I‚ĆŽv‚Á‚Ä.cshrc‚Ć‚Š‚Éalias“o˜^‚ˇ‚é‚Ż‚Ç‚ˇ‚Ž‚É–Y‚ę‚Ä“Ż‚ś“ŕ—e‚đŽč‘Ĺ‚ż‚ľ‚Ä‚˝‚股‚é
‚ť‚Ě‹“‹ĺ‚É‚ą‚ę‚Í•Ö—˜I‚ĆŽv‚Á‚Ä.cshrcŠJ‚­‚ĆŠů‚É“o˜^‚ľ‚Ä‚ ‚é‚Ć‚˘‚¤c

>>59
‘S‰´‚Ş‹¤Š´‚ľ‚˝B

61ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/24(ŒŽ) 12:01:33
i.cshrc‚đ.bashrc‚É’u‚ŤŠˇ‚Ś‚āj@‰´‚ŕ“Ż‚śŒoŒą‚Ş‚ ‚éB

62ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/28(‹ŕ) 00:37:50
uˆęs–ě˜Yv‚Í–ź–ó

63ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/28(‹ŕ) 01:20:24
‚Ţ‚Š‚ľAu“Ǐ‘‚ˇ‚éƒvƒƒOƒ‰ƒ}v‚đ‚ć‚ń‚ŁAawk‚ʼnďŒv‚đ‚ˇ‚é‚Ě‚Ş‚Š‚Á‚ą—Ç‚˘‚Ć
‚¨‚ŕ‚Á‚Ä‚Ü‚ľ‚˝B
‚Ĺ‚ŕŠm’č\‚đ‚ˇ‚ég‚É‚Č‚Á‚˝‚çEXCEL‚đŽg‚Á‚Ä‚˘‚éB

uƒGƒ“ƒWƒjƒA‚Ě‚˝‚ß‚ĚŽ––ąě‹Ć sed awk grep ‚ť‚ľ‚ÄTexv‚Č‚ń‚ď‘Đ‚Ş‚ ‚ę‚ΐH‚˘‚‚­‚Ě‚É...

64ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/28(‹ŕ) 02:53:12
awk‚ʼnďŒv—pƒXƒNƒŠƒvƒg‚đ‘‚­‚ć‚čA‰ďŒv‚Ě‚ľ‚­‚Ý‚đ—‰đ‚ˇ‚é‚ą‚Ć‚Ě•ű‚Ş
‰´‚É‚Í—y‚Š‚É“ď‚ľ‚˘

65ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/09/28(‹ŕ) 14:47:04
Perl‚ž‚Ż‚ǁA‚ą‚ę‚́H
http://www.moge.org/okabe/temp/balance/

66ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/02(‰Î) 02:19:46
Perl ‚̓R[ƒhˆę–ÚŒŠ‚ĉ´‚Şcore“f‚Ť‚ť‚¤‚É‚Č‚é

67ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/02(‰Î) 07:50:30
”CˆÓ‚É core ‚Ş“f‚Ż‚˝‚ç•Ö—˜‚ž‚ć‚ȁB“ú‹L‘ă‚í‚č‚É‚Č‚éB

68ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/02(‰Î) 08:00:10
>>67
‘ĚŒ^ˆŰŽ‚Ě‚˝‚ß‚É—]‹V‚Č‚­‚ł‚ę‚Ä‚˘‚él‚ŕ‚˘‚˝‚悤‚Ĺ‚ˇB
Žw‚đA‚É“ü‚ę‚é‚悤‚É‚ˇ‚é‚̂ŁA‘­‚ÉŒž‚¤‚°‚ë‚ž‚ą‚ŞŽw‚É‚Ĺ‚Ť‚Ü‚ˇB

69ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/03(…) 23:18:59
awk‚Á‚Ä‚Č‚ń‚ĹPerl•—‚ɐł‹K•\Œť’uŠˇ‚Ĺ‚Ť‚é‚悤‚É‚Č‚ç‚ń‚́B“ĆŽŠŠg’Ł‚Ĺ‚ŕ‚˘‚˘‚ń‚ž‚Ż‚ǂȁB

70ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/04(–Ř) 02:48:29
>>69
‚ńA‚­‚í‚ľ‚­B

Perl‚Ěƒƒ^•śŽš‚đŽg‚˘‚˝‚˘‚Ć‚˘‚¤‚Ě‚Ć‚Íˆá‚¤‚Ě?
#Žg‚Ś‚ń‚í‚Ż‚ž‚Ş

71ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/04(–Ř) 21:53:48
awk‚ÍDFA‚Ĺperl‚ÍNFA‚ž‚Á‚Ż‚Š?

72ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/10/05(‹ŕ) 02:45:00
>>71
ƒIƒŠƒWƒiƒ‹‚ł͂ˁB
’†‚É‚ÍNFA‚đŽg‚Á‚Ä‚˘‚éawk‚ŕ‚ ‚éBmawk‚Ć‚ŠB

73ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/11/22(–Ř) 06:36:33
xgawk‚Ĺ‘˝”{’ˇŽ”‚đŽg‚˘‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA
printf( "%ld\n", num );
‚Ĺ‚ÍŒ…”‚Í‘‚Ś‚Ä‚ŕ¸“x‚Íă‚Ş‚Á‚Ä‚Č‚˘‚悤‚Ĺ‚ˇB
Œ^éŒž‚ˇ‚é‚É‚Í‚Ç‚¤‚ˇ‚é‚Ě‚Ĺ‚ľ‚傤‚Š

74ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/11/22(–Ř) 07:17:23
>>73
‘˝”{’ˇŽ”‚đŽŔ‘•‚ˇ‚é‚Ě‚ÉŒÂ•Ę‚Ě¸“x‚đă‚°‚Ä‚Ç‚¤‚ˇ‚éB

75ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/11/22(–Ř) 07:34:48
xgawk‚Í‘˝”{’ˇŽ”‚ ‚é‚ń‚Ĺ‚ˇ‚ć‚ˁH
‚ŁAruby‚̂悤‚É–łéŒž‚ĹŽg‚Ś‚é‚Š‚ĆŽv‚Á‚˝‚ç‚ť‚¤‚Ĺ‚Í‚Č‚˘‚ç‚ľ‚˘‚̂ŁA
‚Ç‚¤‚ˇ‚é‚Ě‚Š‚ƁB

http://home.vrweb.de/~juergen.kahrs/gawk/XML/xmlgawk.html
‚˘‚Ü‚ą‚Ě‚Ö‚ńŒŠ‚Ä‚é‚ń‚Ĺ‚ˇ‚Ş

76ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/11/22(–Ř) 08:47:49
MPFR,‘˝”{’ˇŽ”‚Ĺ‚Í‚Č‚­ŽŔ”‚Š‚ȁB
ƒOƒO‚Á‚ÄŒŠ‚‚Ż‚Ü‚ľ‚˝B
http://www.kt.rim.or.jp/~kbk/zakkicho/zakkicho7.html#D060126

http://golf.shinh.org/p.rb?Factorial
ŽŔ‚Í‚ą‚ę‚â‚Á‚Ä‚é‚ń‚Ĺ‚ˇ‚ށB
‚ ‚Ć‚Ídll‚ĚƒpƒX‚Ş•Ş‚Š‚ę‚΁EEE

77ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/11/26(ŒŽ) 21:13:28
>>76
u‚ ‚Č‚˛‚év‚Ě xgawk ‚Í MPFR Ď‚ń‚Ĺ‚Č‚˘‚ĆŽv‚¤‚ށEEEB

78ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2007/11/29(–Ř) 08:00:03
‚ť‚¤‚Ĺ‚ˇ‚Š
‚Ç‚ż‚ç‚É‚ľ‚Ä‚ŕŽŔ”‚Á‚ÄŽ–‚Í‚â‚Á‚Ď–ł—‚Č‹C‚Ş‚ľ‚Ü‚ľ‚˝

79ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/04(‹ŕ) 07:28:20
sed‚Ý‚˝‚˘‚ɁAƒpƒ^[ƒ“•”•Ş‚đs”ԍ†‚ĹŽw’čo—ˆ‚Ü‚š‚ń‚ŠH

80ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/04(‹ŕ) 09:32:19
>>79
awk 'NR == 79 {print;}'
‚Á‚Ä‚ą‚Ć? ‚ť‚ę‚Ć‚ŕA
awk 'FNR == 79 {print;}'
‚Á‚Ä‚ą‚Ć?

81ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/04(‹ŕ) 14:24:54
>80
‚Í‚ś‚ßsed‚Ý‚˝‚˘‚É 10,35{ ‚Ý‚˝‚˘‚ČŠ´‚ś‚ɏ‘‚˘‚ă_ƒ‚ž‚Á‚˝‚Ě‚Ĺ; }
•’Ę‚É”äŠrŽŽ‘‚­‚ń‚Ĺ‚ˇ‚ˁB10<=NR&&NR<=35{ ‚ŏo—ˆ‚Ü‚ľ‚˝; }
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>81
‚ŕ‚¤­‚ľ sed ‚ç‚ľ‚­‚ľ‚˝‚˘‚Č‚çA
10==NR, NR==35 { print }
‚Č‚ń‚Ä‚Ě‚ŕ‚ ‚č

83ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/14(ŒŽ) 09:02:50
awk ‚̓IƒvƒVƒ‡ƒ“‚Č‚ľ‚ž‚Ćƒƒ“ƒ‰ƒCƒi[‚ĚƒR[ƒh‚đ‘‚­‚ą‚Ć‚É‚Č‚é‚ĆŽv‚˘‚Ü‚ˇ‚Ş
ŽŔŰ awk ‚Ěƒƒ“ƒ‰ƒCƒi[‚Á‚Ä‚Ç‚ń‚ČŽž‚ÉŽg‚˘‚Ü‚ˇ‚ŠH
‚ ‚Ü‚čŒŠ‚˝‚ą‚Ć‚Ş‚Č‚­‚āc

84ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/14(ŒŽ) 09:45:08
>>83
UNIX‚Ĺ‚Í‘˝‚­‚Ěƒtƒ@ƒCƒ‹‚âo—Í‚Ş—“‹ćŘ‚čƒeƒLƒXƒg‚ĚŒ`ŽŽ‚É‚Č‚Á‚Ä‚˘‚é‚Š‚ç
‚ť‚̏ęŽg‚˘ŽĚ‚ăƒ“ƒ‰ƒCƒi[‚Ş–{—ˆ‚ĚŽg‚˘•ű‚Č‚ń‚ž‚Ż‚ǁA
‘ź‚ĚOS‚ž‚Ć BEGIN ‚đ main ‘ă‚í‚č‚ÉŽg‚¤‚悤‚Ȃ̂΂Á‚Š‚É‚Č‚é‚Š‚ŕ‚ˁB

85ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/14(ŒŽ) 09:46:06
>>83‚Şsed‚đ‚Ç‚¤Žg‚Á‚Ä‚˘‚é‚Ě‚Š‹C‚É‚Č‚éB
sedƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚Ć‚Šě‚Á‚āAƒXƒNƒŠƒvƒg‚Ěˆř”‚ɏˆ—‘ÎŰ‚Ěƒtƒ@ƒCƒ‹‚đ“n‚ľ‚Ä‚˝‚股‚é‚Ě‚Š‚ȁB

86ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/14(ŒŽ) 10:18:29
‚ć‚­‘‚­ˆęs–ě˜YB
--
du -sk /tmp/* | awk '{sum += $1;} END {print sum / NR;}'
# ‚Ü‚ŸAdu‚Á‚Ä‚Ě‚ÍĄŽv‚˘‚‚˘‚˝‚ž‚Ż‚ŁAŽŔŰ‚Édu‚̏o—Í‚Ě•˝‹Ď‚đŽć‚é‚ą‚Ć‚Í‚Č‚˘‚Ż‚ǂˁB
--
paste foo bar | awk '($1 - $2) > 1e-3 || ($1 - $2) < -1e-3 {print NR, $0;}'
# ˆę’v‚đŒŠ‚é‚ž‚Ż‚Č‚çdiff‚Ĺ‚˘‚˘‚Ż‚ǁA‹ßŽ—‚đŒŠ‚é‚É‚ÍŽg‚Ś‚Č‚˘‚ń‚ŁB

87ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/15(‰Î) 18:34:44
>>85
sed‚Í’P‘Ě‚Ě–˝—ß‚đŒŠ‚Äu’uŠˇvus‚̐؂čŽĚ‚āv‚Ý‚˝‚˘‚Č—p“r‚Ş
ƒpƒb‚ĆŒŠ‚ÄŽv‚˘•t‚­‚Ě‚Ĺ‹^–â‚Í•Ś‚Š‚Č‚˘‚ń‚Ĺ‚ˇB

awk‚͂ЂƂ‚ЂƂ‚̖˝—ß‚đŒŠ‚Ä‚ŕ
•’Ę‚ÉƒXƒNƒŠƒvƒgŒžŒę‚Ě–˝—ß‚Ć‚ľ‚ŠŽv‚Ś‚Č‚˘‚Ě‚Ĺ
uƒR[ƒh‘‚­‚Č‚ç‚Ć‚ŕ‚Š‚­Aƒƒ“ƒ‰ƒCƒi[‚Ĺ‚Ç‚¤Žg‚¤‚́Hv‚Ć
‹^–â‚đ‚ŕ‚Á‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇB

>>86
‚¤`‚ńAŒ‹\•ĄŽG‚É‚Č‚č‚Ü‚ˇ‚ˁB
‚ť‚ę‚ž‚ĆŽ„‚Č‚çƒ^[ƒ~ƒiƒ‹‚ɏ‘‚Š‚¸‚É
ƒR[ƒh‚É‹N‚ą‚ľ‚Ä‚ľ‚Ü‚˘‚ť‚¤‚Ĺ‚ˇB

‚Ĺ‚ŕAƒpƒ^[ƒ“‚ĆƒtƒB[ƒ‹ƒh‚đăŽč‚­Žg‚Ś‚Î
FXo—ˆ‚é‹C‚Ş‚ľ‚Ä‚Ť‚Ü‚ľ‚˝B
—á‚đ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

88ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/15(‰Î) 18:59:18
‚ AƒR[ƒh‘‚Ť‚ť‚¤‚Č‚Ě‚ÍŒăŽŇ‚Ĺ‚ˇB
•˝‹Ď‚Ć‚Š‡Œv‚Ý‚˝‚˘‚Čƒ‚ƒm‚É‚Í—Ç‚ł‚ť‚¤‚Ĺ‚ˇ‚ˁB

89ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/15(‰Î) 19:28:50
Ą“ú‘‚˘‚˝ˆęs–ě˜YB
--
awk '{for (ic = 1; ic <= NF; ++ic) {if (max < $ic) max = $ic;}} END {print max;}'
--
‚ą‚ę‚ŕ‘SƒtƒB[ƒ‹ƒh‚ÉŠg’Ł‚ľ‚Ä‚˘‚é‚ž‚Ż‚ŁA’P‚ÉĹ‘ĺ’l‚đ“ž‚Ä‚˘‚é‚ž‚Ż‚ž‚ˁB

90ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/22(‰Î) 16:52:32
‚ć‚­‘‚­ˆęs
du -k|awk '$1 > 10000'
‚Ĺ‚Š‚˘ƒfƒŒƒNƒgƒŠ‚đ‚ł‚Ş‚ˇ

91ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/29(‰Î) 23:34:51
‰´‚Ş‚ć‚­‘‚­ˆęs–ě˜Y
$ awk 1 > hoge.sh

92ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/31(–Ř) 12:58:14
>>91
‚ť‚ę‚ɉ˝‚ĚˆÓ–Ą‚Ş?
cat > hoge.sh‚Ĺ‚ŕŽ–‚Ş‘Ť‚č‚ť‚¤‚ž‚ށB

93ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/01/31(–Ř) 18:48:07
>92
Windows‚Éawk“ü‚ę‚Ä‚˝Žž‚ɁA‚ą‚ń‚Čƒwƒ“‚Č•Č‚Ş•t‚˘‚Ä‚ľ‚Ü‚Á‚˝B

94ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/02(“y) 12:38:28
‚ˇ‚Ý‚Ü‚š‚ńA‰SŽŇ‚Ĺ‚ˇ‚Şawk‚ÉŠÖ‚ˇ‚é˝Ú‚Ş‚ą‚ą‚ľ‚Š‚Č‚Š‚Á‚˝‚̂ŁB
Ť‚Ěƒ\[ƒX‚đ‘‚˘‚Ä‚˘‚˝‚ž‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށA‚˘‚Á‚˝‚˘‚Ç‚¤‚ˇ‚ę‚ÎŽg‚Ś‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚ż‚Ȃ݂ɁA‚ą‚ę‚̓tƒHƒ‹ƒ_“ŕ‚ĚWinrarŒ`ŽŽƒtƒ@ƒCƒ‹‚ĚƒŠƒJƒoƒŠƒŒƒR[ƒh‚Ş•t‚˘‚Ä‚˘‚é‚Š”Ű‚Š
ƒŠƒXƒg‚đˆęŠ‡‚ŏo—Í‚ˇ‚é‚ŕ‚Ě‚Ĺ‚ˇB
‚ć‚ë‚ľ‚ą
**************
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ž‚Ż‚Çunrar lt sample.rar‚̏o—Í—˜—p‚ľ‚ăŠƒXƒg‚đě‚é‚ž‚Ż
Žg‚˘•ű‚̓pƒCƒv‚Ĺawk‚É“n‚ľ‚ďˆ—unrar lt *.rar | gawk -f rr.awk
awk‚Č‚ń‚Š“ü‚Á‚Ä‚Č‚˘‚ž‚낤‚Š‚ç“–‘R‚ť‚Ě‚Ü‚Ü‚ś‚á“Ž‚Š‚Č‚˘

rr.awk
#!/usr/local/bin/gawk

BEGIN {$rr=0; printf "%-30s\t%s\n", "FileName", "RecoveryRecord";}

{if($1=="Solid" && $2=="archive"){
for(i=3;i<=NF;i++) printf "%-30s ",$i;printf "\t";getline;getline;
if($0=="Recovery record is present"){printf "Yes / ";
for(;;){getline;if($0=="Data header type: RR"){getline;printf "%sbyte\n",$2;break;}}
}else printf "No\n";}}

‚ť‚ę‚đ“Ž‚Š‚ˇ‚É‚Í‚Ü‚¸ gawk ‚đ‚Ç‚ą‚Š‚Š‚ç“üŽč‚ˇ‚éB

>>94
>Ť‚Ěƒ\[ƒX‚đ‘‚˘‚Ä‚˘‚˝‚ž‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށA

‘‚˘‚˝l‚É•ˇ‚­B

‚Ć“š‚Ś‚é‚ƁA‚í‚Ż‚Ě‚í‚Š‚ç‚ń——R‚đŒž‚Á‚Ä‚˛‚Ë‚é‚ž‚낤‚Š‚çA
ć‚ÉŒž‚Á‚Ć‚­‚ƁA‚ť‚ń‚ČŒŠ‹ę‚ľ‚˘Œž‚˘–󂡂é‚ȁB

‚Ç‚¤‚š“š‚Ś‚˝‚Á‚āAĄ“x‚́››‚Ş‚í‚Š‚č‚Ü‚š‚ń‚Ć‚ŠŒž‚˘o‚ˇ‚ń‚ž‚ëH
‚Ç‚Á‚Š‚Š‚çgawk‚đ—Ž‚Ć‚ľ‚Ä“WŠJ‚ľ‚ë‚ćB‘S‚­AˆęśƒOƒO‚Á‚Ä‚ë‚ćƒJƒX
"C:\Program Files\WinRAR\UnRAR.exe" lt *.rar | "gawk‚Ěƒtƒ‹ƒpƒX" -f rr.awk

97ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/10(“ú) 19:16:33
‚ˇ‚˘‚Ü‚š‚ńA‚ ‚éƒeƒLƒXƒg‚đ{print $1,$2}‚Ć‚ľ‚Ä’Šo‚ľ‚Ä

aaa 1
aaa 2
aaa 3
bbb 1
bbb 2
ccc 1
ccc 4
...

‚Ć‚Ü‚Ĺ‚Í‚Ĺ‚Ť‚˝‚ń‚Ĺ‚ˇ‚ށA•Ŕ‚ń‚Ĺ‚˘‚éƒf[ƒ^‚đ‚ť‚ę‚ź‚ęA

aaa 6
bbb 3
ccc 5

‚ƏWŒv‚ľ‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA‚ǂ̂悤‚É‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH

98ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/10(“ú) 19:28:07
awk '{count[$1] += $2;} END{for (aaa in count) {print aaa count[aaa]}}'
‚ ‚Ć‚Íƒ\[ƒg‚ˇ‚ę‚΂˘‚˘‚Í‚¸

99972008/02/10(“ú) 20:22:03
>98‚ł‚ńA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇI
î‚Ż‚Č‚˘‚Ě‚Ĺ‚ˇ‚ށAĄ‚Ü‚Ĺ•Ö—˜‚Čƒc[ƒ‹‚É—Š‚Á‚Ä‚˘‚Ä‘S‘RƒRƒ}ƒ“ƒh‚ɂ‚˘‚Ä—‰đ‚Ĺ‚Ť‚Ä‚˘‚Č‚Š‚Á‚˝‚Ě‚Ĺ˘‚Á‚Ä‚˘‚Ü‚ľ‚˝B
ŽŔ‚̓[ƒ‹ƒƒO‚Ĺ‘—MŽŇ‚Ş‚Ç‚ę‚ž‚Ż‚̒ʐ”‚𑗐M‚ľ‚Ä‚é‚Š‚đŠm‚Š‚ß‚é‚˝‚߂ɃRƒ}ƒ“ƒh‚Ĺ‚Ĺ‚Ť‚Č‚˘‚ŠA‚Ĺ>97‚ł‚܂¢‚Ä‚˘‚Ü‚ľ‚˝B
‰˝‚Ć‚Š“r’†‚Ü‚Ĺ‚Ĺ‚Ť‚˝‚ń‚Ĺ‚ˇ‚ށA”ńí‚ɃX[ƒp[ƒGƒŒƒKƒ“ƒg‚Č1sƒR[ƒh‚Ĺ‚ľ‚ācB

Žż–â‚‚˘‚łŐ\‚ľ–ó‚Č‚˘‚Ě‚Ĺ‚ˇ‚ށA
(aaa in count) {print aaa count[aaa]}
‚Ěaaa‚ɂ‚˘‚Ä‚Í‚Ç‚¤‰đŽß‚ˇ‚ę‚΂˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH


100ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/10(“ú) 20:33:27
>>99
bash‚Ć‚Š‚Ěfor‚Ć‚Š‚Ć“Ż‚ś‚Ĺ“K“–‚Č•śŽš—ń‚Č‚ç‚Č‚ń‚Ĺ‚ŕ‚˘‚˘‚Ĺ‚ˇD—á‚ɏo‚Ä‚Ť‚˝aaa‚Č‚ń‚Š‚É‚ˇ‚é‚Š‚ç‚â‚â‚ą‚ľ‚­‚Č‚Á‚Ä‚ˇ‚Ý‚Ü‚š‚ńD
for(hoge in list) {...}
‚Ĺ”z—ńlist‚ĚƒL[‚đ•Đ‚Á’[‚Š‚çhoge‚É“ü‚ę‚㋁[ƒv‚ˇ‚é‚Á‚ĈӖĄ‚É‚Č‚é‚Í‚¸‚Ĺ‚ˇ‚ćD

101ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/10(“ú) 20:36:22
98‚ś‚á‚Č‚˘‚Ż‚Ç

awk '{count[$1] += $2;} END{for (i in count) {printf "%s %i\n", i, count[i]}}'

‚ą‚¤‚â‚Á‚ď‘‚Ż‚΂ľ‚ń‚š‚‚ś‚á‚ˁH
ƒf[ƒ^‚Ě’†‚Ěaaa‚ĆloopƒJƒEƒ“ƒ^[‚Ěaaa‚đ“Ż‚ś–ź‘O‚É‚ˇ‚é‚Ě‚ÍˆÓ’nˆŤ‚ž‚ĆŽv‚¤‚ć


102ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/10(“ú) 20:37:23
101‚Ĺ‚ˇB‚ˇ‚Ü‚ńonz

103‚982008/02/10(“ú) 20:39:44
‚ [A‚Ý‚ń‚ȏ‘‚˘‚Ä‚˘‚é‚Š‚玄‚̏‘‚˘‚˝‚Ě‚Í‘ĺ•‚ɍí‚é‚ŠB
‚ť‚ĚENDƒuƒƒbƒN“ŕ‚́A
for (§Œä•Ď” in ˜A‘z”z—ń) {...;}
‚Ć‚˘‚¤ƒpƒ^[ƒ“B

‚ť‚Ě‘O’i‚Ěcount[$1] += $2‚͈ęs–Ú‚Ě‚Ć‚Ť
count["aaa"] += 1‚ƉđŽß‚ł‚ę‚éBˆČ‰ş“Ż—l‚ɁB
‚ą‚Ěcount‚ޘA‘z”z—ń‚Ć‚ľ‚ÄŽg‚í‚ę‚Ä‚˘‚é‚Ć‚˘‚¤‚ą‚ƁB

104ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/10(“ú) 20:42:05
>>101
c”˝Č‚ľ‚Ä‚Ü‚ˇ

‚˘‚âC‚Ů‚çC‚‚˘‚˘‚‚ŕ‚ĚƒNƒZ‚Łc‚˛‚ß‚ń

105972008/02/10(“ú) 20:52:15
‚˘‚Ś‚˘‚Ś‚˘‚Ś‚˘‚Śc‚ť‚¤‚˘‚¤ˆÓ–Ą‚ś‚á‚Č‚­‚Ä‹ł‚í‚Á‚Ä‚˘‚Č‚Ş‚ç‚ˇ‚˘‚Ü‚š‚ń‚Ĺ‚ˇB
ă‹L‚ŏ‘‚˘‚˝‚Ć‚¨‚č•Ö—˜ƒc[ƒ‹‚É—Š‚čŘ‚Á‚Ä‚Ä–w‚Ç’m‚ç‚Č‚˘Ž„‚ވŤ‚˘‚Ě‚Ĺ‚ˇ‚ށcB
ĄˆęśŒœ–˝3byte’ö“x‚Ě”]‚Ý‚ť‚ŕ׋­‚ľ‚Ä‚é‚ń‚Ĺ‚ˇ‚ށA2“ú–Ú‚ĹÁÜ‚ľ‚ť‚¤‚ĹŽż–â‚ł‚š‚ĖႢ‚Ü‚ľ‚˝cB

‚˝‚Ć‚Ś‚΃ƒO‚É‚Í
Feb 9 22:44:40 localhost postfix/qmgr[1936]: 345C48C0154: from=<use1@example.com>, size=556, nrcpt=1 (queue active)
‚Ć•K‚¸o‚Ü‚ˇB‚ŁA
1,śƒƒO‚đ‚ť‚Ě‚Ü‚Üˆ—‚ˇ‚é‚Ě‚Ş•|‚˘i‘ĺ‚Ť‚Čƒtƒ@ƒCƒ‹j‚̂ŁA“ú•t‚ĹƒƒO‚đ’Šo‚ľ‚Ä•Ęƒtƒ@ƒCƒ‹‚Ö•Ű‘śB
2,grep‚Ĺ nrcpt=‚Ć’Šo‚ľ‚āA‚ł‚ç‚Égrep -v‚ŏœŠO‚ˇ‚éƒhƒƒCƒ“‚đŽw’č‚ľ‚Ä’Šo
3,‚ť‚ľ‚Äsed‚Ĺnrcpt=‚đíœ‚ľ‚Ä
4,‚ą‚ą‚Ĺ>97‚̂悤‚É$7‚Ć$9‚đ•Ŕ‚ׂ˝‚Ć‚ą‚ë‚Ĺ”]‚Ý‚ť‚Ěƒoƒbƒtƒ@ƒGƒ‰[‚đ‹N‚ą‚ľ‚Ü‚ľ‚˝B

‚ą‚̏ˆ—‚Ě•ű–@‚ŕƒGƒŒƒKƒ“ƒg‚Č‚ą‚Ć‚Í•Ş‚Š‚Á‚Ä‚˘‚Ü‚ˇ‚ށA’p‚͏ł’m‚Ĺ‚¨Žf‚˘‚ľ‚˝ŽŸ‘ć‚Ĺ‚ˇcB

106ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/13(…) 07:31:34
gsub‚Ĺ[.*]‚đ’u‚ŤŠˇ‚Ś‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH

107ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/14(–Ř) 02:38:02
>>106
‚ť‚ę‚̓Šƒeƒ‰ƒ‹‚Ć‚ľ‚Ĉľ‚Á‚Ä‚Ć‚˘‚¤‚ą‚Ć‚Š‚˘?
‚Č‚ç‘S•”ƒGƒXƒP[ƒv‚ˇ‚ę‚΂˘‚˘‚ĆŽv‚¤‚މ˝‚Š–â‘č‚Ş‚ ‚é‚Ě?

108ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/16(“y) 01:08:44
awk‚ĹŒťÝŽž‚Š‚çn•Ş‘O‚Š‚çˆČ~‚ĚƒƒO‚ž‚Ż‚𔲂Ťo‚ľ‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠcB
02 15 12:34:56 xxxxxxxxx
02 15 13:45:01 xxxxxxxxx
...
...
...
‚Ć‚Š‚ĚŒ`ŽŽ‚Ȃ̂ŁAstrftime()‚Ć‚Š‚ĹŒťÝ‚ĆƒƒO‚ĚŽž‚đ”äŠr‚ľ‚Ä”˛‚Ťo‚ˇA‚Ć‚Š‚đŽŽ‚ľ‚˝‚ń‚Ĺ‚ˇ‚ރ_ƒ‚Ĺ‚ľ‚˝c

109ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/16(“y) 01:49:16
>>108 ‚ą‚ę‚Ĺ‘Ę–Ú‚Š‚ȁH(ˆę‰ž gawk 3.0.4 ‚Ĺ‚Í“Ž‚˘‚˝)
BEGIN{
n=5
basetime=strftime("%m %d %H:%M:%S", systime()-60*n)
}
{
chktime=substr($0, 1, 14)
if(chktime >= basetime) print
}

110ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/16(“y) 02:23:28
>109

‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇc‘f’ź‚É–Ú‚Ş—Ř‚Ĺ‚ľ‚˝cB

> chktime=substr($0, 1, 14)

‚Č‚ń‚Ĺ‚ˇ‚ˁc
perl‚ŞŽg‚Ś‚Č‚˘ŠÂ‹Ť‚Ȃ̂ŁA‚ą‚ę‚Ş•Ş‚Š‚ę‚΂˘‚낢‚ë—Ź—pŒř‚­‚Ě‚Ĺ•‚Š‚č‚Ü‚ľ‚˝B
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‚ŕ‚¤‚ż‚ĺ‚Á‚Ɛ¸i‚ľ‚Ü‚ˇBBB

111ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/18(ŒŽ) 18:58:36
>>29
đ”N6ŒŽ‚ɁuAWK‚đ256”{Žg‚¤‚˝‚ß‚Ě–{v‚Ş–{‰Ž‚̏‘’I‚É‚ ‚Á‚˝‚Ě‚Ĺ”ƒ‚˘‚Ü‚ľ‚˝B
‰œ•t‚É
1993”N8ŒŽ21“ú‰”Ĺ”­s
2007”N5ŒŽ9“ú@‘ć1”Ĺ‘ć16ü”­s
‚Ə‘‚Š‚ę‚Ä‚˘‚Ü‚ˇB

112ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/18(ŒŽ) 22:32:44
>>111
‚˘‚Â‚ĚƒŒƒX‚ɃŒƒX‚ľ‚Ä‚ń‚ži‚—

ÓÚ‚ŕ”ƒ‚Á‚˝‚Ż‚ǁA‚Ü‚ž‘ĺ‚Ť‚Č–{‰Ž‚ĹŒŠ‚Š‚Ż‚é‚ˁB

113ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/19(‰Î) 02:59:17
>2007”N5ŒŽ9“ú@‘ć1”Ĺ‘ć16ü”­s 

–{‰Ž‚Ě’I‚Ĺ–°‚č‘ą‚Ż‚Ä‚˝‚Á‚Ä‚í‚Ż‚ś‚á‚Č‚˘‚Ě‚Šw

114ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/24(“ú) 00:57:13
–Ú‚Ş—Ř ‚Ɉę’v‚ˇ‚é“ú–{Œę‚Ěƒy[ƒW –ń 1,920 Œ’† 1 - 20 Œ–Ú (0.24 •b)

115ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/02/24(“ú) 01:00:56
ƒƒK—Ř

116ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/03/28(‹ŕ) 21:53:28
sed, awk, ruby ‚đŽg‚¤B
‚ť‚ę‚ź‚ę“KŢ“KŠ‚ĹŽg‚¤‚Ż‚ǁA
used ‚ž‚Żvuawk ‚ž‚Żv‚ĹĎ‚Ü‚š‚ç‚ę‚é‚ƁA
•sŽv‹c‚ČŠě‚Ń‚đŠ´‚ś‚éB

117ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/03/30(“ú) 14:05:33
>>116
‚¤‚żAAIXŽg‚Á‚Ä‚é‚ń‚Ĺksh+sed+awk+perl‚ž‚ȁB
ruby‚Ş•W€‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚Ä‚éŠÂ‹Ť‚Á‚Ä‚ ‚ń‚Ü‚Č‚˘‚ĆŽv‚¤B

118ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/03/30(“ú) 16:22:26
ŒĂ‚˘ƒT[ƒo‚ž‚ĆPerl‚ˇ‚ç“ü‚Á‚Ä‚Č‚˘Ž–‚Ş‚ ‚é‚Š‚çawk‚͏d•ó‚ˇ‚éB

119ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 10:26:45
Ĺ‹ß‚Ěgawk‚ރlƒbƒgƒ[ƒN‚É‚ŕŽg‚Ś‚é‚Ć’m‚Á‚Ä‚ż‚ĺ‚Á‚Ć‹Á‚˘‚˝‚—
ƒJ[ƒjƒnƒ“‚Ě–{ƒŒƒxƒ‹i‚Ć‚Š256”{j‚ľ‚Š’m‚ç‚Č‚˘l‚Á‚Ä‘˝‚˘‚ĆŽv‚¤B

120ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 12:44:41
ƒm[ƒ}ƒ‹‚Ěawk‚ĹXML‚đŽš‰ş‚°‚ľ‚˝‚č‚ľ‚Ä‚¤‚Ü‚­•\ŽŚ‚ł‚š‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ě‚Š‚ȁEEE

121ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 17:09:18
sed‚ž‚Ż‚ŏ‘‚Ż‚é‚ƁA‰´‚Á‚ēރCƒC‚Š‚ŕ‚Á‚ÄŽv‚¤B

#!/bin/sed -f

122ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 17:16:17
•śŽš—ń‚Ě’Pƒ‚Č’uŠˇ‚ž‚Ż‚Č‚çawk‚ć‚čŠČ’P‚ɏ‘‚Ż‚é‚ń‚ž‚Ż‚ǁB
awk‚ÉŒĹŽˇ‚ľ‚Č‚˘‚Ĺ—Ő‹@‰ž•Ď‚Ésed‚đŽg‚¤‚Á‚ĈӖĄ‚Ĺ‚Č‚ç—v—Ě‚Ş‚˘‚˘‚Ć‚˘‚¤ˆÓ–Ą‚ĹŒŤ‚˘‚Ż‚ǁB
# awk‚ŏ‘‚˘‚˝•ű‚ŞŠČ’P‚Č‚ą‚Ć‚đsed‚ĹŠć’Ł‚Á‚ď‘‚˘‚˝‚Ě‚ž‚Ć‚ľ‚˝‚çA‚ť‚ĚˆÓ–Ą‚Ĺ‚Í“ŞˆŤ‚˘‚Čw

123ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 17:34:45
awk‚Š‚çsystem‚ĹsedŒÄ‚Ô‚ą‚Ć‚ÍŽžX‚ ‚é‚—

124ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 18:49:04
>>24
awk‚Á‚Ä•\ŒvŽZ‚̂悤‚ȏˆ—‚É“Á‰ť‚ľ‚Ä‚Ü‚ˇ‚ć‚ˁB
‚ť‚Ě“_‚Ş”ńí‚Ƀ†ƒj[ƒN‚Ć‚˘‚¤‚ŠŽ––ąˆ—‚ĚŒžŒę‚ž‚ȁA‚ƁB
visicalc(1979)awk(1977)‚Ĺ‚ˇ‚Š‚çawk‚Ě‚Ů‚¤‚ŞŽáŠąŒĂ‚˘‚ń‚Ĺ‚ˇ‚ށA
•\ŒvŽZ‚̓Zƒ‹‚É’źÚŽŽ‚đ‘‚­‚Ć‚˘‚¤”­‘z‚ސV‚ľ‚Š‚Á‚˝B‚¤‚ނށB

125ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/06(“ú) 19:26:56
VisiCalc‚̍lˆÄŽŇDan Bricklin‚É‚ć‚éƒAƒCƒfƒA‚Ěŕ–ž
ttp://www.danbricklin.com/history/saiidea.htm

Dan‚Ě“d‘ě‚ŞHP‚ś‚á‚Č‚­‚ÄTI‚Č‚Ě‚ŞˆÓŠO‚ČŠ´‚śB
The idea for the electronic spreadsheet came to me while I was a student at the Harvard Business School, working on my MBA degree, in the spring of 1978.
Sitting in Aldrich Hall, room 108, I would daydream.
"Imagine if my calculator had a ball in its back, like a mouse..." (I had seen a mouse previously, I think in a demonstration at a conference by Doug Engelbart, and maybe the Alto).
And "..imagine if I had a heads-up display, like in a fighter plane, where I could see the virtual image hanging in the air in front of me.
I could just move my mouse/keyboard calculator around, punch in a few numbers, circle them to get a sum, do some calculations, and answer '10% will be fine!'"
(10% was always the answer in those days when we couldn't do very complicated calculations...)

126ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 02:52:10
‚Í‚ś‚ß‚Ü‚ľ‚Ägawk‚ĚŽż–â‚Ĺ‚ˇ
‚¨Žč‚ˇ‚Ť‚ĚŽž‚É‚Ĺ‚ŕ‚˛‰đ“š’¸‚Ż‚Ü‚ľ‚˝‚珕‚Š‚č‚Ü‚ˇ

2ch‚Ĺ‚¨˜b‚ľ‚Ä‚˘‚˝‚ž‚˘‚˝•ű‚Š‚çgawk‚đ‹ł‚Ś‚Ä’¸‚Ť‚Ü‚ľ‚˝
ł‹K•\Œť‚Ĺƒ}ƒbƒ`‚ľ‚˝•”•Ş‚Ş‚˘‚­‚‚ ‚Á‚Ä‚ŕ‘S‚Ä‚Ě‰ÓŠ‚đ1ƒAƒNƒVƒ‡ƒ“‚Ĺ•Ű‘ś‚Ĺ‚Ť‚é—D‚ę‚ŕ‚Ě‚Ĺ‚ˇ
“–•űAŒžŒę‚Í‘S‚­’m‚ç‚Č‚˘‚̂Őć‚Ů‚Ç‚Ü‚ĹƒeƒXƒgŽŔs‚ľ‚Ä‚Í‹Á‚˘‚Ä‚˘‚Ü‚ľ‚˝
‚ą‚Ě—D‚ę‚ŕ‚Ě‚đĄŒă––‰i‚­Žg‚Á‚Ä‚˘‚Ť‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş
‰ş‹L‚ĚŽ–€‚đƒOƒO‚Á‚ÄŒŠ‚˝‚Ě‚Ĺ‚ˇ‚Ş‚í‚Š‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝
‚Ç‚Č‚˝‚Š‚í‚Š‚é•ű‚¨‚ç‚ę‚Ü‚ľ‚˝‚ç‹ł‚Ś‚ĉş‚ł‚˘

Ž„‚Ě‚â‚č‚˝‚˘‚ą‚Ć
EEUC‚đ“ǂݍž‚ń‚ĹS-JIS‚đo—Í
EŠů‘ś‚ĚƒeƒLƒXƒg––”ö‚ɒljÁ‘‚Ťž‚Ý•Ű‘ś
i‹ł‚Ś‚Ä’¸‚˘‚˝ƒXƒNƒŠƒvƒg‚Íă‘‚Ť•Ű‘ś‚Č‚Ě‚Ĺo—͐ć‚Ě“ŕ—e‚ޏÁ‚Ś‚Ä‚ľ‚Ü‚˘‚Ü‚ˇj

‹C’ˇ‚É‘Ň‚Á‚Ä‚˘‚Ü‚ˇ‚̂ʼn˝‘˛‚ć‚ë‚ľ‚­‚¨Šč‚˘’v‚ľ‚Ü‚ˇ

127ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 03:10:31
>>126
‘OŽŇ‚Íawk‚Ĺ‚â‚é‚ׂŤ‚ą‚Ć‚Ĺ‚Í‚Č‚˘Biconv, nkf‚Č‚Ç‚ť‚ęę—p‚Ěƒc[ƒ‹‚Ş‚ ‚éB
ŒăŽŇ‚ŕ•K‚¸‚ľ‚ŕawk‚Í•s—vBƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ŞŽg‚Ś‚éŠÂ‹Ť‚Ȃ畁’Ę‚É‚Ĺ‚Ť‚éB
—á‚Ś‚΁AUnixŒn‚Č‚ç cat append.txt >> original.txt ‚ĹŠů‘ś‚Ěƒtƒ@ƒCƒ‹‚ɒljÁ‚Ĺ‚Ť‚éB
DOSŒn‚Ĺ‚ŕAtype append.txt >> original.txt ‚Ĺ‚Ĺ‚Ť‚éB
—v‚́Aawk‚Ě‚˘‚˘‚Ć‚ą‚ë‚Í‚ť‚ę’P‘Ě‚Ĺ‚Č‚ń‚Ĺ‚ŕ‚Ĺ‚Ť‚é(ˆ˝‚˘‚Í‚Ĺ‚Ť‚Č‚˘)‚ą‚Ć‚Ĺ‚Í‚Č‚­A
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ŠÂ‹Ť‚Ĺ—Í‚đ”­Šö‚ˇ‚éƒc[ƒ‹‚Ĺ‚ ‚é‚ą‚ƁB

—á‚Ś‚΁Ał‹K•\Œť‚Ĺƒ}ƒbƒ`‚ľ‚˝•śŽš—ń‚đ’uŠˇ‚ˇ‚é‚ž‚Ż‚Č‚çƒeƒLƒXƒgƒGƒfƒBƒ^‚Ĺ‚ŕ‚Ĺ‚Ť‚éB
‚ [‚ť‚¤‚ť‚¤AƒGƒfƒBƒ^‚Ş‚ ‚ę‚ΕśŽšƒR[ƒh‚Ě•ĎŠˇ‚ŕ‚ť‚ę‚ž‚Ż‚Ĺ‚Ĺ‚Ť‚éB
ŠˆŕƒeƒLƒXƒgƒGƒfƒBƒ^‚đŽg‚Á‚˝‚ą‚Ć‚Ş‚Č‚˘‚Č‚çAˆę“x(ł‹K•\ŒťŒŸő‹@”\A
•śŽšƒR[ƒh•ĎŠˇ‹@”\‚Ě‚ ‚é)ƒeƒLƒXƒgƒGƒfƒBƒ^‚đG‚Á‚Ä‚Ý‚é‚Ć‚˘‚˘‚Š‚ŕ‚ľ‚ę‚Č‚˘B

128ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 03:32:54
>>127‚ł‚ń
>>126‚Ĺ‚ˇ
‚¨”ć‚ę‚Ě‚Ć‚ą‚둁X‚Ě‚˛‰đ“š˝‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
ƒRƒ“ƒo[ƒg‚Í•Ę‚Ěƒc[ƒ‹‚ōs‚¤
DOSŠÂ‹Ť‚Ĺ‚Ítype append.txt >> o—͐ćƒtƒ@ƒCƒ‹–ź‚ŒljÁ‘‚Ťž‚Ý
—š‰đ‚ľ‚Ü‚ľ‚˝
ƒGƒfƒBƒ^[‚͏GŠŰƒGƒfƒBƒ^[‚đŽg‚Á‚Ä‚˘‚Ü‚ˇ
ƒRƒ“ƒo[ƒg‚͏o—ˆ‚é‚Ě‚Ĺ‚ˇ‚ŞŒŸő‚Ĺƒ}ƒbƒ`‚ľ‚˝•śŽš—ń‚Í1‰ÓŠ‚¸‚ƒRƒs[‚Č‚ń‚Ĺ‚ˇ
sakuraƒGƒfƒBƒ^[‚ĹˆęŠ‡ƒRƒs[‚âŘ‚čŽć‚č‚Şo—ˆ‚é‚Ć‹ł‚Ś‚Ä‚­‚ę‚˝•ű‚ŕ‚˘‚Ä‚˝‚Ě‚Ĺ‚ˇ‚Ş
sakuraƒGƒfƒBƒ^[‚ÍŽŽ‚ľ‚˝‚ą‚Ć‚Ş–ł‚˘‚ń‚Ĺ‚ˇ
Ú‚ľ‚­‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝

129ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 03:56:33
AAA.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ƀy[ƒXƒg‚ˇ‚é

BBB.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ě––”ö‚Ƀy[ƒXƒg‚ˇ‚é

CCC.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ě––”ö‚Ƀy[ƒXƒg‚ˇ‚é

‚ć‚ë‚ľ‚­‚¨Šč‚˘‚ľ‚Ü‚ˇ

130ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 04:02:07
>>127‚ÍŒ‹‹Çawk‚̉𓚂͂ľ‚Č‚˘‚Ě‚É‚Č‚ń‚Ĺ‚ľ‚á‚ľ‚á‚čo‚Ä‚Ť‚˝‚́H
‚Ĺ‚Ť‚Č‚˘‚ś‚á‚ń

131ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 06:48:34
>>130
Žż–â‚É‹ď‘̐Ť‚Ş‚Č‚˘‚Š‚çˆę”Ę˜_‚đ‘‚˘‚˝‚ž‚Ż‚ž‚Ż‚ǁB

>>129
awk '/“Œ‹ž(.+?)†Žş/ {print > "TEST.txt";}' AAA.txt
awk '/“Œ‹ž(.+?)†Žş/ {print >> "TEST.txt";}' BBB.txt
ˆČ‰ş“Ż—l‚ɁB

132ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 12:02:34
>>131
ƒŒƒX‚ ‚č‚Ş‚Ć
gawk '/“Œ‹ž(.+?)†Žş/ {print > "TEST.txt";}' AAA.txt
gawk '/“Œ‹ž(.+?)†Žş/ {print >> "TEST.txt";}' BBB.txt
ƒtƒ@ƒCƒ‹–źAƒfƒBƒŒƒNƒgƒŠ–źA‚Ü‚˝‚̓{ƒŠƒ…[ƒ€@ƒ‰ƒxƒ‹‚̍\•ś‚ŞŠÔˆá‚Á‚Ä‚˘‚Ü‚ˇB
gawk3.16‚Ĺ‚ÍŽg‚Ś‚Č‚˘H


133ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 13:29:56
>>132
DOS‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚŽg‚˘•ű‚Í‘źŠ‚Ĺ•ˇ‚˘‚Ä‚­‚ęB

134ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 13:38:24
–đŠ‚Ě‘‹Œű‚Ý‚˝‚˘‚ȑΉž‚ž‚ȁB

135ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 13:43:47
DOS‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ɂ‚˘‚Ä‚Í‘˝‚­‚đ’m‚ç‚Č‚˘‚ń‚ž‚ćB

136ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 16:36:42
DOS‚Ěę‡‚Í‹ó”’‚đŠÜ‚Ţę‡ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚ś‚áƒ_ƒ‚ž‚Š‚ç‚ȁB
ƒ_ƒuƒ‹ƒNƒH[ƒg‚ĹŠ‡‚Á‚Ä’†‚ĚƒR[ƒh‚Í
ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚ŠAƒGƒXƒP[ƒv‚ľ‚ă_ƒuƒ‹ƒNƒH[ƒg“ü‚ę‚é‚ŠB

ˆę”ÔŠČ’P‚Ȃ̂́Aƒƒ“ƒ‰ƒCƒi[‚Ĺ‚ŕƒtƒ@ƒCƒ‹‚É‹N‚ą‚ľ‚Ä‚ľ‚Ü‚¤‚ą‚ƁB
gawk -f myscript.awk AAA.txt
‚Ć‚â‚Á‚Ä‚ľ‚Ü‚Ś‚΁AƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚Ć‚Šƒ_ƒuƒ‹ƒNƒH[ƒg‚Ć‚Š‹C‚É‚ˇ‚é•K—v‚Í‚Č‚˘B

137ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/07(ŒŽ) 18:22:15
>>132
“ń‚–â‘č‚Ş‚ ‚éB
gawk‚̐ł‹K•\Œť‚Ĺ‚Í.+?‚Ć‚˘‚¤‚Ě‚ÍŽg‚Ś‚Č‚˘B
cmd.exe‚ł́AƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚đˆř”‚đ
‚­‚­‚é‚Ě‚ÉŽg‚Ś‚Č‚˘B

‚Č‚ń‚Š‚ć‚­‚í‚Š‚ç‚ń‚ށAperl‚ĹƒeƒLƒXƒg‚đŠŰˆů‚Ý‚ľ‚Ä‚Š‚ç
ˆ—‚ˇ‚ę‚΂˘‚˘‚ń‚ś‚á‚Č‚˘‚Ě‚ŠH

138ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/12(“y) 19:00:42
VisiCalc ‚Ć‚˘‚Ś‚΁AoŽn‚ß‚Ě ‚É TRS-80 —p ‚đ Radio Shack ‚ĹŒŠ‚š‚Ä‚ŕ‚ç‚Á‚˝‚ń‚ž‚Ż‚ǁAŠwś‚ž‚Á‚˝Ž„‚ɂ͉ż’l‚Ş‚í‚Š‚ç‚Č‚Š‚Á‚˝‚Č‚ŸB
‚Ü‚ŸA‚ą‚ę‚ÉŒŔ‚炸Aw‚Č‚ń‚Ĺ‚ą‚ń‚ČƒRƒ}ƒ“ƒh‚âƒIƒvƒVƒ‡ƒ“‚Ş‚ ‚é‚ń‚žHx‚Á‚Ä‚Ě‚Í‘˝‚˘B
Žg‚˘•ű‚ś‚á‚Č‚­A‚Č‚ş‚ť‚ę‚Ş‚ ‚é‚Ě‚Š‚đ•ďŠ‡“I‚ɉđŕ‚ľ‚˝–{‚â web site ‚Á‚Ä‚ ‚č‚Ü‚ˇ‚ŠB(‚˝‚Ć‚Ś‚Α˝‚­‚Ě unix ƒRƒ}ƒ“ƒh‚đ–Ô—…‚ľ‚Ä‚˘‚é‚Ć‚Š)

139ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/12(“y) 19:01:22
‚ ‚ AƒXƒŒˆá‚˘‚ž‚Á‚˝B‚˛‚ß‚ń‚˛‚ß‚ńB

140ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/04/12(“y) 19:58:47
‚Č‚ń‚Ć‚˘‚¤Œë”š

141ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/05/06(‰Î) 02:42:04
>>132 ‚ŕ‚¤‹‚Č‚˘‚Š‚ȁBgawk3.1.6 + nkf2.0 Žg—p@cmd.exe

C:\work>type aaa.txt (ŚEUC‚Ȃ̂ʼnť‚Ż‚鎖‚đŠm”F)
¤Ű¤˛¤Ű¤˛
ŁEšćźź
ŁEŁ˛šćźź
ŁEŁąŁ°šćźź
ŁE¤Ű¤˛šćźź
ŁE¤Ő¤ŹšEŁEŐ¤Źšćźź
ŁEŁłšćźź¤ČŁEŁľšćźź

C:\work>nkf -Es AAA.txt
‚Ů‚°‚Ů‚°
“Œ‹ž†Žş
“Œ‹ž‚Q†Žş
“Œ‹ž‚P‚O†Žş
“Œ‹ž‚Ů‚°†Žş
“Œ‹ž‚ӂލ†
“Œ‚ӂލ†Žş
“Œ‹ž‚R†Žş‚Ć“Œ‹ž‚T†Žş

C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žş/{print $0}"
“Œ‹ž†Žş
“Œ‹ž‚Q†Žş
“Œ‹ž‚P‚O†Žş
“Œ‹ž‚Ů‚°†Žş
“Œ‹ž‚R†Žş‚Ć“Œ‹ž‚T†Žş

Šůo‚Ě’Ę‚č•śŽš•ĎŠˇnkf(>>127) ł‹K•\Œť‚̐§–ń‚ĹđŒ•ĎX(>>137)
ŽŔŰ‚ÉŽg‚¤ę‡‚Í‚ą‚ń‚ČŠ´‚ś‚Ĺƒoƒbƒ`ě‚é‚Ć‚ŠB
C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žş/{print $0}" >>TEST.txt

1421412008/05/06(‰Î) 02:56:02
‚ƁA•ű–@‚đ‘‚˘‚Ä‚¨‚˘‚ăAƒŒ‚ž‚Ż‚ǁA
GŠŰŽg‚Á‚Ä‚é‚Č‚çgrep‚ĚŽŔs‚ĹŒŸő‚ˇ‚éƒtƒ@ƒCƒ‹‚É(ŒťÝ‚Ě“ŕ—e)‚Ĺ
ŒŸőŒ‹‰Ę‚Š‚çƒtƒ@ƒCƒ‹–ź‚ƍs”ԍ†‚đœ‹Ž‚ˇ‚é‚Ě‚Ĺ‚ŕ‚Ĺ‚Ť‚ť‚¤‚Č‹C‚Ş‚ˇ‚éB
ˇ‘ĺ‚ɃXƒŒˆá‚˘‚ž‚Ż‚ǁB

143ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/05/06(‰Î) 14:28:43
>>142‚ł‚ń
‚ ‚č‚Ş‚Ć
‚Ü‚žŽv‚¤‚悤‚É‚Ĺ‚Ť‚Ä‚˘‚Č‚˘‚ń‚ž
ŽQl‚É‚Č‚é‚抴ŽÓ‚Ĺ‚ˇ

144ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/16(ŒŽ) 01:50:26
‚Đ‚Ĺ‚Ś‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—

145ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/16(ŒŽ) 01:50:57
‚ˇ‚Ü‚ńŒë”š

146ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 02:17:58
Žż–â‚Ĺ‚ˇI

ˆČ‰ş‚Ěƒtƒ@ƒCƒ‹hoge‚Š‚çawk‚ŁA‰żŠi‚𔲂Ťo‚ľ‚č‡Œv’l‚đo‚ľ‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇB
ƒtƒ@ƒCƒ‹‚Ě“ŕ—e‚́A‘Đ–ź‚ƉżŠi‚Ĺ‚ˇB‰żŠi‚͈ę”ÔŒă‚ë‚̐”Žš‚É‚Č‚č‚Ü‚ˇB

----------------------
$ cat hoge
‚ť‚ꂢ‚ŻI‚ ‚ń‚Ď‚ń‚Ü‚ń 1000
ƒƒ^ƒ{ƒŠƒbƒN‚đŒ‚‘Ţ‚š‚ć 1000
‰ş—ŹŽĐ‰ď 1000
ă—ŹŽĐ‰ď‚Ɖş—ŹŽĐ‰ď “ú–{‚Ě‚ą‚ę‚Š‚ç 1000
˜_•ś 2008 “ú–{‚Ě•ř‚Ś‚é–â‘č 1000
˜_•ś 2007 “ú–{‚Ě•ř‚Ś‚é–â‘č ‰ß‹Ž–â‘čW 1000
----------------------

“ď‚ľ‚˘‚Ě‚ŞA‘Đ–ź‚Ě2008‚â2007‚Ȃǂ̐”’l‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚ą‚Ć‚â‹ó”’‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚ą‚Ć‚Ĺ‚ˇB
1s–Ú‚Ěę‡2—ń–ڂމżŠi‚É‚Č‚č‚Ü‚ˇ‚ށA2s–Ú‚Ěę‡4—ń–ڂމżŠi‚Ć‚Č‚č‚Ü‚ˇB

‚ą‚̂悤‚Ɉę”ÔĹŒă‚Ě—ńi‰żŠij‚đŽć“ž‚ľA‡Œv’l‚đŒvŽZ‚ˇ‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂悢‚Ĺ‚ľ‚傤‚ŠH

‚˛‹łŽŚ‚¨Šč‚˘‚˘‚˝‚ľ‚Ü‚ˇB



147ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 02:28:00
awk '{x+=$NF}END{print x}' hoge

148ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 09:33:15
x‚ś‚á‚Č‚­‚Äsum‚Ć‚Š‚É‚ľ‚悤‚ćB

149ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 13:36:51
ˆęs–ě˜Y‚͎萔i‘Ő”jdŽ‹‚Č‚ń‚ś‚á‚Ü‚˘‚Š

150ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 15:27:28
“ď‚ľ‚˘‚Á‚ă}ƒjƒ…ƒAƒ‹“Ç‚ß‚ÎĹŒă‚Ě—v‘f‚đŽw‚ˇ‚ŕ‚Ě‚Ş‰˝‚Š‘‚˘‚Ä‚ ‚é‚ĆŽv‚¤‚Ş

151ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 16:09:13
“Ç‚ń‚Ĺ‚˝‚ç‘źl‚É‚Č‚ń‚Š•ˇ‚Ť‚Ü‚š‚ńB

152ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/25(…) 16:34:16
‚ś‚á‚ Aƒ}ƒjƒ…ƒAƒ‹“Ç‚ń‚Ĺ‚ŕ‚í‚Š‚ç‚Č‚Š‚Á‚˝‚炨Žčă‚°‚Š

153ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/06/29(“ú) 21:37:04
Windows ”Ĺ‚Ě gawk-3.1.5 ‚Ĺ`‘o•űŒüƒpƒCƒv‚Ş‚¤‚Ü‚­“Žě‚ľ‚Ü‚š‚ńBˆČ‰şA
http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html#SEC182
‚Š‚ç‚ĚƒTƒ“ƒvƒ‹ƒtƒ@ƒCƒ‹‚Ĺ‚ˇ‚ށA“r’†‚ĹŽ~‚Ü‚Á‚Ä‚ľ‚Ü‚Á‚āA•ÔŽ–‚Ş•Ô‚Á‚Ä‚Ť‚Ü‚š‚ńB

BEGIN {
command = "sort"
n = split("abcdefghijklmnopqrstuvwxyz", a, "")

for (i = n; i > 0; i--)
print a[i] |& command
close(command, "to")

while ((command |& getline line) > 0)
print "got", line
close(command)
}

Cygwin ‚Ě gawk ‚Ĺ‚Í–â‘č‚ ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B

154ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/01(‰Î) 20:42:14
‚ą‚ęŽg‚¤‚Ć‚˘‚˘‚ć
ttp://www.pipeunish.jp/

155ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 01:35:15
‚Ç‚¤‚â‚Á‚˝‚ç Cygwin ‚Ě gawk(GNU Awk 3.1.6) ‚Ĺ print length("‚ ‚˘‚¤") ‚Ş 3 ‚É‚Č‚é‚Ě‚Ĺ‚ˇ‚ŠH

156ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 02:13:54
Windows‚Ěƒo[ƒWƒ‡ƒ“‚­‚炢‘‚ą‚¤‚ȁB‚Ĺ‚Č‚˘‚Ć’Ţ‚č‚ĆŽv‚í‚ę‚é‚ć

157ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 08:51:57
jgawk?

158ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 09:32:16
gawk.dll‚Á‚āA‚Ü‚ž’N‚Šƒƒ“ƒe‚ľ‚Ä‚­‚ž‚ł‚Á‚Ä‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
ĹV”Ĺgawk‚Ědll‚đ’T‚ľ‚Ä‚é‚ń‚Ĺ‚ˇ‚ށAŒŠ‚‚Š‚č‚Ü‚š‚ńB

‚Ü‚˝‚́Aƒ\[ƒX‚Ětar.gz‚Š‚çdll‚đě‚é•ű–@‚ލڂÁ‚Ä‚˘‚éƒy[ƒW‚đ
Œä‘ś’m‚Ě•ű‚Ş‚˘‚ç‚Á‚ľ‚Ⴂ‚Ü‚ľ‚˝‚çA‹ł‚Ś‚Ä‚˘‚˝‚ž‚Ż‚é‚Ə•‚Š‚č‚Ü‚ˇB

159ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 10:34:53
‚Č‚É‚đ‚˘‚Á‚Ä‚é‚Ě‚Š‚í‚Š‚ç‚ń
ƒ\[ƒX‚Ětar.gz‚Á‚ĂȂɁH

160ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 10:42:47
http://ftp.gnu.org/gnu/gawk/ ‚Š‚çƒ_ƒEƒ“ƒ[ƒh‚Ĺ‚Ť‚égawk-*.tar.gz‚Ě‚ą‚Ć‚Ĺ‚ˇ‚ށBB
source‚Š‚çgawk.exe‚đě‚Á‚˝‚č‚ľ‚Č‚˘‚Ě‚Ĺ‚ˇ‚ŠHH

dll‚Ə‘‚˘‚Ä‚˘‚é‚Ě‚Ĺ‚í‚Š‚é‚Š‚Ć‚ÍŽv‚˘‚Ü‚ˇ‚ށA
windowsŠÂ‹Ť‰ş‚Ĺ‚Ě˜b‚Ĺ‚ˇB•’i‚Ícygwin‚Ĺmake‚ľ‚˝gawk‚đŽg‚Á‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚ށA
dll‚Ş‚ ‚é‚Ć‘ź‚ĚŒžŒę‚Š‚çŒÄ‚яo‚ľ‚ÄŽg‚Ś‚é‚Ě‚Ĺ•Ö—˜‚Š‚ȁ[‚ĆŽv‚Á‚Ä‚Ü‚ˇB

161ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 10:45:49
cygwin‚Íwin—p‚Ěƒ\[ƒX‚ś‚á‚Č‚˘‚Š‚ç
win—p‚Ěƒ\[ƒX‚Ş‚˘‚é

162ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 11:53:32
>>160
Ě‚ ‚Á‚˝DLL”Ĺ‚ÍěŽŇ‚Ş“ĆŽŠ‚ɍě‚Á‚˝‚ŕ‚Ě‚Ý‚˝‚˘‚Ĺ
–{‰Ć‚É”˝‰f‚ł‚ę‚Ä‚Č‚˘‚Š‚ç–{‰Ć‚Ěƒ\[ƒX‚Š‚çDLL‚đě‚é‚Ě‚Í–ł—B
DLL”Ĺ‚Ěƒ\[ƒX‚đŽQl‚É‚ľ‚ÄŽŠ—Í‚Ĺě‚é‚Š
‚Ĺ‚Ť‚Č‚˘‚Č‚çěŽŇ‚ɘA—‚ľ‚Ä‹Ś—Í‚đ‹‚ß‚é‚ľ‚Š‚Č‚˘B

163ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/02(…) 12:05:07
>>160
ŽŠ•Ş‚ʼnüC‚ˇ‚é‚ľ‚Š‚Č‚˘‚ž‚ë

164ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/03(–Ř) 02:36:53
(ɁÍ`)@ą˛ŔŔŔ

1651552008/07/05(“y) 15:47:31
>156
XP [Version 5.1.2600] ‚Ĺ‚Â

>>153
‚Ü‚žŒŠ‚Ä‚é‚Š?
‘˝•Ş‚Č‚¨‚Á‚Ä‚é‚ĆŽv‚¤‚ń‚ŐV‚ľ‚˘‚Ě‚ĹŽŽ‚ľ‚Ä‚Ý‚Ä‚­‚č‚âB

167ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/06(“ú) 06:36:13
‚¤‚¨H
ěŽŇ~—Ő‚Š

168ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/06(“ú) 07:02:21
‚ˇ‚ń‚΂炡‚Ą

169ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/20(“ú) 00:40:48
AWK@Žg‚Á‚Ä‚P‚T”NH@‚R‚O”N‘O‚ĚƒR[ƒh‚Ş“f‚Ťo‚ˇƒf[ƒ^‚đ‚ż‚ĺ‚ą‚Á‚Əˆ—‚ľ‚悤‚Ć‚ľ‚āc
FS=/[ ()]+/ ‚ÍŠú‘Ň’Ę‚č‚Ě“Ž‚Ť‚đ‚š‚¸AFS="[ ()]+" ‚Ə‘‚Š‚˂΂Ȃç‚Č‚˘B
‰‚ß‚Ä’m‚Á‚˝B
@ŒŸő‚ľ‚Ä‚ŕA‚ą‚ę‚ɂ‚˘‚Ä–ž‰ő‚ɏ‘‚˘‚Ä‚ ‚éƒy[ƒW‚Ş‚Č‚Š‚Č‚ŠŒŠ‚‚Š‚ç‚Č‚Š‚Á‚˝‚Ş
„ł‹K•\Œť’萔‚Ş‚ť‚ꎊg‚Ć‚ľ‚ÄŒť‚ę‚˝‚Ć‚ŤA‚ť‚ę‚̓pƒ^[ƒ“’†‚ÉŒť‚ę‚˝‚Š‚̂悤‚ɁA
„‚‚܂č`($0 ~ /foo/)' ‚̂悤‚É‚Ý‚Č‚ł‚ę‚éB
<’†—Ş>
„ŒžŒę‚Ě‚ą‚Ě‹@”\‚́APOSIX•W€‚Ü‚ĹƒhƒLƒ…ƒƒ“ƒg‰ť‚ł‚ę‚Č‚Š‚Á‚˝B
orz
@‚ą‚ę‚Ĺ‚PŽžŠÔ‚Ž‚炢ƒ€ƒ_‚É‚ľ‚˝BŽ„‚Ş’m‚ç‚Č‚Š‚Á‚˝‚ž‚Ż‚Ĺ‚ˇ‚ŠHH

170ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/20(“ú) 00:58:40
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKx‚É‚Íˆę‰žÚ‚Á‚Ä‚é‚Ż‚Ç‚Č
> iFS‚É‘ă“ü‚ł‚ę‚éj•śŽš—ń‚Ş1•śŽš‚ć‚č’ˇ‚˘‚Ć‚Ť‚́Cł‹K•\Œť‚Ć‚ľ‚Ĉľ‚í‚ę‚é

171ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/20(“ú) 01:10:48
ƒxƒ‹Œ¤Œn“‚ĚŒžŒę‚Í‹Lq‚ĚŽŠ—R“x‚Í‚ ‚é‚Ş‹““Ž‚ނ‚Š‚݂Â炢

172ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/20(“ú) 02:09:53
>>170
@hh‚ĹˆÍ‚ń‚ž•śŽš—ń‚ސł‹K•\Œť‚Ć‚ľ‚Ĉľ‚í‚ę‚é@‚Ć‚˘‚¤‚ą‚Ć‚Ć
@//‚ĹˆÍ‚ń‚žł‹K•\Œť’萔‚ŏ‘‚˘‚Ä‚Í‚˘‚Ż‚Č‚˘@‚Ć‚˘‚¤‚ą‚Ć‚Í“Ż‚ś‚Ĺ‚Í‚Č‚˘B
ŽŔŰAsplitŠÖ”‚́@‘ć‚Rˆř”‚É—^‚Ś‚鐳‹K•\Œť‚́@‚Ç‚ż‚ç‚Ĺ‚ŕ“Ž‚­
@‚ނނށA‚ą‚ą‚Ĺ‚Í($0~/foo/)‚É’u‚ŤŠˇ‚Ś‚Ä•]‰ż‚ł‚ę‚Č‚˘‚ń‚žc
171‚ĚˆÓŒŠ‚ސł‚ľ‚˘‚悤‚ž‚ˁ@ƒ`ƒƒƒ“ƒ`ƒƒƒ“


173ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/21(ŒŽ) 12:39:44
•Ą”‚Ěƒtƒ@ƒCƒ‹‚Ě“Ç‚Ýž‚Ý‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
print ƒtƒ@ƒCƒ‹1‚Ě$2 ƒtƒ@ƒCƒ‹2‚Ě$1
‚Ý‚˝‚˘‚ČŠ´‚ś‚Ĺ

174ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/21(ŒŽ) 13:06:32
>>173
paste‚ĹŒq‚˘‚ś‚áƒ_ƒ?
Ž„‚Í‚ć‚­‚â‚é‚Ż‚ǁB
‰ź‚Ƀtƒ@ƒCƒ‹1‚Ş5ƒJƒ‰ƒ€ŒĹ’č‚Č‚çA
paste ƒtƒ@ƒCƒ‹1 ƒtƒ@ƒCƒ‹2| awk '{print $2 $6;}'
‚Ä‚ČŠ´‚ś‚ŁB
# ƒJƒ‰ƒ€”‰Â•Ď‚Č‚ç‚ŕ‚¤ˆę”P‚č•K—v‚ž‚Ż‚ǂˁB

175ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/21(ŒŽ) 13:50:02
>>173
awk‚ž‚Ż‚Ĺ‚â‚č‚˝‚˘‚Č‚çgetline‚đŽg‚Ś‚΂łŤ‚éB

176ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/22(‰Î) 18:37:52
awk‚ˇ‚˛‚˘•Ö—˜‚ŁAgnuplot‚Ć‘g‚ݍ‡‚í‚š‚ÄExcel‚Š‚ç‰đ•ú‚ł‚ę‚‚‚ ‚č‚Ü‚ˇB
ă‚Ě•ű‚É‚ ‚Á‚˝DFA‚ĆNFAŽg‚Á‚Ă鎖‚Š‚ç‚­‚éˆá‚˘‚Á‚Ä‚Č‚ń‚Ĺ‚ˇ‚ŠH

177ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/07/23(…) 02:40:07
>>176

ˆę”Ô‚Ěˆá‚˘‚́ADFA‚ž‚ĆŒă•űŽQĆ‚Ş‚Ĺ‚Ť‚Č‚˘‚ą‚Ć‚Š‚ȁB
‚Ć‚č‚ ‚Ś‚¸

DFA
‘O€”ő‚ÉŽčŠÔ‚đŠ|‚Ż‚é‚Ż‚Ǐˆ—‚ť‚Ě‚ŕ‚Ě‚Í‘‚˘

NFA
‘ŚŔ‚ɏˆ—‚đŽn‚ß‚é‚Ż‚ǁAˆ—‚ÉŽžŠÔ‚Ş‚Š‚Š‚éę‡‚Ş‚ ‚éB

‚Ž‚炢‚ɍl‚Ś‚Ä‚¨‚Ż‚΂˘‚˘‚ĆŽv‚¤B

178ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/02(“y) 00:57:57
•ŰŽç

179ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/02(“y) 14:34:05
sh + awk ‚Í–ž‚ç‚Š‚ÉŠČ’P‚ž‚ĆŽv‚¤B
sh + awk ‚ŏo—ˆ‚é‚ą‚Ć‚đ perl ‚Ě‚Ý‚Ĺ‹Lq‚ˇ‚él‚Ě‹CŽ‚ż‚Ş‚Ç‚¤‚ľ‚Ä‚ŕ—‰đo—ˆ‚Č‚˘B
‚˝‚žAƒlƒbƒgƒ[ƒNƒvƒƒOƒ‰ƒ~ƒ“ƒOˆČă‚É‚Č‚é‚ĆC, perl, ruby ‚É‚Č‚ç‚´‚é‚đ“ž‚Č‚˘‚Ż‚ǁB

ƒ}ƒVƒ“’P‘Ě‚Ĺ‚ĚŽíX‚ĚŽč‘ą‚Ť‹Lq‚ž‚ƁA
sh + awk ‚Ş‚â‚Á‚Ď‚čˆę”ÔŠŽŒ‹‚É‚Č‚é‚ĆŽv‚¤‚ń‚ž‚Ż‚ǂȁ`B

180ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/02(“y) 14:49:58
‚¨‚ę‚ŕawk‚Ĺ‚Ĺ‚Ť‚é‚ą‚Ć‚Č‚çawk‚Ĺ‚â‚éB
‚Ĺ‚ŕ‚ ‚Ü‚č‚ɃgƒŠƒbƒL[‚Č‚ą‚Ć‚É‚Č‚č‚ť‚¤‚ž‚Á‚˝‚çperl‚Ĺ‚â‚Á‚˝‚股‚é‚Š‚ȁB

181‚ ‚˘‚ż‚á‚ń2008/08/03(“ú) 01:39:18
l‚É“n‚ˇ‰Â”\Ť‚Ş‚ ‚é‚Č‚çAawk‚ÍŒ‹\‚‚炢‚ą‚Ć‚Ş‚ ‚éB
Perl‚Ĺ‚â‚ę‚Ίî–{“I‚É–â‘č‚Č‚˘‚Š‚çAPerl‚ŏ‘‚­•Č‚ނ‚­B
ShellScript‚Ĺ‚˘‚Á‚˝‚ńŽg‚¤‚ž‚Ż‚Č‚çAawk‚Í•Ö—˜‚ž‚Ż‚ǁB

182ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/04(ŒŽ) 01:23:58
>>180
‰´‚ŕ@AWK ‚Ĺ‚Ĺ‚Ť‚é‚Č‚çAWKB
‚ƍl‚Ś‚é‚Ɓ@ƒoƒCƒiƒŠ[‚Ěƒf[ƒ^‚˘‚ś‚éˆČŠO‚ÍAWK‚Ĺ‚Ĺ‚Ť‚é‚̂ł́c
i­‚Č‚­‚Ć‚ŕ@‰´‚É“úí‚Ěƒj[ƒd‚ł́@‚ť‚¤‚žj

183ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/04(ŒŽ) 02:16:24
>>182
“ŻŠ´B‚˝‚žƒoƒCƒiƒŠ‚ÍŽd•ű‚Č‚˘‚É‚ľ‚Ä‚ŕA
‘S”źŠpŹÝ‚ĚŒĹ’č’ˇƒtƒH[ƒ}ƒbƒg‚ވľ‚˘‚É‚­‚˘‚ń‚ž‚ć‚ȁB
ASCII‚É‚ˇ‚é‚Ć‘SŠp‚Ě‚Ý•”•Ş‚ޏˆ—‚ľ‚É‚­‚˘‚ľA
SJIS‚Ć‚Š‚É‚ˇ‚é‚Ɛł‚ľ‚­Ř‚čo‚š‚Č‚˘‚ľĽĽĽ
‚ ‚ę‚Í‚Č‚ń‚Ć‚Š‚Č‚ç‚ń‚ŕ‚Ě‚Š‚ȁB

184ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/07(–Ř) 01:55:09
‚â‚Á‚Ď‚č ASCII ‚ž‚Ż‚Ě–â‘č‚É‚ľ‚Ä‚¨‚˘‚˝•ű‚Ş–ł“ďB

185ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/11(ŒŽ) 15:38:13
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚Ĺƒ_ƒEƒ\‚Ĺ‚Ť‚é‚Ě‚ŞASCII‚ĆSJIS‚đ‚¤‚Ü‚­ˆľ‚Ś‚é‚â‚‚Ŕ‚á‚˂́H

186ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/13(…) 00:38:23
>>185
‚˘‚âA‚ť‚ĚgawkŽg‚Á‚Ä‚é‚Ż‚ǁA‘S”źŠpŹÝ‚ĚŒĹ’č’ˇ‚͍˘‚é‚Í‚¸B
—ź•ű•ĘX‚Č‚ç–â‘č‚Č‚­ˆľ‚Ś‚é‚Ż‚ǁA“ŻŽž‚ɂ͈ľ‚Ś‚Č‚˘B
—á‚Ś‚΁BSJIS‚Ps5ƒoƒCƒg+‰üs‚ĚŒĹ’č’ˇƒtƒ@ƒCƒ‹‚Ĺ
‚Ps‚Í‚Q€–ځia:‘S”źŠpŹÝ4ƒoƒCƒg b:”źŠp‚Ě‚Ý1ƒoƒCƒgj‚Ěƒtƒ@ƒCƒ‹‚Ş‚ ‚é‚Ć‚ŤB
asciiƒ‚[ƒh‚Č‚ça, b‚đŘ‚č•Ş‚Ż‚ç‚ę‚é‚Şa‚Ě‘SŠp•śŽš‚͏ˆ—‚Ĺ‚Ť‚Č‚˘B
sjisƒ‚[ƒh‚Č‚ça, b‚đŘ‚č•Ş‚Ż‚ç‚ę‚Č‚˘B

”Y‚Ü‚ľ‚˘‚̂́A€–Ú‚đŘ‚č•Ş‚Ż‚éƒXƒNƒŠƒvƒg‚đascii ƒIƒvƒVƒ‡ƒ“‚Ĺ‹N“Ž‚ľ‚Ä
o—ÍŒ‹‰Ę‚đsjis‚ŏˆ—‚ˇ‚ę‚΁i‚ß‚ń‚Ç‚­‚ł‚˘‚Ż‚ǁjŒťó‚ŏˆ—‚Ĺ‚Ť‚Ä‚ľ‚Ü‚¤B
‚̂ŁAƒ}ƒjƒ…ƒAƒ‹‚ɏ‘‚˘‚Ä‚ ‚é’Ę‚čAěŽŇ‚đ‚¨‚Ë‚Ş‚˘‚ˇ‚ę‚Ή”\Ť‚Í‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚ށA
‚¨Šč‚˘‚ˇ‚é‚Ě‚ŞçSçO‚í‚ę‚銴‚ś‚Ȃ̂ˁB

187ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/13(…) 22:12:09
awk‚ÍŽž‘ă‚̊֐”‚ž‚Š‚çŽg‚í‚ę‚Č‚­‚Č‚Á‚Ä‚˘‚­‚ń‚ž‚ë‚Č‚ 

188ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/15(‹ŕ) 02:08:00
UTF-8‚Ěę‡‚Ĺ‚ŕŒĹ’č’ˇ‚Í”źŠp•‚ľ‚Š‘Ήž‚Ĺ‚Ť‚Ä‚Č‚˘B
•śŽš”‚ĆƒoƒCƒg”‚Ć•\ŽŚ•‚Ć‚ŠA“ú–{Œę‚Í–Ę“|‚ž‚Ě‚¤B

length()‚Ć‚Š‚ĹƒoƒCƒg”‚đE‚Ś‚Č‚˘‚Š‚玊‘O‚ŏˆ—‚ŕ‚â‚č‚É‚­‚˘B

189ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/19(‰Î) 22:37:59
>>188
ˆęu”[“ž‚ľ‚Š‚Ż‚˝‚Ż‚ǁB
—âĂ‚ɍl‚Ś‚é‚ƁA‚ť‚ŕ‚ť‚ŕ‚P•śŽš‚Ş‰Â•Ď’ˇ‚Ĺ‚ ‚éUTF8‚đ
ŒĹ’č’ˇƒtƒ@ƒCƒ‹‚Ě•śŽšƒR[ƒh‚ÉŽg‚¨‚¤‚ƍl‚Ś‚˝“z‚đ’÷‚ßă‚°‚Ä
‹ƒ‚­‚قǖ₢‹l‚ß‚é•ű‚Şć‚ž‚ĆŽv‚¤‚͉̂´‚ž‚ŻH

l‚Ś‚Ä‚ŕl‚Ś‚Ä‚ŕƒƒŠƒbƒg‚ŞŽv‚˘‚‚Š‚Č‚˘‚ćc

190ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/21(–Ř) 00:40:10
>>189
‚Ů‚Ć‚ń‚Ç‚Ě•śŽšƒR[ƒh‚Ş‰Â•Ď’ˇ‚ž‚Š‚ç‚Č‚ B
‘Š‘ΓI‚ÉŒŠ‚ę‚΃}ƒV‚Č•ű‚É“ü‚é‚ń‚ś‚á‚Č‚˘?
ƒzƒXƒg‚Ş—‚Ţ‚Ć•śŽšƒR[ƒhŽü‚č‚͔ߎS‚ž‚ćc
ƒzƒXƒg‚ś‚á‚Č‚˘‚Č‚ç‚ť‚ŕ‚ť‚ŕŒĹ’č’ˇ‚ś‚á‚Č‚­‚Ä—Ç‚˘‚ń‚ž‚Ż‚ǂˁB

191ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/23(“y) 01:53:25
‚ ‚éƒtƒBƒ‹ƒ^ƒXƒNƒŠƒvƒg‚đgawk‚ŏ‘‚˘‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚Ş
•śŽš‚ĚƒR[ƒh‚𐎐”’l‚É•ĎŠˇ‚ľ‚悤‚Ć‚ľ‚Ä‚¤‚Ü‚­‚˘‚Ť‚Ü‚š‚ń
‚˝‚Ć‚Ś‚΁ucv‚Ć‚˘‚¤•śŽš‚ĚƒR[ƒh‚𐎐”’l‚É‚ľ‚悤‚Ć‚ľ‚Ä
BEGIN {
@testChar = "c";
@printf("testChar=%d\n",testChar);
}
‚̂悤‚É‚ľ‚Ä‚ŕutestChar=0v‚Ć•\ŽŚ‚ł‚ę‚Ä‚ľ‚Ü‚˘‚Ü‚ˇ
—Ç‚˘•ű–@‚Ş‚ ‚ę‚΂¨‹ł‚Ś‚­‚ž‚ł‚˘

192ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/08/23(“y) 03:21:15
>>191

awklib ‚É ord ‚Á‚ㆁ[ƒU[’č‹`‚Ěƒ‰ƒCƒuƒ‰ƒŠŠÖ”‚Ş‚ ‚é‚Š‚ç‚ť‚ę‚đŽg‚¤B
ŽŠ‘O‚ōě‚Á‚Ä‚ŕ‚˘‚˘‚Ż‚ǂˁB

‚­‚í‚ľ‚­‚Í info gawk ‚Ĺ’˛‚ׂāB

1931912008/08/23(“y) 03:28:08
>>192
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
‘‘ŹŒŸ“˘‚ľ‚Ä‚Ý‚Ü‚ˇ

1941912008/08/23(“y) 10:56:41
>>192
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_16.html
‚É‚ ‚Á‚˝‚ŕ‚Ě‚đŽŽ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝.Šú‘Ň‚Ç‚¨‚č‚Ě“Žě‚đ‚ľ‚Ä‚­‚ę‚Ü‚ˇ.
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝.

195ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/15(ŒŽ) 01:12:37
“ü—Í“ŕ—e‚đawk‚ŐśŹ‚ˇ‚é‚ą‚Ć‚Ío—ˆ‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š
‚ŕ‚ľ‚­‚ÍBEGIN“™‚ĚƒuƒƒbƒN“ŕ‚Ĺ•śŽš—ń‚𐜐Ź‚ľ‚Ä
‚ť‚Ě•śŽš—ń‚Ěƒpƒ^[ƒ“–ˆ‚É•ŞŠňAƒtƒB[ƒ‹ƒh‚đŽg‚Á‚Ä‚Ěˆ—
i—v‚Íawk‚É“ü—̓tƒ@ƒCƒ‹“n‚ľ‚˝Žž‚ÉŠČ’P‚ɏ‘‚Ż‚鏈—j
‚đŠČ’P‚ɏ‘‚­‚ą‚Ć‚Ío—ˆ‚é‚Ě‚Ĺ‚ľ‚傤‚Š

—á‚Ś‚΁c‚Ç‚ń‚ȏˆ—‚Ş“KŘ‚Čŕ–ž‚Š”ť‚č‚Ü‚š‚ń‚Ş
BEGIN{for(i=0;i<10;i++) print int(rand()*10),int(rand()*10),int(rand()*10)}
‚ĚŒ‹‰Ę‚ɑ΂ľ‚Ä
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
c‚Ć‚Š‚ť‚ń‚ČŠ´‚ś‚ŁAƒeƒLƒXƒg‚𐜐Ź‚ľ‚˝Œ‹‰Ę‚ɑ΂ľ‚Ä
ƒtƒBƒ‹ƒ^[‚Ć‚ľ‚Ä”äŠrŽŽ‚␳‹K•\Œť‚Ĺ•ŞŠň‚ľ‚āAƒtƒB[ƒ‹ƒh‚đŽg‚Á‚ďˆ—‚ˇ‚銴‚ś‚Ĺ‚ˇB

‚â‚Á‚Ď‚čƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ćawkƒtƒ@ƒCƒ‹‚đ‚˘‚­‚‚ŕě‚Á‚˝‚č
ˆęsˆęs‚ɑ΂ľ‚Äif•ś‚Ĺ•ŞŠň‚ľ‚˝‚čsplit‚Ĺ•ŞŠ„‚ˇ‚é‚ľ‚Š–ł‚˘‚Ĺ‚ˇ‚Š‚ˁcB

196ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/15(ŒŽ) 01:52:51
>>195
Š¸‚Ś‚Ä“ü—͂𐜐Ź‚ľ‚˝‚˘‚Ě‚Č‚çAawk‚đƒpƒCƒv‚ĹŒq‚°‚΂˘‚˘‚ĆŽv‚¤B
‚ť‚¤‚Ĺ‚Í‚Č‚­A’P‚É—”‚ŏˆ—‚đU‚č•Ş‚Ż‚˝‚˘‚̂Ȃ畁’Ę‚Éif•ś‚Ĺ‚˘‚˘‚ĆŽv‚¤B

‚ť‚ę‚Í‚ł‚Ä‚¨‚ŤA
--
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
--
‚Í•Ę‚Éă‚ĚđŒŽŽ‚Í—v‚ç‚ń‚ž‚ëBˆęŒ…‚̐”’l‚đ10‚ĹŠ„‚Á‚˝—]‚č‚ÍŒł‚Ě‚Ü‚Ü‚ž‚Š‚ç‚ȁB

197ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/15(ŒŽ) 14:18:55
>196
‚˘‚â‚ ‚­‚Ü‚Ĺ—á‘č‚Č‚Ě‚Ĺ“ŕ—e‚͐[‚­l‚Ś‚Č‚˘‚Ĺ‚­‚ž‚ł‚˘corz

•’Ę‚Éif•ś‚Ć‚ÍŒž‚¤‚ŕ‚̂́AÜŠpawk‚Ş•W€‚Ĺ”ő‚Ś‚Ä‚é•Ö—˜‚Č‹@”\‚𖳎‹‚ľ‚Äç’ˇ‚ȏ‘‚Ť•ű‚ˇ‚é‚Ě‚ŕ“ď‚ž‚ľ
‚Š‚ĆŒž‚Á‚Ä.awkƒtƒ@ƒCƒ‹•Ą”ŒÂ‚Ćƒoƒbƒ`‚ŁAƒpƒCƒv‚ł‚Ȃ°‚ďˆ—‚ˇ‚é‚Ě‚ŕc‚¤`‚ńA‚Ć‚Č‚Á‚Ä‚ľ‚Ü‚¤B
—Ç‚˘‘‚Ť•ű–ł‚˘‚Š‚Č‚Ÿ‚ĆŽv‚Á‚˝‚Ě‚Ĺ•ˇ‚˘‚Ä‚Ý‚˝‚Ě‚Ĺ‚ˇ‚ށAif‚Ćsplit‚ĹŠć’Ł‚č‚Ü‚ˇB

198ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/16(‰Î) 02:58:54
Žż–â‚Ş‚ć‚­‚í‚Š‚ç‚ń‚Ě‚ž‚ށABEGIN•”‚ŐśŹ‚ľ‚˝ƒtƒ@ƒCƒ‹‚đˆ—•”‚Ĺˆľ‚˘‚˝‚˘‚Ć‚˘‚¤‚ą‚Ć‚Š‚ȁH
—á‚Ś‚΁A
gawk 'BEGIN{ ARGV[1]="in_file.txt"; ARGC=2; }{ print }'
‚Á‚Ä‚â‚Á‚˝‚ç in_file.txt ‚đ•\ŽŚ‚Ĺ‚Ť‚é‚ź‚˘

199ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/16(‰Î) 09:51:03
>198
III
–Ú‚Š‚ç—Ř‚Ĺ‚ˇB

‚ť‚Á‚ŠAƒtƒ@ƒCƒ‹śŹ‚ľ‚ż‚á‚Ś‚Îˆę”­‚ōs‚Ż‚é‚Ě‚Šc‚â‚Á‚Ä‚Ý‚Ü‚ˇ

200ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/16(‰Î) 15:07:48
‚¤‚°Aˆę’Uƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í‚ ‚č‚Č‚Ě‚Š‚ćB
if‚đŽg‚¤‚Ě‚Íç’ˇ‚Ȃ̂ɁAƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Íç’ˇ‚ś‚á‚Č‚˘‚Á‚Ä‚Ç‚ń‚ČƒZƒ“ƒX‚Č‚ń‚žB

201ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/16(‰Î) 17:48:16
>200
“ü—̓f[ƒ^‚Í‹K‘ĽŤ‚Ě‚ ‚é‚ŕ‚̂ŁAśŹ‚ľ‚Ä‚ľ‚Ü‚Ś‚é‚Ż‚Ç
‚ť‚ę‚ɑ΂ľ‚Ä‚Ě•ŞŠň‚Í‘˝‚˘c‚Ć‚˘‚¤ę‡
if‚âsplit‚đ—…—ń‚ˇ‚é‚ć‚č‚ŕAawk‚ŞŒłXŽ‚Á‚Ä‚é
ƒpƒ^[ƒ“‚ĆƒtƒB[ƒ‹ƒh•ŞŠ„‚đŽg‚Á‚˝•ű‚Ş
ƒXƒbƒLƒŠ‚ˇ‚é‚ĆŽv‚¤‚Ě‚Ĺ‚ˇ‚ŞŠÔˆá‚Á‚Ä‚é‚Ĺ‚ľ‚傤‚ŠcB

202ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/16(‰Î) 19:39:26
>>201
•Ę‚É‚˘‚˘‚ń‚ś‚á‚Ë?
‹‘ĺ‚Č’†ŠÔƒtƒ@ƒCƒ‹‚đě‚é‚Á‚Ä‚í‚Ż‚Ĺ‚ŕ‚Č‚˘‚ń‚ž‚낤‚ľB
‚Ü‚ŸAŽŸ‚Ě——R‚ĹŽ„‚Í’†ŠÔƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í”đ‚Ż‚é‚Ż‚ǂˁB
Eƒtƒ‹ƒpƒX‚đŽw’č‚ľ‚Č‚˘ę‡AƒJƒŒƒ“ƒgƒfƒBƒŒƒNƒgƒŠ‚ɏ‘‚Ťž‚ÝŒ ŒŔ‚Ş‚ ‚é•Űá‚Ş‚Č‚˘B
E‚ť‚ŕ‚ť‚ŕ“Ż–źƒtƒ@ƒCƒ‹‚Ş‘śÝ‚ľ‚Ä‚˘‚ď‘‚Ťž‚ÝŒ ŒŔ‚Ş‚Č‚˘‚Š‚ŕ’m‚ę‚Č‚˘B
E‚[‚ŠA“ŻŽž‚É2Œ“Ž‚Š‚ľ‚˝‚çƒoƒbƒeƒBƒ“ƒO‚ľ‚Ä‚ľ‚Ü‚¤B
E‚ž‚Š‚ç‚ĆŒž‚Á‚āAˆęXƒ†ƒj[ƒN‚Č–ź‘O‚Ěƒtƒ@ƒCƒ‹–ź‚𐜐Ź‚ˇ‚é‚Ě‚ŕ–Ę“|‚žB
E‚ľ‚Š‚ŕA’†ŠÔƒtƒ@ƒCƒ‹‚ÍŒă‚ŏÁ‚ľ‚Ä‚¨‚­•K—v‚Ş‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘B

‚ť‚ę‚ƁAŽŠ‘O‚Ĺ“ü—͂𐜐Ź‚ˇ‚é‚Č‚çAĹ‰‚Š‚ç•ŞŠ„‚ł‚ę‚˝ó‘Ô‚Ĺě‚ę‚΂˘‚˘‚Š‚çsplit‚Í—v‚ç‚Č‚˘‚ˁB
ƒpƒ^[ƒ“‚đŽg‚¤‚Šif‚đŽg‚¤‚Š‚ÍŽď–Ą‚Ě–â‘č‚̂悤‚Č‹C‚Ş‚ˇ‚é‚Ż‚ǁB
# $1+$2+$3<10{print;}‚Ə‘‚­‚Šif($1+$2+$3<10){print;}‚Ə‘‚­‚Š‚Ěˆá‚˘‚ž‚ŕ‚ń‚ˁB

203ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/18(–Ř) 01:19:00
FXl‚Ś•ű‚Ş‚ ‚é‚̂ˁB

ŽŠ•Ş‚Č‚çƒgƒŠƒbƒL[‚ȍ׍H‚ľ‚Ä‚P‚‚Ɏű‚ß‚¸•ŞŠ„‚ľ‚ÄifŽg‚킸‚ɏ‘‚­‚Ż‚ǁB
Žč‘‚­ƒJƒ^‚đ‚‚Ż‚ç‚ę‚é‚Ě‚Şawk‚Ě—Ç‚˘Š‚ž‚ĆŽv‚¤‚ľA
‹ZI‚É‘–‚é‚ĆŠÔˆá‚˘‚Č‚­–Y‚ę‚é‚Ě‚Ĺƒƒ“ƒe•s‰Â”\‚É‚Č‚é‰Â”\Ť‘ĺ

‚܁A‚ť‚ę‚Í‚ť‚ę‚Ć‚ľ‚Ä>>198‚̓pƒYƒ‹“I‚Č–Ę”’‚ł‚Ş‚ ‚Á‚Ä—Ç‚˘‚ˁB

204ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/19(‹ŕ) 19:54:42
>202
‚¤`‚ńAŒž‚í‚ę‚Ä‚Ý‚ę‚΂ť‚¤‚Š‚ŕB
ˆę‰žAĄ‰ń‚Ě‚ÍŽdŽ–‚ĹŽg‚¤‚í‚Ż‚Ĺ‚ŕ‚Č‚Ż‚ę‚Αźl‚ÉŽg‚Á‚Ä‚ŕ‚炤—\’č‚ŕ‚Č‚˘
ŠŽ‘S‚ČŒÂl—pƒXƒNƒŠƒvƒg‚Č‚Ě‚Ĺ‚Ç‚¤‚É‚Ĺ‚ŕ‚Č‚č‚Ü‚ˇ‚Ş
‚ą‚ę‚Ş‹Ć–ą‚⎊•ŞˆČŠO‚ŕŽg‚¤‚ŕ‚Ě‚Ĺ‚ ‚ę‚Αf’ź‚Éif‚Č‚ń‚Ĺ‚ľ‚傤‚ˁB

205ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/22(ŒŽ) 20:50:40
2008/09/15 13:17 61 20080915142145.txt
2008/09/16 13:17 316 2008091611529.txt
2008/09/22 20:09 24,028 2008_0922asahiindex.txt
2008/09/22 12:57 1,545 clean.txt

‚Ć‚˘‚¤ƒtƒ@ƒCƒ‹ˆę——‚Š‚çAgawk‚ōĄ“ú‚Ě“ú•t‚Ěƒtƒ@ƒCƒ‹‚ž‚Ż”˛‚Ťo‚ˇ‚É‚Í‚Ç‚¤‚ˇ‚č‚Ⴂ‚˘‚ń‚ž‚Á‚Ż?

BEGIN{month = strftime("%m",systime()); date = strftime("%d",systime())}

/month/ && /date/ {print $0}

‚Ĺ‚˘‚˘‚Š‚ĆŽv‚Á‚˝‚çA/ /‚Ě‚Č‚Š‚Émonth‚Ć‚Š‚ÍŽg‚Ś‚Č‚˘‚ç‚ľ‚˘B

/strftime("%d",systime())/ {print $0}
‚Ƃׂ˝‘‚Ť‚ľ‚Ä‚ŕ‚ž‚߁B
‚Ç–Y‚ę’†Bƒwƒ‹ƒvƒ~[B

206ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/22(ŒŽ) 21:05:13
BEGIN{date=strftime("%m/%d")} $0 ~ date {print $0}

207ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/09/22(ŒŽ) 21:45:34
>>206
thanks!

208ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/10/10(‹ŕ) 19:41:51
Žż–â‚Ĺ‚ˇB
“ü—Í’†‚Ěƒtƒ@ƒCƒ‹–ź‚ÍFILENAME‚ɃZƒbƒg‚ł‚ę‚Ü‚ˇ‚ށA
“ü—Í’†‚Ěƒtƒ@ƒCƒ‹‚ĚƒpƒX‚đŽć“ž‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ˇ‚ŠB

209ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/10/10(‹ŕ) 22:13:43
>>208
FILENAME‚Ĺ“ž‚ç‚ę‚éî•ń‚Ş‘S‚āBƒtƒ‹ƒpƒX‚Ş—~‚ľ‚˘‚Ć‚˘‚¤‚ą‚Ć‚Č‚çA
cwd‚đŽć“ž‚ľ‚Ä‚ť‚ą‚Š‚ç‚Ě‘Š‘΃pƒX‚ŞFILENAMEB

210ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/12(…) 19:19:08

awk‚ĚŒ‹‰Ę‚đ set ‚Š@setenv ‚̕ϐ”‚É‘ă“ü‚ľ‚˝‚˘‚Ĺ‚ˇB

awk '{ print $1+ $3 }' test.txt
‚Ő”’l‚ޏo‚Ü‚ˇB
‚ą‚ĚŒ‹‰Ę‚đ•Ď”‚É‘ă“ü‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚炢‚˘‚ń‚Ĺ‚ľ‚傤‚ŠH

set tmp=`awk '{ $1+ $3 }' test.txt`

‚ą‚ę‚ž‚ƏăŽč‚­‚˘‚Ť‚Ü‚š‚ńBprint ‚Í‚ť‚Ě‚Ü‚Ü‚Ĺ‚˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH

211ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/12(…) 20:24:22
‚Č‚ń‚Ĺ print ‚đČ—Ş‚Ĺ‚Ť‚é‚ƍl‚Ś‚˝‚Ě‚Š‚Ş“ä‚ž‚Ş

212ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/12(…) 23:57:16
>print ‚Í‚ť‚Ě‚Ü‚Ü‚Ĺ‚˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚Ü‚¸ŽŽ‚š‚ć‚—

213ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/13(–Ř) 14:17:14
V‹IŒłŽĐ‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęawk‚Ş‚Ç‚ą‚ŕ”„‚čŘ‚ę‚Č‚ń‚ž‚Ż‚Ç
‚ŕ‚¤“ü‚ç‚Č‚˘‚Ě‚Š‚Č

214ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/16(“ú) 03:02:56
>>211
print‚͉ć–Ę•\ŽŚ‚ˇ‚é‚ŕ‚́¨•Ď”‚É“ü‚ę‚é‚ž‚Ż‚Č‚ç•s—v
c‚ĆŽv‚Á‚˝‚ń‚ś‚á“ŕ‰Č‚Ë

215ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 11:28:33
ƒJƒ“ƒ}‹ćŘ‚č‚Ěƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ş‚ ‚čA‚ť‚Ě’†‚ŁA‘ć‚PƒtƒB[ƒ‹ƒh‚Ć‘ć‚RƒtƒB[ƒ‹ƒh“ŕ‚É‚ŕ‚ľ
Žq‰šAŽq‰šAŽq‰šA•ę‰š‚Ş‘śÝ‚ˇ‚ę‚΂ť‚̍s‚ž‚Ż”˛‚Ťo‚ˇƒI[ƒN‚ĚƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚đ‚‚­‚č‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚¤‚ˇ‚ę‚΂悢‚Ĺ‚ˇ‚Š

216ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 11:41:15
>>215
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚ĚƒTƒ“ƒvƒ‹‚Ć”˛‚Ťo‚ľ‚˝‚˘sƒˆƒ

217ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 11:50:40
‚ą‚ń‚ČŠ´‚ś‚Ĺ‚ˇ
takeshi,fiad,fdjioaf,fdjsoafdsiŠŠY“–‚Č‚ľj
dddacea,fsaofsa,rrra,fjisaofdjsaiddda‚Ćrrra‚ŞŠY“–j
aexxxu,dsoifsa,yyyuo,fjsaofaixxxu‚Ćyyyu‚ŞŠY“–j

218‚Ń‚Ź‚Č‚Ÿ2008/11/18(‰Î) 12:12:55
ƒI[ƒNƒXƒNƒŠƒvƒg‚đŽŔs‚ˇ‚é‚Əî•ń‚đ•\ŽŚ‚ˇ‚é‚悤‚É‚ľ‚˝‚Ě‚Ĺ‚ˇ‚Ş‚Ps–Ú‚ĆĹŒă‚̍s‚ž‚Ż‚đ•\ŽŚ‚ľ‚Č‚˘‚悤‚É‚ˇ‚é‚É‚Í
END“ŕ‚ɉ˝‚ď‘‚Ż‚΋X‚ľ‚˘‚Ĺ‚ľ‚傤‚Š

219ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 12:43:59
>>215
BEGIN{FS=","}
function term_check(term, lower_term) # lower_term ‚͋ǏŠ•Ď”
{
lower_term=tolower(term)
if(lower_term ~ /[bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][aiueo]/) return 1
return 0
}
{
if(term_check($1) && term_check($3)) print
}

ƒpƒ^[ƒ“ŒJ‚č•Ô‚ľ‚Á‚Ä {3} ‚Ć‚Š‚Ĺ‚˘‚Ż‚é‚Í‚¸‚Č‚ń‚ž‚Ş
‘‚Ť•ű’m‚ç‚Č‚˘‚Ě‚ĹƒRƒsƒy‚ľ‚˝‚—

220ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 12:47:37
>>218
’€ŽŸo—Í‚ľ‚Ä‚éH
END ‚Ĺ‚Ü‚Ć‚ß‚Äo—Í‚ľ‚Ä‚éH

221ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 13:53:22
>>218
1s‚¸‚ƒoƒbƒtƒ@ƒŠƒ“ƒO‚ľ‚āAŽŸ‚̍s‚Ě“ü—Í‚Ĺ‘O‚̍s‚đo—Í‚ˇ‚ę‚ÎĹŒă‚̍s‚͏Á‚Ś‚Ä‚Č‚­‚Č‚éB
awk 'NR > 2 {print buffer;} NR > 1 {buffer = $0;}'

222ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 14:20:29
>>215
gawk‚Č‚ç
awk -F "," -v r="[bcdfghj-np-tv-z]{3}[aiueo]" --posix '$1 ~ r && $3 ~ r'
$1‚Ć$3‚Ç‚ż‚ç‚Šˆę•ű‚É‚ ‚ę‚΂˘‚˘‚Č‚ç&&‚đ||‚É•Ď‚Ś‚Ä‚Ë

223ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/18(‰Î) 16:29:37
>>219
•‚Š‚č‚Ü‚ľ‚˝I

224‚Ń‚Ź‚Č‚Ÿ2008/11/18(‰Î) 16:46:03
o—ˆ‚Ü‚ľ‚˝@‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ

225ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/19(…) 23:48:41
ž‚Ý“ü‚Á‚ĂĐŽ—‚Ĺ‚Ť‚Č‚˘‚Ě‚Ĺ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B
E‘ÎŰ‚ĚƒeƒLƒXƒg‚Í2s–Ú‚Ş‚Č‚˘(1s–Ú‚ľ‚Š‚Č‚˘)‚Š‚Â
E1s–Ú‚Í‚Đ‚ç‚Ş‚ČƒJƒ^ƒJƒiŠżŽš‚Ĺ15•śŽšˆČ“ŕ
‚Ć‚˘‚¤đŒ‚đ‘‚­‚Ě‚Á‚āAŽŸ‚̂悤‚É‚ľ‚˝‚Ě‚Ĺ‚ˇ‚ށA‚¤‚Ü‚­ƒqƒbƒg‚ľ‚Ü‚š‚ńB
‚Ç‚¤‘‚Ż‚΂˘‚˘‚Ĺ‚ľ‚傤?

NR==2 && length($0) == 0 && NR==1 && /[‚Ÿ-‚ńƒ@-ƒ–ˆŸ-˜r]{1,15}/

226ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/19(…) 23:53:31
>>225
NR == 2 && NR == 1‚ś‚áAâ‘ΐŹ—§‚ľ‚Č‚˘‚ž‚ëB

227ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/19(…) 23:54:54
awk‚͍s‚đ1s‚¸‚ˆ—‚ˇ‚é‚Š‚çAŽ–‘O‚Ƀg[ƒ^ƒ‹s”‚đ’m‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘B
ƒg[ƒ^ƒ‹s”‚Ş1s‚Ĺ‚ ‚é‚ą‚Ć‚đ•ŰŘ‚ľ‚˝‚˘‚Č‚çAENDƒuƒƒbƒN‚ŏˆ—‚ˇ‚é‚ľ‚Š‚Č‚˘B

228ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/20(–Ř) 00:22:37
>Ž–‘O‚Ƀg[ƒ^ƒ‹s”‚đ’m‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘
BEGIN•”‚Ő”‚Ś‚ę‚΁H

229ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/20(–Ř) 00:28:19
>>228
‚Ç‚¤‚â‚Á‚Ä? ‘ÎŰ‚Şƒtƒ@ƒCƒ‹‚Ĺ‚ ‚é•ŰŘ‚Ş‚ ‚é‚Č‚çwc‚Ĺ‚ŕŒÄ‚ׂ΂˘‚˘‚Ż‚Ç‚ť‚ę‚Č‚çawk‚Ĺ‚â‚é•K—v‚ł‚Ś‚Č‚˘‚ć‚ˁB

230ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/20(–Ř) 03:49:07
{ a = $0 }
END { if (NR == 1 && a ~ /re/) print a }
‚Ć‚Š?

231ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/20(–Ř) 23:58:06
‚Ç‚Č‚˝‚ŠA”CˆÓƒrƒbƒg•‚Ě2‚̕␔HEX‚đDEC‚É•ĎŠˇ‚ˇ‚éƒvƒƒOƒ‰ƒ€‚đ‘‚˘‚Ä‚ŕ‚ç‚Ś‚Ü‚š‚Ę‚ŠH

232ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/22(“y) 12:02:58
Žd—l‚Ş•s–žŠm‚Č‚Ć‚ą‚ë‚Ş‚ ‚é‚ľA‚Č‚É‚ć‚č‚Č‚ń‚Ĺawk‚Ĺ?

233ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/26(…) 22:53:51
>>232
‚ą‚ą‚ŞawkƒXƒŒ‚ž‚Š‚ç‚Ĺ‚ľ‚ĺB

234ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/11/29(“y) 03:05:38
>>232
l‚Ś‚é‚ȁBŠ´‚ś‚ë‚—

235ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/12/12(‹ŕ) 07:21:00
u‚ ‚Č‚˝‚͉˝ŒĚawk‚Ĺ‚â‚낤‚Ć‚ˇ‚é‚Ě‚Ĺ‚ˇ‚ŠHv
u‚ť‚ą‚Éawk‚Ş‚ ‚é‚Š‚çv

236ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/12/13(“y) 04:23:45
awk‚Š‚çsystem()‚Ĺgrep‚Ć‚Šsed‚Ć‚ŠŒÄ‚ń‚ž‚股‚é•Č‚Ş•t‚˘‚Ä‚˘‚é
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚ˇ‚é•ű‚Ş‚Ţ‚ľ‚ëˆá˜aŠ´

237ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/12/13(“y) 23:56:31
‚¨‚˘‚¨‚˘Agrep‚âsed‚Ž‚炢ŒÄ‚яo‚ł‚¸‚Éawk‚Ĺ‚â‚낤‚şB

238ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2008/12/16(‰Î) 00:29:26
grep‚âsed‚̓pƒCƒv‚ł‚Ȃ°‚ÄŽg‚¤‚ŕ‚Ě‚ś‚á‚Č‚˘‚́H(^^;

239ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/10(“y) 22:10:41
gawk 3.1.4 mb@‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c

240ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/11(“ú) 00:38:51
‚Č‚ń‚Ĺ‚ť‚ń‚ČŒĂ‚˘ƒo[ƒWƒ‡ƒ“‚Ş—~‚ľ‚˘‚Ě?

241ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/11(“ú) 12:16:04
>‚Č‚ń‚Ĺ‚ť‚ń‚ČŒĂ‚˘ƒo[ƒWƒ‡ƒ“‚Ş—~‚ľ‚˘‚Ě?
length‚Ć‚Šsubstr‚ŁAujv•t‚Ť•śŽš—ńŠÖ”‚Ş‚ ‚é‚Š‚ç‚Ĺ‚ˇB
3.1.5ˆČ~‚ž‚ƁA“Ż‚śƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹“ŕ‚ŁAƒoƒCƒg’PˆĘˆ—‚Ć
ƒLƒƒƒ‰ƒNƒ^[’PˆĘˆ—‚̍ŹÝ‚Ş“ď‹V‚Č‚Ě‚Ĺ‚ˇB

2422402009/01/11(“ú) 15:01:36
3.1.5‚Ĺ•śŽš‚Ěˆľ‚˘‚Ş•Ď‚í‚Á‚˝‚Ě‚Í‚ť‚Ě’Ę‚č‚ž‚Ż‚ǁA3.1.4‚ĚWindows”Ĺ‚Ä
jlength‚â‚ç‚ ‚Á‚˝‚Á‚Ż?
‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB

243ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/11(“ú) 15:48:22
>‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB
‚Ś‚ÁB3.1.4ˆČ‘O‚Ě‚ÍƒoƒCƒg’PˆĘƒIƒ“ƒŠ[‚Á‚ÄŽ–‚Ĺ‚ˇ‚ŠH
c‚ť‚ę‚Ĺ‚ŕ2ƒoƒCƒgŠˇŽZ‚Ĺˆľ‚Ś‚΂˘‚˘‚Š‚çA‚Ü‚žƒ}ƒV‚Š‚ŕB

j•t‚Ť‚ޒljÁ‚ł‚ę‚Ä‚˘‚˝‚Ż‚ǁA“Žě•ĎX‚É”ş‚Á‚Ä”pŽ~‚ł‚ę‚˝c
‚ĆŽv‚Á‚Ä‚˘‚Ü‚ľ‚˝B
‹L‰Ż‚É‚ ‚é‚̂́A‚Ç‚Č‚˝‚Š‚Ě“ĆŽŠŠg’Ł•ĘVer‚ž‚Á‚˝‚Ě‚ŠcH

2442402009/01/11(“ú) 17:54:21
> ‚Ś‚ÁB3.1.4ˆČ‘O‚Ě‚ÍƒoƒCƒg’PˆĘƒIƒ“ƒŠ[‚Á‚ÄŽ–‚Ĺ‚ˇ‚ŠH ‚ż‚ႤB
j‚Č‚ń‚Ć‚Š‚Ş‚ ‚Á‚˝‚̂́A
2.11ƒx[ƒX‚Ějgawk‚Ć2.15ƒx[ƒX‚Ějgawk
2.15ƒx[ƒX‚Ě‚Ćgawk+mb
3.0.xƒx[ƒX‚Ěgawk+mb
‚ŁA3.1.xƒx[ƒX‚Ě‚É‚Í‚Č‚Š‚Á‚˝‚Ć‚˘‚¤˜b‚ž‚Á‚˝‚ĆŽv‚¤B
‚ť‚ę‚ź‚ę‚â‚Á‚Ä‚él‚ވႤB

245ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/11(“ú) 19:05:17
>3.1.xƒx[ƒX‚Ě‚É‚Í‚Č‚Š‚Á‚˝‚Ć‚˘‚¤˜b‚ž‚Á‚˝‚ĆŽv‚¤B
‚ť‚¤‚Ĺ‚ˇ‚ŠcB
gawk 3.1.4 mb ‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
‚Ĺ‚Í‚Č‚­‚āA
3.0.xƒx[ƒX‚Ěgawk+mb ‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
‚Ć‚˘‚¤Ž–‚É‚Č‚é–ó‚Ĺ‚ˇ‚ށc–ł—‚Á‚Ű‚˘B
‚ ‚Á‚Ä‚ŕŠÖ”‚â‘gž•Ď”‚ŞŒ¸­c‚ť‚Ě‘O‚É16bitDOS”ĹONLY‚Ě—\Š´cB
’ú‚ß‚Ü‚ˇB240‚ł‚ńA‚Ç‚¤‚ŕ‚Ĺ‚ľ‚˝B

246ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/11(“ú) 19:50:26
>>245

http://www.hinadori.atnifty.com/~wills/
‚É‚ ‚é‚ćB3.0.6‚̂₁B
DOS”Ĺ‚ž‚Ż‚ś‚á‚Č‚­‚ÄWin32”Ĺ‚ŕ‚ ‚éB

3.0.6→3.1.x‚Ĺ‘‚Ś‚˝‹@”\‚Ĺ‚ŕŽg‚Á‚Ä‚ń‚Ě?


247ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/01/11(“ú) 22:30:39
>‚ ‚é‚ćB3.0.6‚̂₁B
‚¨‚¨B ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
>3.0.6¨3.1.x‚Ĺ‘‚Ś‚˝‹@”\‚Ĺ‚ŕŽg‚Á‚Ä‚ń‚Ě?
‚˘‚‰˝‚Ş‘‚Ś‚˝‚Ě‚Š‚ć‚­”cˆŹ‚ľ‚Ä‚˘‚Č‚˘‚ń‚Ĺ‚ˇ‚ށA
gensub‚Ć‚Šmktime‚Ć‚Šswitch-case‚Ć‚Šc‚ ‚č‚Ü‚ˇ‚Š‚ˁB
‚Ü‚ A‘ă‘ÖŽč’i‚Í‚ ‚é‚Ě‚ĹŽŽ‚ľ‚Ä‚Ý‚Ü‚ˇB‚Ç‚¤‚ŕ‚Ĺ‚ˇB

248ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/02/23(ŒŽ) 08:11:12
awk‚ŁA‘g‚ݍ‡‚í‚š‚Ě‘S‚Ä‚đě‚éA‚Ć‚˘‚¤Ž–‚Í‚Ĺ‚Ť‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚˘‚í‚ä‚én‚br‚́AŒÂ”‚Ĺ‚Í‚Č‚­‚āA’†g‚đ’m‚č‚˝‚˘‚Ć‚˘‚¤Ž–‚Č‚Ě‚Ĺ‚ˇ‚ŞĽĽĽB
imawk‚đŽg‚Á‚Ä‚˘‚Ü‚ˇj

249ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/02/24(‰Î) 18:18:34
>>248
‚Ĺ‚Ť‚Ü‚ˇ

250sage2009/03/04(…) 15:23:19
248‚Ĺ‚ˇB
‚Č‚ń‚Ć‚Š‚Ĺ‚Ť‚Ü‚ľ‚˝B249‚ł‚ń‚Ç‚¤‚ŕ‚Ĺ‚ˇB

251ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/03/04(…) 15:24:16
sageŠÔˆá‚Ś‚˝c

252ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/03/23(ŒŽ) 11:47:59
int(0.5005*10000)‚Ş5004‚É‚Č‚é‚Ě‚Í‚Č‚ş‚Ĺ‚ˇ‚ŠB

253ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/03/23(ŒŽ) 12:41:00
ŠŰ‚ßŒëˇ‚Ĺ‚ľ‚傤B
Ř‚čŽĚ‚Ä‘O‚É0.5‘Ť‚ˇ‚Ć‚ŠH•v‚ľ‚Ä‚Ý‚Ä‚Í”@‰˝‚Ĺ‚ľ‚傤‚ŠB
Ú‚ľ‚­‚́AIEEE‚ĆŠŰ‚ßŒëˇ•Ó‚č‚ĚƒL[ƒ[ƒh‚ĹŒŸő‚Ě‚ą‚ƁB

254ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/03/23(ŒŽ) 19:57:34
>253
‚ ‚č‚Ş‚Ć‚¤

255ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/04/13(ŒŽ) 21:36:16
gawk‚ĹŒfŽŚ”ě‚č‚˝‚˘‚ń‚Ĺ‚ˇ‚Ż‚ǁA
gawk‚ŞŽg‚Ś‚é–ł—żŽI‚Ç‚ą‚Š‚É‚ ‚č‚Ü‚š‚ń‚ŠH

256ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/04/13(ŒŽ) 21:58:14
Linux‚Ş“ü‚Á‚Ă郌ƒ“ƒ^ƒ‹ŽI‚Č‚ç“ü‚Á‚Ä‚é‚ń‚ś‚á‚Č‚˘‚Š‚Č‚ŸH
ƒŒƒ“ƒ^ƒ‹ŽI”‚łŤ‚˘‚Ä‚Ý‚˝‚çB
‚ł‚­‚ç‚ĚFreeBSD‚ÍFreeBSD‚Ěawk(!=gawk)‚ž‚Á‚˝B

257ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/04/13(ŒŽ) 22:07:10
>>256
‚ł‚­‚ç‚Ígawk‚Ĺ‚ˇ‚ŠB
Windows‚ś‚á‚Č‚˘ƒŒƒ“ƒ^ƒ‹ŽI‚Č‚çawk‚ŞŽg‚Ś‚Ä‚ŕ—Ç‚ł‚ť‚¤‚Ĺ‚ˇ‚Ż‚ǁA
–ł—ż‚Ĺ‚Í‚Č‚Š‚Č‚ŠŒŠ‚‚Š‚ç‚Č‚˘‚ń‚Ĺ‚ˇ‚ć‚ˁB
perlCrubyCphp‚Í‘˝‚˘‚ń‚Ĺ‚ˇ‚Ż‚Ç‚Ë‚ĽBB

2582572009/04/13(ŒŽ) 22:14:30
Ž¸—çB
‚ł‚­‚ç‚Ígawk‚ś‚á‚Č‚˘awk‚Ĺ‚ˇ‚ŠB

259ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/04/18(“y) 13:07:13
‚í‚炤w
ttp://awk.info/?doc/dsl/awkplusplus.html

object_variable = class_name.new[(optional parameters)]
object_variable.method_name(parameters)
object_variable.delete

260ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/04/18(“y) 13:30:10
>>259
“Ż‚ś‚­ƒEƒP‚˝
awk‚͉i‘ą“I‚ÉŽg‚Á‚Ä‚˘‚āCC-->C++-->Java‚Əć‚čŒp‚˘‚Ĺ‚Ť‚˝‚ށCawk‚Í‚ą‚ę‚çƒRƒ“ƒpƒCƒ‰ŒžŒę‚đŽg‚¤ă‚Ĺ
—Ç‚˘ŠwKŢ—ż‚É‚Č‚Á‚Ä‚Ť‚˝‚ĆŽv‚˘Š´ŽÓ‚ľ‚Ä‚˘‚é(‚ŕ‚ż‚ë‚ń–˘‚ž‚Éscript‚Ěawk‚đawk‚ŏ‘‚˘‚Ä‚˘‚é)D
—Bˆęawk‚ŕ׋­‚Ĺ‚Ť‚Č‚Š‚Á‚˝‚Ě‚ŞOOP‚ž‚Á‚˝‚Š‚çCŠwKŢ—ż‚Ć‚ľ‚Ä‚Ěawk‚Ş‚ą‚¤‚˘‚¤•űŒü‚ÉŠˆ˜H‚đŒŠ‚˘‚ž‚ˇ‚Ě‚Í
—Ç‚˘‚ą‚Ć‚Š‚ŕ‚ľ‚ę‚Č‚˘D‚˝‚ž‚ľŽŔ—p‚ÉŒü‚Ż‚čl‚Ś‚Ä‚Ý‚é‚ƁCŒÂl“I‚É‚ÍOOP‚Ş–{—Ě‚đ”­Šö‚ˇ‚é‚Ě‚Í“Ş‚Ě’†‚Ĺalgorithm‚đ
”cˆŹ‚ľ‚Ť‚ę‚Č‚­‚Č‚é’ö“x‚É‘ĺ‚Ť‚ČƒVƒXƒeƒ€‚đ‘g‚Ýă‚°‚éę‡‚Ȃ̂ŁC‰Ę‚˝‚ľ‚Ä‚ť‚ę‚đawk‚ŏ‘‚­‚Š‚Ć‚˘‚í‚ę‚é‚ƁcD

2612602009/04/18(“y) 13:57:19
s/algorithm/ƒf[ƒ^\‘˘/

262ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/05/09(“y) 23:49:39
Ĺ‹ßruby‚̕׋­Žn‚ß‚˝‚ń‚ž‚ށA
uruby‚Ş‚ ‚ę‚ÎAWK‚˘‚ç‚ˁv‚Ć‚ÍŽv‚Ś‚ńB
‹t‚ÉAWK‚Ě•Ö—˜‚ł‚đÄ”FŽŻ‚ľ‚˝B

‚â‚Á‚Ď‚čAŠČ’P‚ČƒeƒLƒXƒgˆ—‚Í
AWK‚Ĺ‚â‚Á‚˝‚Ů‚¤‚ŞŠČ’P‚žB

263ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/05/09(“y) 23:58:09
Šes‚ɑ΂ľ‚ďˆ—‚Á‚Äę‡‚Íawk‚Ş—Ç‚˘‚Ë

264ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/05/10(“ú) 00:37:15
ruby‚̓IƒuƒWƒFƒNƒgŽwŒü‚đ‹­§‚ł‚ę‚é‚Š‚珬‰ń‚č‚Ş‚Ť‚Š‚ń

265ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/05/10(“ú) 01:20:35
JavaScript‚Ş“Ž‚­ HTMLŽŔŒą•”‰Ž
ttp://homepage2.nifty.com/tomoarai/java/exper.html

266ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/05/14(–Ř) 08:38:05
jawk‚Ě˜b‘č‚Ş‘S‘Ro‚Č‚˘‚ˁB
Žg‚Á‚Ä‚él­‚Č‚˘‚́H

267ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/05/19(‰Î) 23:16:20
>>266
‚ł‚­‚Á‚Ć1s‚ĹĎ‚Ţ‚Ě‚Ş‹C‚É“ü‚Á‚Ă鉴‚É‚Í–ł—p‚ž‚Č

268ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/01(ŒŽ) 15:22:34
>>266
JƒA(ƒI)[ƒNAƒvƒ‰ƒOƒAƒEƒbI

269ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/08(ŒŽ) 01:31:39
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_167
Geocoding - ZŠ‚Š‚çˆÜ“xŒo“x‚đŒŸő ‚ž‚Á‚āB‰˝‚ą‚ꂨ‚ŕ‚낢B

270ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 16:39:12
{if(miso<$1){printf($1)}} miso=30
‚đŽŔs‚ˇ‚é‚Ć$1‚Ş‚PŒ…‚̐”Žš‚Ě‚Ć‚Ť‚É‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚ń‚Ĺ‚ˇ‚Ż‚Ç‚Č‚şH

271ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 19:43:04
•śŽš—ń‚Ĺ”äŠr‚ł‚ę‚Ä‚é‚ń‚ś‚á‚ˁH
miso<$1-0
‚Ĺ‚â‚Á‚˝‚ç‚Ç‚¤H

272ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 21:34:56
>>271
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‚Ĺ‚ŕ‚ž‚ß‚Ĺ‚ľ‚˝B
•śŽš—ń‚Ĺ”äŠr‚ł‚ę‚Ä‚é‚Á‚Ű‚˘‚Ĺ‚ˇ‚ˁB

273ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 22:04:19
>>270
‰˝‚đ“ü—Í‚ľ‚˝‚Ć‚Ť‚ɉ˝‚ޏo‚Ä—~‚ľ‚˘‚́H
‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚Á‚Ä‚Ç‚¤‚Č‚é‚́H

274ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 22:23:40
>>273
$1‚Ş4‚Ě‚Ć‚Ť‚ɏo‚Ä‚Ů‚ľ‚­‚Č‚˘‚Ě‚Éo‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇDDD

275ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 22:31:41
>>274
‚ą‚ń‚Č‚ńH
BEGIN{miso=30}{if(miso<$1){printf("%d\n",$1)}}

276ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 22:46:46
>>275
o‚Ä‚ľ‚Ü‚¤——R‚Ş‹C‚É‚Č‚č‚Ü‚ˇDDD‚Č‚ń‚Ĺ‚Ĺ‚ľ‚傤
‚â‚Á‚Ď‚č‚Q‚V‚P‚ł‚ń‚ĚŒž‚¤‚Ć‚¨‚č•śŽš—ń”äŠr‚ľ‚Ä‚é‚ń‚Ĺ‚ľ‚傤‚ŠH

277ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/21(“ú) 22:54:47
>>276
awk ‚Ěƒo[ƒWƒ‡ƒ“iŽí•Ęj‚Ş•Ş‚Š‚ç‚Č‚˘
‰˝‚đH‚í‚š‚Ä‚é‚Ě‚Š•Ş‚Š‚ç‚Č‚˘
ƒXƒNƒŠƒvƒg‚͈ęs‚ŏ‘‚˘‚Ä‚é‚Ě‚Šƒtƒ@ƒCƒ‹‚É‚ľ‚Ä‚é‚Ě‚Š•Ş‚Š‚ç‚Č‚˘
ˆęs‚ŏ‘‚˘‚Ä‚˘‚é‚Č‚çƒVƒFƒ‹‚ɉ˝‚đŽg‚Á‚Ä‚˘‚é‚Ě‚Š

278ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/22(ŒŽ) 00:38:26
•śŽš—ń”äŠr‚ł‚ę‚Ä‚é‚Č‚çˆęŒ…‚Ě‚Ć‚Ť‚ɏăŽč‚­‚˘‚Š‚Č‚˘‚Ć‚˘‚¤‚ć‚č
“ńŒ…‚Ě‚Ć‚Ť‚ž‚ŻăŽč‚­‚˘‚­‚Ć‚˘‚¤Š´‚ś‚Č‚Ě‚Š‚ˁB
WindowsXP‚ĚƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ĺgawk(3.1.5)Žg‚Á‚ĉş‹L‚đŽŽ‚ľ‚Ä‚Ý‚˝‚Ż‚Ç
‚ť‚ĚŒťŰÄŒť‚Ĺ‚Ť‚Č‚Š‚Á‚˝B
gawk "{if(miso<$1){printf($1)}}" miso=30

279ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/22(ŒŽ) 07:43:07
$awk -W version
mawk 1.3.3 Nov 1996, Copyright (C) Michael D. Brennan

compiled limits:
max NF 32767
sprintf buffer 2040
$seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940
‚¤‚Ü‚­“Ž‚˘‚Ä‚˘‚é‚悤‚ž‚ށB

280ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/22(ŒŽ) 18:20:09
>>279‚đƒ}ƒl‚ł‚š‚Ä‚ŕ‚ç‚Á‚˝
$ awk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

$ seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940

281ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/22(ŒŽ) 19:59:10
miso=30‚Á‚Ä-v•t‚Ż‚Č‚­‚Ä‚˘‚Ż‚é‚ń‚žB‚ľ‚ç‚ń‚Š‚Á‚˝B

282270 ‚Ě‚ŞÄŒť‚Ĺ‚Ť‚Č‚˘...2009/06/23(‰Î) 01:02:55
gawk‚Í
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĹŽw’č‚ł‚ę‚˝ƒtƒ@ƒCƒ‹–ź‚Ş var=val ‚Ć‚˘‚¤Œ`ŽŽ‚Č‚ç‚΁A‚ť‚ę‚͕ϐ”‚Ö‚Ě‘ă“ü‚Ĺ‚ ‚é‚ƉđŽß‚ł‚ę‚Ü‚ˇB•Ď” var ‚Í’l val ‚ɐݒ肳‚ę‚Ü‚ˇ (‚ą‚ę‚́A‚ˇ‚×‚Ä‚Ě BEGIN ƒuƒƒbƒN‚đŽŔs‚ľ‚˝‚ ‚Ć‚És‚í‚ę‚Ü‚ˇ)B


‚â‚Á‚Ď‚č‚ŕ‚ę‚Ě XPƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒgŠÂ‹Ť‚Ĺ‚ŕ
>gawk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

>seq 1 40 | gawk "{if(miso<$1) print}" miso=30
31
32
33
34
35
36
37
38
39
40

‚Á‚ÄŠú‘Ň’Ę‚č‚Ě“Ž‚Ť‚žYO!

283ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/24(…) 00:39:07
ŒĹ’č’ˇ‚ʼnüs‚Č‚ľ‚Ěƒtƒ@ƒCƒ‹i6MB’´j‚đˆ—‚ˇ‚é‚ą‚Ć‚É‚Č‚čA
‘ź‚Ěƒ\ƒtƒg‚މüs‚ ‚č‚ĚŒĹ’č’ˇŁ‚É‚ľ‚Ä‚Š‚çAawk‚ŏˆ—‚ľ‚Ä‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށc

ƒf[ƒ^ƒtƒ@ƒCƒ‹‚É‚ć‚­o‚Ä‚­‚é•śŽš‚đ‚Ć‚č‚ ‚Ś‚¸RS‚ÉŒŠ—§‚Ăēǂݍž‚Ý
¨RS‚ÉŽw’č‚ľ‚˝•śŽš‚đ˜AÚ
¨ŒĹ’č’ˇ‚Ě1s•Ş‚ć‚č’ˇ‚Š‚Á‚˝‚ç‚ť‚Ě•”•Ş‚đŘ‚čo‚ľ

‚ľ‚Ä‚˘‚­‚Ƣ‰üs‚ ‚č‚ĚŒĹ’č’ˇŁA‚Ĺ‚Ť‚ż‚Ⴂ‚Ü‚ľ‚˝B
RS‚ÉŽw’č‚ľ‚˝•śŽš‚Ş‚ľ‚΂炭o‚Ä‚ą‚Č‚Ż‚ę‚Εϐ”ƒpƒ“ƒN‚ľ‚ż‚Ⴄ‚ľA‘ĺ•ŞŠë‚Č‚Á‚Š‚ľ‚˘‚Ě
‚Ĺ‚ˇ‚ށA‚Ć‚č‚ ‚Ś‚¸awk‚Ĺ‚Ĺ‚Ť‚˝‚Ě‚Ş­‚ľ‚¤‚ę‚ľ‚˘B

284ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/24(…) 03:25:12
‰üs‚ ‚č‚ĚŒĹ’č’ˇ‚đawk‚Ĺ“Ç‚ń‚ž‚Ě‚Č‚ç
substr($0, start, length) ‚ł΂炚‚ćw

285ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/26(‹ŕ) 11:29:46
>>283
>284‚Ý‚˝‚˘‚ȓljđ—Í‚Č‚˘”nŽ­‚Ş—N‚Š‚Č‚˘‚悤‚ɁA”ť‚čˆŐ‚­‘‚Ť‚Ü‚ľ‚傤B
‚[‚ŠA‹ď‘Ě“I‚ČƒR[ƒh‚ŕo‚ł‚¸‚Ɂuawk‚Ĺ‚Ĺ‚Ť‚Ä‚¤‚ę‚ľ‚˘v‚Č‚ń‚Ä‚Ě‚Íƒ`ƒ‰ƒV‚Ě— ‚É‚Ç‚¤‚źB

286ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/06/30(‰Î) 01:27:46
fold ‚Ć‚ŠH

287ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/13(ŒŽ) 09:52:52
ł‹K•\Œť‚Ĺ‹ó”’‚Ĺ‹ćŘ‚ç‚ę‚˝ƒeƒLƒXƒg‚đHTML‚Ĺ‚˘‚¤table‚É‚ľ‚˝‚˘‚Ĺ‚ˇB
—áj

10i 2i 8i
000 000 000
001 001 001
002 010 002
003 011 003

ŤŤŤŤŤŤŤ

<table>
<tr><th>10i</th> <th>2i</th> <th>8i</th></tr>
<tr><td>000</td> <td>000</td> <td>000</td></tr>
<tr><td>001</td> <td>001</td> <td>001</td></tr>
<tr><td>002</td> <td>010</td> <td>002</td></tr>
<tr><td>003</td> <td>011</td> <td>003</td></tr>
</table>

288ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/13(ŒŽ) 12:07:49
>>287
ł‹K•\Œť‚đŽg‚¤‚Ů‚Ç‚Ě‚ą‚Ć‚Ĺ‚Í‚Č‚˘
ƒRƒA‚Ě•”•Ş‚ž‚Ż‘‚­‚Ć‚ą‚ę‚ž‚Ż
for(i=1;i<=NF;i++) printf("<td>%s</td>", $i)

289ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/13(ŒŽ) 16:12:21
ł‹K•\ŒťŽg‚Á‚ă^ƒO‚đŘ‚č‘Ö‚Ś‚˝‚˘‚Ě‚Š‚ȁH

290hogehoge2009/07/17(‹ŕ) 16:37:34
split ‚â asort ‚ľ‚˝‚ç‚Ç‚¤‚ľ‚Ä“YŽš‚Ş1‚Š‚ç‚É‚Č‚é‚ń‚žI
‚Č‚ń‚Ĺ‚žI
Žd—l‘“Ç‚Ý”ň‚΂ľ‚Ăăf[ƒ^Œ‡—Ž‚ł‚š‚é‚Ć‚ą‚ë‚ž‚Á‚˝(LĽƒÖĽM)

>>287
sed ‚Ĺ‚Ś‚Ś‚â‚ń

291ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/17(‹ŕ) 18:35:54
Ą‚Ü‚Ĺawk '{print $3}'’ö“x‚ľ‚ŠŽg‚Á‚Ä–ł‚Š‚Á‚˝‚ށAĹ‹ß‚ą‚ę‚đ“Ç‚ń‚Ĺawk‚đŒŠ’ź‚ľ‚˝B

http://www.eecs.harvard.edu/cs152/lectures/CS152-Lecture_14-Kernighan.pdf

292ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/26(“ú) 15:10:31
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚ą‚ą‚Ěgawk‚Ĺ>>17‚ĚƒTƒ“ƒvƒ‹‚đŽŽ‚ľ‚˝‚Ş“Ž‚Š‚Č‚Š‚Á‚˝B

gawk: test.awk:4: ’v–˝“I: “üo—Í—p‚Ě‘o•űŒüƒ\ƒPƒbƒg `/inet/tcp/0/www.yahoo.com/80' ‚ŞŠJ‚Ż‚Ü‚š‚ń (No such file or directory)B

293hogehoge2009/07/27(ŒŽ) 11:13:15
‚ť‚ę‚Í‚ť‚ą‚ĚƒTƒCƒg‚̐l‚ÉŒž‚Ś‚ć

294ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/28(‰Î) 00:11:42
‚˘‚‚̂܂ɂŠgawk 3.1.7‚ޏo‚Ä‚˝B

295ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/07/30(–Ř) 11:45:58
Ruby •×‹­’†‚ž‚Ż‚Ç AWK ‚Ě‚Ů‚¤‚ŞŠy‚ľ‚˘‚ş(LĽƒÖĽM)

296ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 10:22:37
7ŒŽ7“ú¨[[7ŒŽ7“ú|07ŒŽ07“ú]]
7ŒŽ28“ú¨[[7ŒŽ28“ú|07ŒŽ28“ú]]
11ŒŽ3“ú¨[[11ŒŽ3“ú|11ŒŽ3“ú]]
12ŒŽ16“ú¨[[12ŒŽ16“ú|12ŒŽ16“ú]]

‚Ć’u‚ŤŠˇ‚Ś‚˝‚˘‚Ĺ‚ˇB
perl‚Č‚ç‚í‚č‚ĆŠČ’P‚Č‚Ě‚Ĺ‚ˇ‚ށAawk‚ĹŠČ’P‚É‚˘‚Ť‚Ü‚ˇ‚ŠH
ŽŠ•Ş‚Şawk‚Ě‚ą‚Ć‚đ•×‹­•s‘Ť‚ž‚Š‚ç‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ż‚ǁcB

297ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 10:24:13
ŞŠÔˆá‚˘‚Ü‚ľ‚˝B
7ŒŽ7“ú¨[[7ŒŽ7“ú|07ŒŽ07“ú]]
7ŒŽ28“ú¨[[7ŒŽ28“ú|07ŒŽ28“ú]]
11ŒŽ3“ú¨[[11ŒŽ3“ú|11ŒŽ03“ú]]
12ŒŽ16“ú¨[[12ŒŽ16“ú|12ŒŽ16“ú]]

298ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 11:03:17
—á‚Ş‚ć‚­‚í‚Š‚ç‚Č‚˘‚ń‚ž‚Ż‚ǁC”Žš1Œ…‚Ě•”•Ş‚đ2Œ…‚É‚ľ‚˝‚˘‚Á‚Ä‚ą‚ƁH

299ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 11:13:12
{
gsub(/ŒŽ|“ú/," ");
printf("%02dŒŽ%02d“ú\n",$1,$2);
}
‚Ć‚ŠD
ƒtƒB[ƒ‹ƒhƒZƒpƒŒ[ƒ^‚ރfƒtƒHƒ‹ƒg(”źŠpƒXƒy[ƒX)‚Ěę‡‚ˁD

300ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 11:15:10
>296
Perl‚ĹŠČ’P‚ɏ‘‚Ż‚é‚Č‚çAˆę’UPerlƒR[ƒhŽN‚ľ‚Ä‚­‚ę‚é‚ŠH
‚Ç‚¤‚ŕŽd—l‚Ş‚ć‚­‰đ‚ç‚ń‚Ě‚žc

301ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 11:54:28
print gensub(/0([0-9])([0-9])/, "\\1\\2", "g", gensub(/([0-9]+)/, "0\\1", "g",
$1))

‰ä‚Č‚Ş‚ç‰˜‚Ë‚Ľ‚Č‚Ÿ(LĽƒÖĽM)
>>299‚Ě•ű‚Ş‚˘‚˘‚Č

302ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 12:27:22
>>298,300 ’uŠˇ‚ľ‚Č‚˘‚Ĺ•Ď‚Ś‚˝‚˘‚Ć‚ą‚ž‚Żo—Í‚ˇ‚é‚Č‚ç‚ą‚¤‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
#!/usr/bin/perl
while(1){
$line = <STDIN>;
if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú/){
$month = $1; $day = $2;
if($month >= 10) {
if($day >=10){
print "$& -> [[$monthŒŽ$day“ú]]";
}
else {
print "$& -> [[$monthŒŽ$day“ú|$monthŒŽ0$day]]";
}
}
else{
if($day >=10){
print "$& -> [[$monthŒŽ$day“ú|0$monthŒŽ$day]]";
}
else{
print "$& -> [[$monthŒŽ$day“ú|0$monthŒŽ0$day]]";
}
}
}
}
1ŒŽ1“ú - ƒ†[ƒ“ą“ü10Žü”NB
1ŒŽ1“ú -> [[1ŒŽ1“ú|01ŒŽ01]]
12ŒŽ31“ú - ƒjƒ…[ƒˆ[ƒN‚Ěƒ}ƒ“ƒnƒbƒ^ƒ“‹´ŠJ’Ę100Žü”NB
12ŒŽ31“ú -> [[12ŒŽ31“ú]]
8ŒŽ21“ú - ƒnƒƒCBB§50Žü”NB
8ŒŽ21“ú -> [[8ŒŽ21“ú|08ŒŽ21]]
10ŒŽ1“ú - ƒpƒ‰ƒI“Ć—§15Žü”NB
10ŒŽ1“ú -> [[10ŒŽ1“ú|10ŒŽ01]]

303ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 14:16:23
‚Č‚ń‚Š‘f’ź‚ÉPerl‚Ĺ‚â‚Á‚˝‚Ů‚¤‚ŞŠy‚ť‚¤‚ž‚Č‚ A‚ť‚ęB
‚ż‚Ȃ݂ɁA‚ť‚ĚƒR[ƒh‚ś‚á–łŒŔƒ‹[ƒv‚ˇ‚é‚źB
#!/usr/bin/perl
while($line = <STDIN>) {
    if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú/) {
        $month = $1; $day = $2;
        if($month < 10 || $day < 10) {
            printf "%s -> [[%dŒŽ%d“ú|%02dŒŽ%02d]]\n", $&, $month, $day, $month, $day;
        }
        else {
            print "$& -> [[$monthŒŽ$day“ú]]\n";
        }
    }
}

304ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 14:44:03
‚ž‚ß‚žcƒR[ƒh‚ĚˆÓ–Ą‚Í•Ş‚Š‚é‚ŞCŽd—l‚Ş—Ç‚­•Ş‚Š‚ç‚ńD

305ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 14:47:14
7ŒŽ7“ú
‚Ć‚˘‚¤•śŽš—ń‚đ
[[7ŒŽ7“ú|07ŒŽ07“ú]]
‚Ć’u‚ŤŠˇ‚Ś‚éA‚Á‚Ä‚ą‚Ć‚Ĺ‚ľ‚ĺB
‚Č‚ń‚Ĺ•Ş‚Š‚ç‚ń‚Š‚Č‚ŸB‚ť‚Á‚ż‚Ě‚Ş•Ş‚Š‚ç‚ńB

306ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 14:53:30
“ü—Í‚Ş07ŒŽ07“ú‚ž‚Á‚˝‚çC
o—Í‚Í[[07ŒŽ07“ú|07ŒŽ07“ú]]‚É‚Č‚é‚ć‚ˁH‚ą‚ę‚ÍOK?
‚ť‚ŕ‚ť‚ŕC‚ť‚¤‚˘‚¤“ü—Í‚Í‹N‚ą‚č‚Ś‚Č‚˘‚́H

>>305
‚ť‚ń‚ČŠ´‚ś‚Ĺ‚ˇB
–Ú“I‚đŒž‚Á‚Ä‚˘‚Č‚˘‚̂ŁA‰˝‚Ş‚â‚č‚˝‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ç‚Č‚˘‚Ě‚ž‚ĆŽv‚˘‚Ü‚ˇB
‘‚˘˜bAWiki‚Ě‹L–@‚đŽg‚Á‚ăŠƒ“ƒN‚đ’Ł‚č‚˝‚˘‚Ě‚Ĺ‚ˇB
0‚đ‚­‚í‚Ś‚ÄŒ…‚𒲐Ž‚ľ‚Ä‚˘‚闝—R‚Í
•śŽš—ń‚Ć‚ľ‚ă\[ƒg‚ľ‚Đł‚ľ‚­¸‡‚É•Ŕ‚Ԃ悤‚É‚ˇ‚é‚˝‚ß‚Ĺ‚ˇB—á‚Ś‚ÎWikipedia‚Č‚ç
7ŒŽ7“ú‚Ě‚Ć‚Ť‚́A[[7ŒŽ7“ú|07ŒŽ07“ú]]‚Ć‚ˇ‚é‚ą‚Ć‚Ĺ
ƒŠƒ“ƒN‚Íhttp://ja.wikipedia.org/wiki/7ŒŽ7“ú
•\ŽŚ‚ł‚ę‚é•śŽš—ń‚Í 07ŒŽ07“ú@
‚Ć‚Č‚č‚Ü‚ˇB
‚ą‚ę‚đƒ\[ƒg‚Ĺ‚Ť‚éƒe[ƒuƒ‹‚Ě—v‘f‚É‚ľ‚Ü‚ˇBŽQl‚Ü‚Ĺ‚É
http://ja.wikipedia.org/wiki/Help:%E8%A1%A8%E3%81%AE%E4%BD%9C%E3%82%8A%E6%96%B9#.E5.86.8D.E6.95.B4.E5.88.97.E5.8F.AF.E8.83.BD.E3.81.AA.E8.A1.A8
‚ą‚̏ˆ—‚Íawk‚Ĺ‚ŕ‰Â”\‚Č‚ą‚Ƃ͉”\‚ž‚Á‚˝‚ń‚Ĺ‚ˇ‚ށA–ł’m‚Č‚š‚˘‚Š
‚¨‚ť‚ë‚ľ‚­•sŠiD‚É‚Č‚č‚Ü‚ľ‚˝B

>>306
‚ť‚ęŽv‚˘‚Ü‚ľ‚˝B‚Ĺ‚Ť‚ę‚Î
07ŒŽ07“ú->[[7ŒŽ7“ú|07ŒŽ07“ú]]
‚̂悤‚ɏˆ—‚ľ‚˝‚˘‚Ĺ‚ˇB

308ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 18:26:07
>>303
‚ť‚ę‚Ĺ‚ˇB‚ť‚¤‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB

309ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 21:17:06
# gawk ‚É‚ć‚é match ŠÖ”‚ĚŠg’Ł‚đŽg‚Á‚Ä‚˘‚é.
# ˆęs‚É•Ą”‰ńŒť‚ę‚˝ę‡‚Í–łŽ‹.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ú|%02dŒŽ%02d“ú]]", $0, a[2], a[1], a[2], a[1]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ú]]", $0, a[2], a[1]));
        }
    }
    print $0;
}

3103092009/08/06(–Ř) 21:21:15
# ’ůł.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ú|%02dŒŽ%02d“ú]]", a[1], a[2], a[1], a[2]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ú]]", a[1], a[2]));
        }
    }
    print $0;
}

311ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/06(–Ř) 23:59:03
>>310 ŠŽŕř‚Ĺ‚ˇBĄ“x‚Š‚ç‚ą‚ę‚đŽg‚˘‚Ü‚ˇ—L“‚˛‚´‚˘‚Ü‚ľ‚˝B

$ cat test.txt
1ŒŽ1“ú #mŒŽd“ú
01ŒŽ1“ú #0mŒŽd“ú
1ŒŽ01“ú #mŒŽ0d“ú
01ŒŽ01“ú #0mŒŽ0d“ú

2ŒŽ10“ú #mŒŽdd“ú
02ŒŽ10“ú #0mŒŽdd“ú

11ŒŽ3“ú #mmŒŽd“ú
11ŒŽ03“ú #mmŒŽ0d“ú

12ŒŽ16“ú #mmŒŽdd“ú

$ awk -f test.awk test.txt
[[1ŒŽ1“ú|01ŒŽ01“ú]] #mŒŽd“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #0mŒŽd“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #mŒŽ0d“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #0mŒŽ0d“ú

[[2ŒŽ10“ú|02ŒŽ10“ú]] #mŒŽdd“ú
[[2ŒŽ10“ú|02ŒŽ10“ú]] #0mŒŽdd“ú

[[11ŒŽ3“ú|11ŒŽ03“ú]] #mmŒŽd“ú
[[11ŒŽ3“ú|11ŒŽ03“ú]] #mmŒŽ0d“ú

[[12ŒŽ16“ú]] #mmŒŽdd“ú

312ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/07(‹ŕ) 06:34:47
Ĺ‰‚É‚ť‚¤‚˘‚¤ƒeƒXƒgƒoƒ^[ƒ“‚đo‚ť‚¤‚Ë

313ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/07(‹ŕ) 11:45:35
‚ą‚ą‚̏Zl‚ރR[ƒfƒBƒ“ƒOD‚Ť‚ž‚Š‚ç‚Á‚ÄŠĂ‚Ś‚â‚Ş‚Á‚Ä(LĽƒÖĽM)

> perl‚Č‚ç‚í‚č‚ĆŠČ’P‚Č‚Ě‚Ĺ‚ˇ‚ށAawk‚ĹŠČ’P‚É‚˘‚Ť‚Ü‚ˇ‚ŠH
‚Á‚ÄŒž‚Á‚Ä‚é‚ń‚ž‚Š‚çAu‚˘‚Ť‚Ü‚ˇv‚Á‚Ä“š‚Ś‚č‚Ⴂ‚˘‚ń‚ž‚ć‚Č

314ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/07(‹ŕ) 11:46:39
>>312
‚Č‚É‚ť‚ĚŽ€‚̍si‚ą‚킢

315ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/15(“y) 11:36:30
ƒoƒ^[ƒ“@ƒeƒXƒg‚ĚƒfƒXƒ}[ƒ`

316ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/08/16(“ú) 09:46:09
>>294
3.1.7ƒx[ƒX‚ĚWindows—pƒoƒCƒiƒŠAo‚Ü‚ľ‚˝B
ttp://www.kt.rim.or.jp/%7Ekbk/gawk-3.1/index.html#GAWK-DOWNLOAD

317222.248.109.702009/08/17(ŒŽ) 17:45:07
ŽŠ“ŽÄl š@@ŽŠ“Ž•ŰŽç ŸKAWORUKOFI@@ŽŠ“Ž•ŰŽç#K9K?_D[L

–źŒžW@‚ť‚Ě‚R
w‚˘‚‚ŕƒTƒ{‚Á‚Ă΂Š‚č‚ĚƒLƒƒƒbƒv‚ރEƒ[‚Śx

http://yutori7.2ch.net/test/read.cgi/news4vip/1249830540/@ID:PVAf+dux0@@ŽŠ“ŽÄl š
> 71 FˆČ‰şA–ź–ł‚ľ‚É‚Š‚í‚č‚Ü‚ľ‚ÄVIP‚Ş‚¨‘—‚č‚ľ‚Ü‚ˇ [sage] F2009/08/10(ŒŽ) 00:58:57.28 ID:PVAf+dux0
> >>69
> ‘ĺ•Ď‚Á‚ÄŒž‚¤‚Š
> –ˆ“úA•ń‚ł‚ę‚˝‚Ě‚đŒŠ‚ÄA”ť’f‚ľ‚āAˆ—‚ľ‚āAŠŽ—š•ń‚ľ‚āAˆČ‰şƒ‹[ƒvB
> ‚ż‚ĺ‚Á‚Ć‚Ĺ‚ŕƒ~ƒX‚ˇ‚é‚ƁA•’i‚͍ě‹Ć‚ŕ‚ľ‚Ä‚Č‚˘ƒLƒƒƒbƒv‚ł‚ń‚˝‚ż‚Ş‚ł‚ń‚´‚ń•ś‹ĺŒž‚Á‚Ä‚Ť‚Ä
> ‚ť‚ĚŒž‚˘‚í‚Ż‚đl‚Ś‚Č‚˘‚ƁAƒLƒƒƒbƒv‚Í‚­’D‚ł‚ę‚˝‚čƒAƒJƒEƒ“ƒg“€Œ‹‚ł‚ę‚˝‚股‚é‚Š‚ç
>
> “o˜^‚ł‚ę‚Ä‚Š‚çˆę”NˆČăŒo‚Á‚āA‚â‚Á‚Ć‚˘‚˘‚˝‚˘‚ą‚ĆŒž‚Ś‚é‚悤‚É‚Č‚Á‚Ä‚Ť‚˝‚ćB



----------------------------------------------
‚ą‚ĚŽŠ“ŽÄl šƒ[ƒ‹ƒ}ƒKƒWƒ“‚Ě”zM’âŽ~‚đ‚˛Šó–]‚ł‚ę‚é•ű‚Í
http://qb5.2ch.net/test/read.cgi/sec2chd/1250169591/
‚É‚ÄŽŠ“ŽÄl š‚Ü‚Ĺ‚˛˜A—‚­‚ž‚ł‚˘

318ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/10/24(“y) 17:23:04
ĹŒă‚Ě10s‚đˆ—‚ľ‚˝‚­‚Č‚˘ę‡A‚Ç‚¤‘‚Ż‚Ηǂ˘‚Ĺ‚ľ‚傤‚ŠH

319ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/10/24(“y) 18:19:03
ĹŒă‚Ü‚Ĺ“Ç‚Ü‚¸‚ÉĹŒă‚Ě10s‚Š‚Ç‚¤‚Š”ť’股‚é•ű–@‚Í–ł‚˘‚ž‚낤‚Č
ˆ—‘ÎŰ‚Şƒtƒ@ƒCƒ‹‚Č‚çAŽ–‘O‚Éwc -l‚Š‰˝‚Š‚ōs”’˛‚×‚Ä awk ‚É“n‚ľ‚Ä‚Ý‚Ä‚Í

320ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/10/24(“y) 18:52:07
Ź‚é’öA‚ą‚ęA‚Ć‚˘‚¤•ű–@‚Í–ł‚ł‚ť‚¤‚Ĺ‚ˇ‚Ë
‚ż‚ĺ‚Á‚ƍl‚Ś‚Č‚Ş‚ç‚â‚Á‚Ä‚Ý‚Ü‚ˇ

321ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/10/24(“y) 19:15:52
‚Ć‚č‚ ‚Ś‚¸A‚ą‚ń‚ČŠ´‚ś‚É‚ľ‚Ü‚ľ‚˝
BEGIN {
SKIPTAILS = 10
}
{
line = buf[1]
for(i=1;i<SKIPTAILS;i++) buf[i] = buf[i+1]
buf[SKIPTAILS] = $0
}
NR > SKIPTAILS {
# line‚đˆ—
}

322ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/10/24(“y) 22:11:41
>>321 l‚Ś•ű‚Í“Ż‚ś‚ž‚Ż‚ǁAfor‚Ş‹C‚É‚Č‚Á‚˝‚Ě‚Ĺ
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ŏˆ—‚ˇ‚é‚悤‚É‚ľ‚Ä‚Ý‚˝B

BEGIN {
@@SKIPTAILS = 10
@@ringpos = SKIPTAILS
}
{
@@ringpos = (ringpos + 1) % SKIPTAILS
@@line = buf[ringpos]
@@buf[ringpos] = $0
}
NR > SKIPTAILS {
@@# line‚đˆ—
}

323ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/10/24(“y) 23:18:06
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
ƒŠƒ“ƒOƒoƒbƒtƒ@A•×‹­‚É‚Č‚č‚Ü‚ľ‚˝
Žg‚í‚š‚Ä’¸‚Ť‚Ü‚ˇ

324ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/11/19(–Ř) 20:22:22
>>42
sed awk ‚ľ‚Ä‘DŽR‚É“o‚é@‚ž‚ëH

325ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/11/23(ŒŽ) 12:06:14
Žż–â‚Ĺ‚ˇ
gawk‚Ĺ
{
printf("%d,%s\n", NR, $0 ) > FILENAME;
}
‚Ć‚˘‚¤s“ނɔԍ†‚đU‚Á‚Ä•Ű‘ś‚ˇ‚鏈—‚đ‚ľ‚Ä

batƒtƒ@ƒCƒ‹‚ĹˆęŠ‡ˆ—‚ł‚š‚悤‚Ć‚ľ‚˝‚ń‚Ĺ‚ˇ‚Ş
c:\windows\gawk\gawk -f g:\ě‹Ć—p\n.awk g:\ě‹Ć—p\*.txt

ŽŔsŒ‹‰Ę‚Ş
ƒtƒ@ƒCƒ‹1@@ƒtƒ@ƒCƒ‹2
1‚`@@@@@@4‚c@@
2‚a@@@@@@5‚d@
3‚b@@@@@@6‚e
‚É‚Č‚č‚Ü‚ˇ

ƒtƒ@ƒCƒ‹2‚ŕ
1‚c
2‚d
3‚e
‚É‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH

326ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/11/23(ŒŽ) 12:27:22
FNR

327ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/11/23(ŒŽ) 12:35:21
>>326
‚¨‚¨Ao—ˆ‚˝I
v‘Ź‚ȉń“š‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ

328ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/12/21(ŒŽ) 13:53:34
”N––‚Ƀpƒ\ƒRƒ“‚đ”ƒ‚˘Šˇ‚Ś‚悤‚ĆŽv‚Á‚Ä‹@Ží‘I‚Ń‚đ‚ľ‚Ä‚˘‚Ä‚Ó‚Ć‹C‚Ă‚˘‚˝A
‚ ‚ęAvaio‚ĚOS‚ŞWindows7 64bitƒo[ƒWƒ‡ƒ“‚ɁEEE
ƒ_ƒ‚ś‚á‚ńIgawk‚ŞŽg‚Ś‚Č‚­‚Č‚Á‚Ä‚ľ‚Ü‚¤EEE
‚¤[‚ńAAA‚Ü‚˝XP‚đ”ƒ‚¤‚ׂŤ‚ŠEEE”Y‚ށEEE

329ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2009/12/21(ŒŽ) 14:21:01
>>328
ŽŠ•Ş‚ĹƒRƒ“ƒpƒCƒ‹‚ľ’ź‚š‚΂˘‚˘‚ž‚Ż‚ś‚á‚Č‚˘‚́H

330ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/01/14(–Ř) 03:52:20
ƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK•œŠ§‚ž‚Á‚ĂˁB
ttp://slashdot.jp/developers/article.pl?sid=10/01/06/0345207

‘˝•Ş•K—vŤ‚đŠ´‚ś‚Č‚˘’ö“x‚É‚ÍŽg‚Á‚Ä‚é‚Š‚çA”ƒ‚í‚Č‚˘‚Ż‚ÇŠđ‚ľ‚˘B
•z‹ł—p‚É”ƒ‚¤‚Á‚Ä‚Ě‚ŕ‚ż‚ĺ‚Á‚ƂȁB


331ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/02/28(“ú) 11:08:56
AAA BBB CCC c -O ZZZ YYY XXX c

awkVŽQ‚Ĺ‚ˇB
-O(ƒIƒvƒVƒ‡ƒ“)‚đŒŸő‚ľA
-O‚Ć‚ť‚ęˆČ~‚đƒŠƒ_ƒCƒŒƒNƒg‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށc
—Ç‚˘•ű–@A‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š

332ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/02/28(“ú) 15:36:31
ƒŠƒ_ƒCƒŒƒNƒg‚Á‚Ä‚Ç‚¤‚˘‚¤ˆÓ–Ą‚ĹŽg‚Á‚Ä‚é?

‚ť‚Ě AAA ‚ĹŽn‚Ü‚é•śŽš—ń‚ŕˆę‘Ě‚Ç‚¤‚˘‚¤‚ŕ‚̂Ȃ́B
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Č‚Ě‚ŠAƒtƒ@ƒCƒ‹‚Š‚ç“ǂݍž‚ń‚Ĺ‚­‚é‚Ě‚Ć‚ŠB

—pŒę‚Ćó‹ľ‚Í‚Ť‚ż‚ń‚Ə‘‚˘‚Ä‚­‚ęB

333ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/02/28(“ú) 16:19:07
D:\My Documents\gawk\331>type 331.txt
AAA BBB CCC c -O ZZZ YYY XXX 0c
AAA BBB CCC c -O ZZZ YYY XXX 1c
AAA BBB CCC c -O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>type 331.awk
{match($0, " -O .*", a);
print a[0];}

D:\My Documents\gawk\331>gawk -f 331.awk 331.txt >a.txt

D:\My Documents\gawk\331>type a.txt
-O ZZZ YYY XXX 0c
-O ZZZ YYY XXX 1c
-O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>

3343312010/02/28(“ú) 18:43:32
ƒŒƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>332‚ˇ‚Ý‚Ü‚š‚ńB‘‚Ť’ź‚ľ‚Ü‚ˇB
AAA BBB CCC c -O ZZZ YYY XXX c
‚Ə‘•Ą”s‘‚Š‚ę‚˝ƒtƒ@ƒCƒ‹‚Ş‚ ‚čA
u-OvˆČ~‚Ě•śŽš—ń‚đ•Ęƒtƒ@ƒCƒ‹‚É•Ű‘ś‚ˇ‚é
‚Á‚Ä‚ą‚Ć‚đ‚ľ‚˝‚Š‚Á‚˝‚Ě‚Ĺ‚ˇB

>>333
ƒGƒXƒp[‚Č•ś‚ž‚Á‚˝‚Ě‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‘z’č‚ľ‚Ä‚˝‚Ě‚Í‚ť‚ń‚ČŠ´‚ś‚Ĺ‚ˇB
‚˝‚žˆČ‰ş‚ĚƒGƒ‰[‚ޏo‚ďăŽč‚­‚˘‚Ť‚Ü‚š‚ńc

gawk: 331.awk:2: fatal: match() cannot have 3 arguments

matchŽg‚Á‚Ä‚é‚Ě‚Éa‚Ć‚˘‚¤3‚Â–Ú‚Ěˆř”‚đŽg‚Á‚Ä‚é‚Š‚çc‚Á‚Ä‚ą‚Ć‚Ĺ‚ľ‚傤‚ŠcH

335ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/02/28(“ú) 19:00:04
Q: make spits out errors like Makefile.awk:256: fatal: match() cannot have 3 arguments

A: Your AWK is too old to recreate the Makefile. The build is done based on the distributed Makefile. Everything shall compile successfully though.
So if the compile succeeds just ignore such errors, please.

3363352010/02/28(“ú) 19:22:38
{print substr($0, match($0, " -O .*")+1);}

3373312010/02/28(“ú) 20:03:12
>>336
o—ˆ‚Ü‚ľ‚˝B‚Ü‚ł‚Š–{“ú’†‚É‰đŒˆ‚Ĺ‚Ť‚é‚Ć‚ÍŽv‚˘‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‘ĺ•Ď•×‹­‚É‚Č‚č‚Ü‚ľ‚˝B

338ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/02/28(“ú) 22:25:50
ÎŢż@–{“–‚ɕ׋­‚É‚Č‚Á‚˝‚Š‚Ç‚¤‚Š‚Í‹^–â‚žĽĽĽ
@‚¨‚Á‚ĆˆęŒžƒIƒE‚Š‚Á‚˝‚ŠB

339ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/04(–Ř) 15:04:38
gsub()‚Ć‚Š‚Ĺˆř”‚ɕϐ”‚đ—˜—p‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
gsub(str1,str2)‚Ý‚˝‚˘‚ɁB

340ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/04(–Ř) 21:44:52
>>339
man gawk‚ć‚č
gsub(r, s [, t])
For each substring matching the regular expression r in the string t,
substitute the string s, and return the number of substitutions.
If t is not supplied, use $0. An & in the replacement text is
replaced with the text that was actually matched. Use \& to get a
literal &. (This must be typed as "\\&"; see GAWK: Effective AWK
Programming for a fuller discussion of the rules for &'s and
backslashes in the replacement text of sub(), gsub(), and gen sub().)

341ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/08(ŒŽ) 21:36:03
awk 'BEGIN{x="ABCDE";y="BCD";z="XXX";gsub(y,z,x);print x}'

‰˝‚Ş“ď‚ľ‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ç‚ńB

342ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/17(…) 22:07:37
ŽžXawk‚ž‚Ć’x‚˘‚Ě‚Ĺperl‚ɏ‘‚ŤŠˇ‚Ś‚é‚Ć‚˘‚¤l‚Ş‚˘‚Ü‚ˇ‚ށA
ŽŔŰ‚Ě‚Ć‚ą‚ë‘Ź‚­‚Č‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
Ž„‚̊‹Ť‚Ĺ‚Íforƒ‹[ƒv‚â‰ÁŽZ‚Č‚Ç‚Íawk‚Ě‚Ů‚¤‚Ş‘Ź‚ť‚¤‚Ĺ‚ˇ‚ށA
‚ǂ̂悤‚ȏˆ—‚Ěę‡‚Éperl‚Ě‚Ů‚¤‚Ş‘Ź‚­‚Č‚č‚Ü‚ˇ‚ŠH

$ time mawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};printf("%f\n" ,x)}'
500000500000.000000

real 0m0.131s
user 0m0.120s
sys 0m0.000s
$ time gawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};print x}'
500000500000

real 0m0.289s
user 0m0.284s
sys 0m0.000s
$ time perl -e '$x=0;for($i=1;$i<=1000000;$i++){$x=$x+$i};print $x'
500000500000
real 0m0.379s
user 0m0.376s
sys 0m0.004s

343ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/17(…) 22:26:14
>>342
uawk‚ž‚Ć’x‚˘‚Ě‚Ĺperl‚ɏ‘‚ŤŠˇ‚Ś‚é‚Ć‚˘‚¤lv ‚É•ˇ‚Ż‚ΕނŠ‚é

344ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/19(‹ŕ) 09:08:06
>>342
’x‚˘‚Ć‚˘‚¤awk‚Ígawk‚Č‚Ě?
‘f‚Ěawk‚ć‚čgawk‚Ě•ű‚Ş‘‚­‚Č‚Š‚Á‚˝‚Á‚ŻH

345ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/20(“y) 01:03:01
ƒJ[ƒjƒnƒ“‚ĆƒpƒCƒN‚́wƒvƒƒOƒ‰ƒ~ƒ“ƒOě–@x‚Éawk‚Ćperl
i‚ĆC‚ĆC++‚ĆJAVAj‚Ě”äŠr‚Ş‚ ‚é‚Č

Ą‚Ěƒ}ƒVƒ“Žg‚Á‚ď‘‚ŤŠˇ‚Ś‚Č‚Ť‚á‚Č‚ç‚Č‚˘‚Ů‚Ç’x‚˘‚Á‚Ä
‚Ç‚ń‚ȏˆ—‚Č‚ń‚ž‚낤H

346ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/21(“ú) 13:44:10
>342
awk “™‚đ‘g‚ݍ‡‚í‚š‚ÄŽŔs‚ˇ‚é‚ĆƒvƒƒZƒX‹N“Ž‚ĚƒRƒXƒg‚Ş‚Š‚Š‚é‚Ě‚Ĺ perl ‚Ĺˆę‚‚ɓZ‚ß‚éA‚Ć‚˘‚¤˜b‚ś‚á‚Č‚˘‚́H

347ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/22(ŒŽ) 17:35:11
•śŽšƒR[ƒh‚ĚƒR[ƒh‚đ•Ď”‚É‚ľ‚Ä•śŽš—ń‚đ‘€ě‚ˇ‚é‚ą‚Ć‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
•śŽš—ń’†‚Ě‘SŠp•śŽš‚𔟊p•śŽš‚É•Ď‚Ś‚é‰Ř—í‚Č•ű–@‚đ–͍ő‚ľ‚Ä‚˘‚Ü‚ˇB

348ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/22(ŒŽ) 18:01:58
Use iconv.

349ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/22(ŒŽ) 18:25:10
> •śŽšƒR[ƒh‚ĚƒR[ƒh‚đ•Ď”‚É‚ľ‚Ä•śŽš—ń‚đ‘€ě‚ˇ‚é‚ą‚Ć‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH

‚Č‚É‚đ‚ľ‚˝‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ń‚Č‚˘‚ń‚ž‚Ż‚ǁB

> •śŽš—ń’†‚Ě‘SŠp•śŽš‚𔟊p•śŽš‚É•Ď‚Ś‚é‰Ř—í‚Č•ű–@‚đ–͍ő‚ľ‚Ä‚˘‚Ü‚ˇB

‰Ř—í‚Č‚Ě‚ÍtrƒRƒ}ƒ“ƒh‚đŽg‚¤•ű–@B‚˝‚žtr‚ރ}ƒ‹ƒ`ƒoƒCƒg‚đ‚¤‚Ü‚­ˆľ‚Á‚Ä‚­‚ę‚é‚Š
‚Ç‚¤‚Š‚Í‚ą‚ą‚ë‚ŕ‚Ć‚Č‚˘B
Perl‚Č‚çtr‚đARuby‚Č‚ç•śŽš—ńƒNƒ‰ƒX‚Ětrƒƒ\ƒbƒh‚đA
Python‚Č‚çstringƒ‚ƒWƒ…[ƒ‹‚ĚmaketransŠÖ”‚Ć•śŽš—ń‚Ěƒƒ\ƒbƒhtranslete‚đŽg‚¤A
‚Ć‚˘‚¤Žč‚Ş‚ ‚éB
awk‚Č‚˘‚ľitrˆČŠO‚́jŒĂ“T“I‚Čƒc[ƒ‹‚ʼnؗí‚É‚â‚é•ű–@‚Í‚Č‚˘‚ĆŽv‚¤B

350ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/24(…) 17:11:16
Excel‚Ĺ
‘SŠp”źŠp•ĎŠˇ‚Í ASC()
”źŠp‘SŠp•ĎŠˇ‚Í JIS()

351ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/25(–Ř) 08:34:11
>>347
1. EUC-JP‚É‚ľ‚Ä(nkf‚Ć‚Š)kakasi ‚ŁA–ß‚ˇ
2. ‚ť‚ę‚ž‚Á‚˝‚çĹ‰‚Š‚çAnkf -Z
3. gawk‘O’ń‚ŁA•śŽš–ˆ‚ɏˆ—(LANG‚đŽw’č‚ľ‚ÄŽqƒvƒƒZƒX‹N“Ž)

awk‚Ě’†‚ŕ‚ś‚Ä‚â‚é‚Ě‚Í‚ß‚ń‚Ç‚­‚ł‚ť‚¤

352ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/03/29(ŒŽ) 23:34:27
gawk 3.1.6
system(cmd) ‚đŽg‚¤‚ƁAƒAƒ“ƒ`ƒEƒBƒ‹ƒXƒ\ƒtƒg(kaspersky)‚Ě
ƒAƒvƒŠƒP[ƒVƒ‡ƒ“—š—đ‚Ƀoƒbƒ`ƒtƒ@ƒCƒ‹‚Ş“o˜^‚ł‚ę‚é‚Ě‚đ”­ŒŠB
close(cmd) ‚ľ‚Ä‚ŕ“Ż‚śB

while(cmd|getline>0){}
‚Ĺ‘ă—p‚ˇ‚é‚ĆŽc‚ç‚Č‚­‚Č‚Á‚˝B??

353ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/13(–Ř) 00:22:57
•§‚Ĺƒuƒ‹ƒJ”Ű’č‚ĚŒˆ‹cĚ‘đ@u‘‚̉ż’lŠĎ‚Ć‘Š—e‚ę‚Č‚˘v
http://www.cnn.co.jp/world/AIC201005120004.html

ƒeƒwƒ‰ƒ“‚ŁAƒuƒ‹ƒJ‚đ’…‚Ä“üo‘‚ˇ‚鎞‚Á‚āAŠç‚Ěƒ`ƒFƒbƒN‚Ç‚¤‚ˇ‚é‚ń‚ž‚낤B
‘źl‚â’j‚Ĺ‚ŕ‚΂ę‚Č‚˘‚́H

354ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/13(–Ř) 00:23:49
>>353
Œë”šƒXƒ}ƒ“

355ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/14(‹ŕ) 13:38:24

356ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 10:51:40
awk‚Ěprint‚ɂ‚˘‚Ä‚˛‹łŽŚ‰ş‚ł‚˘B

‰ş‚̂悤‚ȏo—Í‚Ş—L‚Á‚˝ę‡A—á‚Ś‚Î
lrwxrwxrwx 1 root root 70 May 18 10:37 hoge

ls -al | awk '{print$1$2$2$4$6$7$8$9}' ‚Ć‚ˇ‚ę‚΁u$5v‚Ě
u70v‚𔲂­‚ą‚Ć‚Şo—ˆ‚Ü‚ˇ‚ށA‚ą‚ę‚Ş$100‚Ć‚Š‚Ü‚Ĺ‘ą‚­ę‡A
u$5v‚ž‚Ż‚𔲂Ť‚˝‚˘ę‡‹Lq‚Ş‘ĺ•Ď‚É‚Č‚č‚Ü‚ˇB

‰˝‚Š—Ç‚˘•ű–@‚Í–ł‚˘‚ŕ‚Ě‚Ĺ‚ľ‚傤‚ŠH

357ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 11:01:32
$n‚É‘ă“ü‚Ş‚ ‚é‚ƁA‚ť‚ĚŽž“_‚Ĺ$0‚ލč\Ź‚ł‚ę‚éB

‹ćŘ‚č‚Ě‹ó”’‚Ş$5‚Ě‚ ‚Á‚˝‚Ć‚ą‚ë‚ž‚Ż2ŒÂ‚É‚Č‚é‚Ě‚Ş‹C‚É‚Č‚ç‚Č‚Ż‚ę‚΁A
ls -al | awk '{$5 = ""; print}'
‚Ć‚ˇ‚ę‚΂悢B

‹ó”’2ŒÂ‚đCł‚ˇ‚é‚Č‚ç‚ą‚¤‚ˇ‚éB
ls -al | awk '{$5 = ""; print $0}' | awk '{$1 = $1; print}'

358ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 11:03:15
$0 ‚Í—]Œv‚ž‚Á‚˝B
ls -al | awk '{$5 = ""; print}' | awk '{$1 = $1; print}'

359ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 11:07:03
2‚‚߂Ěawk‚Ě$1 = $1‚͉˝‚Ě‚˝‚ß?

360ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 11:34:06
‚Č‚É‚ŕ‚ľ‚Č‚˘‚ƁA$0‚͓ǂݍž‚ń‚ž‚ť‚Ě‚Ü‚Ü‚Č‚Ě‚Ĺ‹ó”’2ŒÂ‚Í‹ó”’2ŒÂ‚̂܂܁B
$1=$1‚Ĺ‘ă“ü‚ľ‚Ä‚â‚é‚ƁA$1, $2, ...‚đ‹ó”’1ŒÂ‚ł‚Ȃ˘‚ž‚ŕ‚Ě‚Ş$0‚É‘ă“ü‚ł‚ę‚é‚̂ŁA
‹ó”’2ŒÂ‚ž‚Á‚˝‚Ć‚ą‚ë‚Ş‹ó”’1ŒÂ‚É‚Č‚éB

361ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 11:35:04
2‚‚߂Ěawk‚ɐH‚í‚š‚˝Žž“_‚Ĺ$n (n>0)‚Í‹l‚Ü‚é‚Ż‚Ç$0‚Í“ü—͍s‚ť‚Ě‚Ü‚Ü
‹ó”’2ŒÂ‚Č‚Ě‚Ĺ$0‚đÄ\Ź‚ˇ‚é‚Ć‹ó”’1ŒÂ‹ćŘ‚č‚É‚Č‚é

362ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 12:21:12
>>357-358
”ńí‚ɉđ‚č‚₡‚˘‚˛ŕ–žA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚Č‚é‚Ů‚Ç‘ă“ü‚ˇ‚é‚ą‚Ć‚Ĺ‰đŒˆ‚ˇ‚é‚ń‚Ĺ‚ˇ‚ˁB
•×‹­‚É‚Č‚č‚Ü‚ľ‚˝B

363ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 15:08:38
$1 = $1 ‚Á‚ăCƒ}ƒCƒ`‚ć‚­‰đ‚ç‚ń

$1‚Á‚ÄFS‚Ĺ‹ćŘ‚ç‚ę‚˝ˆę‚–ڂž‚ć‚ˁH
‚Č‚ń‚Ĺ‚ť‚ꎊg‚đŽŠ•Ş‚É‘ă“ü‚ľ‚˝‚çƒXƒy[ƒX‚ޏÁ‚Ś‚é‚ńH

364ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 15:27:35
$0‚̍č\Ź‚ލs‚í‚ę‚é‚Š‚ç‚Á‚Äŕ–ž‚ł‚ę‚Ä‚é‚ž‚ëB

$0‚̍č\Ź‚Ć‚Í‚˘‚Á‚˝‚ń‚΂炾‚˝$1,$2,...‚đOFS‚đ‹˛‚ń‚Ĺ
‚‚Ȃ°’ź‚ˇ‚Á‚Ä‚ą‚ƂȂ̂ŁA‰˝‚Ĺ‹ćŘ‚ç‚ę‚Ä‚˘‚˝‚Š‚Í
•Ű‘ś‚ł‚ę‚Č‚˘B

365ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 15:41:56
>>364
>$1=$1‚Ĺ‘ă“ü‚ľ‚Ä‚â‚é‚ƁA$1, $2, ...‚đ‹ó”’1ŒÂ‚ł‚Ȃ˘‚ž‚ŕ‚Ě‚Ş$0‚É‘ă“ü‚ł‚ę‚é

‚Á‚Ä–ń‘ŠŽ–‚đŠo‚Ś‚Ä‚¨‚Ż‚Á‚Ä‚ą‚Ć‚Š‚˘H

366ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 15:42:39
‚ż‚ĺ‚Á‚Ć‹C‚É‚Č‚Á‚ÄŽŽ‚ľ‚Ä‚Ý‚˝B

% echo a b | gawk '{OFS="-";$1=$1;OFS="=";print}'
a=b

Ä\Ź‚Í$1=$1‚đ‚â‚Á‚Ä‚ˇ‚Ž‚ś‚á‚Č‚­‚āAŽŸ‚É$0‚ŞŽg‚í‚ę‚é‚Ć‚ŤA‚Á‚Ä‚ą‚Ć
‚Č‚Ě‚Š‚Č?

3673652010/05/18(‰Î) 16:27:59
‰đ‚Á‚˝

http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html

Œx: ˆę•”‚Ěƒo[ƒWƒ‡ƒ“‚Ěawk‚Í NF‚đŒ¸‚ś‚˝‚Ć‚Ť‚É$0‚̍č\’z‚đs‚í‚Č‚˘B
Œ‹‹Ç‚Ě‚Ć‚ą‚ëAawk‚ɃŒƒR[ƒh‘S‘Ě‚ĚÄ\’z‚đ‹­§‚ľ‚˝‚Ć‚Ť‚É‚Í‚ť‚ĚŽž“_‚Ĺ
ƒtƒB[ƒ‹ƒh‚Ě’l‚ĆOFS‚ŞŽg‚í‚ę‚éBÄ\’z‚đs‚¤‚˝‚߂ɂ́A‰˝‚ç‚Š‚Ě–łŠQ‚Č
‘ă“ü‚đs‚¤:

$1 = $1 # force record to be reconstituted


ŒŤ‚­‚Č‚Á‚˝B‚ ‚ń‚Ş‚ĆB

368ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/18(‰Î) 16:46:58
awk‚Íšú‚ސ[‚˘‚Ě‚§

369ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/19(…) 22:24:52
‹v‚ľ‚Ô‚č‚É‚˘‚˘‚ŕ‚ń‚đŒŠ‚ł‚š‚Ä‚ŕ‚炢‚Ü‚ˇ‚˝„ƒ

370ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/24(ŒŽ) 09:55:14
’m‚ç‚Č‚Š‚Á‚˝B
•×‹­‚É‚Č‚Á‚˝B

371ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/24(ŒŽ) 15:25:46
‚Ý‚ń‚Č>357‚Ě‚¨ˆü‚Ĺ‘˝‚­‚đŠw‚ń‚ž‚ȁB

372ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/05/29(“y) 04:53:07
–ź‘OF
E-mailF
“ŕ—eF
cygwin‚ž‚Ć
% cut -f1 -d, hoge.csv
‚ć‚č
% awk -F, '{print $1}' hoge.csv
‚Ě•ű‚Ş‘Ź‚Š‚Á‚˝B
#ŽŔsŽžŠÔ‚Ë
#PerlHƒVƒ‰ƒl

373ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/06/07(ŒŽ) 11:45:38
>>372
sed -e 's/,.*//'‚Ĺ‚ŕawk‚Ć“Ż‚ś‚­‚炢‚ž‚Š‚çAcut‚ĚŽŔ‘•‚Ş’x‚˘‚ń‚ž‚ˁB
cut‚Ş–ł‘Ę‚ÉƒIƒvƒVƒ‡ƒ“‘˝‚˘Šˆ×‚ś‚á‚Č‚˘?

374ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/06/07(ŒŽ) 12:04:05
ŽčŒł‚ĚlinuxŠÂ‹Ť‚ž‚Ćcut‚Ě•ű‚Ş‘Ź‚˘‚Ć‚˘‚¤•’Ę‚ĚŒ‹‰Ę‚Ĺ‚ľ‚˝‚ށB
hoge.csv‚Í6Œ…‚Ě—”3‚‚đu,]‚Ĺ‹ćŘ‚Á‚Ä•Ŕ‚ׂ˝100–œs‚Ě
ƒtƒ@ƒCƒ‹‚Ĺ‚ˇB

% time cut -f1 -d, hoge.csv >/dev/null
cut -f1 -d, hoge.csv > /dev/null 0.21s user 0.01s system 99% cpu 0.222 total
% time awk -F, '{print $1}' hoge.csv >/dev/nulll
awk -F, '{print $1}' hoge.csv > /dev/nulll 1.52s user 0.03s system 99% cpu 1.558 total

‚ż‚Č‚Ý‚Éƒo[ƒWƒ‡ƒ“‚Í

cut (GNU coreutils) 8.5
GNU Awk 3.1.7

375ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/06/07(ŒŽ) 12:22:48
‚ [‚Č‚é‚قǁA‚Č‚ń‚Š”ť‚Á‚˝Bcygwin‚Ěfgetc()‚Ş’x‚˘‚Š‚ç‚ś‚á‚Č‚˘‚Š‚ȁB
fgetc()‚Ćfgets()‚ĹŽžŠÔ‚đŠr‚ׂ˝‚Ć‚Ť‚Éfgetc()‚Ě•ű‚Ş‚¸‚Á‚Ć’x‚Š‚Á‚˝‹L‰Ż‚Ş‚ ‚éB

376ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/13(ŒŽ) 14:14:54
xgawk (gawk‚Ĺ‚Č‚­)‚É‚Ć‚ ‚éwebƒy[ƒW‚đH‚ׂł‚š‚é‚ƁAXMLERRR (not well-formed)‚Ĺ’†’f‚ľ‚Ü‚ˇB
‚ť‚Ěƒy[ƒW‚Şwell-formed‚Š‹ÉˆŤ‚Š‚ÍŽ„‚É‚Ć‚Á‚Ä‚Ç‚¤‚Ĺ‚ŕ‚ć‚­A’P‚É“ŕ—e‚đ“ž‚˝‚˘‚ž‚Ż‚Ȃ̂ŁA•ś––‚Ü‚Ĺˆ—‚ľI‚Ś‚Ä—~‚ľ‚˘‚Ě‚Ĺ‚ˇB
‚Ç‚¤‚É‚Š‚Č‚ç‚Č‚˘‚Ĺ‚ľ‚傤‚ŠB

377ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/25(“y) 14:55:22
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg“ŕ‚ĹƒpƒCƒv“ü—Í‚ł‚ę‚˝‚ŕ‚Ě‚đˆ—‚ˇ‚é
ƒAƒNƒVƒ‡ƒ“‚đƒqƒAƒhƒLƒ…ƒƒ“ƒg‚ŏ‘‚­Ž–‚͏o—ˆ‚é‚Ĺ‚ľ‚傤‚ŠB

378ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 14:57:18
Žż–â‚Ĺ‚ˇB
ƒf[ƒ^‚Ş
|1|aaa|
|2|bbb|
|3|ccc|
‚Č‚Ç‚Ć‚Č‚Á‚Ä‚˘‚é‚Ć‚Ť
aaa
bbb
ccc
‚đŽć‚čo‚ť‚¤‚Ć‚ľ‚Ä
awk 'FS="|"{print $3}' ƒtƒ@ƒCƒ‹–ź
‚Ć‚ľ‚˝‚ń‚Ĺ‚ˇ‚ށA1s–Ú‚ž‚Ż‚Ş‚¤‚Ü‚­‚Ć‚ę‚Ü‚š‚ńB
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ě1s–Ú‚đ‹ós‚É‚ˇ‚ę‚Î‰đŒˆ‚Ĺ‚Ť‚Č‚˘‚ą‚Ć‚Í‚Č‚˘‚ń‚Ĺ‚ˇ‚ށA
‹ós‚đ“ü‚ę–Y‚ę‚Ä‚ľ‚Ü‚¤Œœ”O‚Ş‚ ‚č‚Ü‚ˇB
‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚ń‚Ĺ‚ľ‚傤‚Š?

379ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 15:01:46
‚â‚č‚˝‚˘‚ą‚Ć‚Í awk 'BEGIN {FS="|"} {print $3}' ‚ś‚á‚Č‚˘‚Š‚ĆŽv‚¤‚ń‚ž‚Ż‚Ç

380ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 15:08:38
378‚Ĺ‚ˇB
>>379
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B

381ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 18:42:12
gensub()‚ɂāAƒ}ƒbƒ`‚ľ‚˝10”Ô–ÚˆČ~‚ĚƒOƒ‹[ƒv‚ĚŽw’č‚ĚŽd•ű‚đ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B
‰ş‹LƒTƒCƒg‚ł́A17”Ô–Ú‚Ü‚Ĺ•’Ę‚ÉŽw’č‚Ĺ‚Ť‚é‚悤‚ČŽ–‚ޏ‘‚˘‚Ä‚ ‚é‚Ż‚ǁA
http://tounderlinedk.blogspot.com/2010/08/gensub-n-awk.html

gensub(pattern,"\\10","g",$2) ‚Ć‚Š‚­‚Ć
\\1(ƒ}ƒbƒ`‰ÓŠ)‚Ć0(•śŽš)‚Ć‚ľ‚ĉđŽß‚ł‚ę‚ż‚á‚Á‚ďăŽč‚­‚˘‚Č‚Š‚˘B

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg•—‚Š‚ĆŽv‚Á‚āA\\{10} ‚ம‚ľ‚˝‚Ż‚ǃ_ƒƒ_ƒbƒ^[B

GNU Awk 3.1.5‚Ĺ‚ˇB

3823812010/09/27(ŒŽ) 19:00:47
BSD‚Ějman‚ɂ́A1‚Š‚ç9‚܂ł̐”Žš‚Á‚Ä–ž‹L‚ł‚ę‚Ä‚é‚Č‚ B
ŽŔ‘•‚É‚ć‚Á‚ĈႤ‚Ě‚Š‚Č‚ 
ƒpƒ^[ƒ“‚đ“Ž“I‚ɐśŹ‚ľ‚ă}ƒbƒ`‚ł‚š‚悤‚Ć‚ľ‚Ä‚é‚Š‚猋\˘‚é(LEƒÖE`)
http://www.linux.or.jp/JM/html/GNU_gawk/man1/gawk.1.html

383ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 19:04:47
>>381
ƒ}ƒjƒ…ƒAƒ‹‚É‚Í1‚Š‚ç9‚Ü‚Ĺ‚Á‚ď‘‚˘‚Ä‚ ‚é‚ľ

Within the replacement text s, the sequence \n, where n is a digit from 1 to 9, may be
used to indicate just the text that matched the n'th parenthesized subexpression.

ƒ\[ƒX‚ĚŠY“–‰ÓŠ(builtin.c‚Ě2542s–Ú‚ ‚˝‚č‚Š‚ç)‚Ý‚Ä‚ŕ1Œ…ŒŔ’č‚ĚƒƒWƒbƒN‚ž‚ćB(3.1.7’˛‚×)

int dig = scan[1] - '0';

‚Č‚ń‚Ä‚â‚Á‚Ä‚éB

384ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 19:08:03
ˆę’U‚Ô‚Á‚˝Ř‚é‚ľ‚Š‚Č‚˘‚ń‚ś‚á‚Ë

3853812010/09/27(ŒŽ) 19:12:31
>>383
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>384
‚ż‚ĺ‚Á‚ĆŒŠ‰h‚ŚˆŤ‚­‚Č‚é‚Ż‚Ç‚ť‚¤‚ˇ‚é(LEƒÖE`)

386ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/27(ŒŽ) 21:27:29
>>381
‚Č‚ń‚Ĺ‚ť‚ą‚Ě‚Đ‚Ć‚Í16‚Ü‚Ĺ‚Ĺ‚Ť‚˝‚ń‚žH

387ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 00:32:52
10‚Ě‘ă‚í‚č‚É:‚đŽg‚Á‚Ä‚˘‚˝‚č‚ľ‚āB

388ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 03:15:24
‚ą‚ĚƒXƒŒ‚ސˇ‹ľ‚Č‚Ě‚Ş’ż‚ľ‚˘‚Š‚ç
‹L”OƒpƒsƒRB

389ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 03:41:50
15”NˆČă‘O‚ž‚Ż‚Çawk‚̕׋­Žn‚ß‚Ä“ŻŽž‚Éperl‚̕׋­‚ŕ‚ľ‚Ä‚˝‚ç
‹C•t‚˘‚˝‚çperl‚΂Á‚Š‚č‚â‚Á‚Ä‚Äawk‚ˇ‚Á‚Š‚č–Y‚ę‚Ä‚ľ‚Ü‚Á‚˝‚Č‚Ÿ
Ą‚ÍperlŽĚ‚ĂĐę‚çpython‚â‚Á‚Ä‚é‚Ż‚Çawk‚ŕ‚˘‚˘‚ć‚Ë

390ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 09:40:13
Busybox‚É‘g‚ݍž‚߂΁A‚ť‚ę‚ą‚ť†”ŃŠí‚â—â‘ ŒÉ‚Ĺ‚ŕ“Ž‚­‚Š‚ç‚Č‚ B
ŽčŒy‚Ĺ‚ ‚é‚É‚ŕŠÖ‚í‚炸AŒ‹\‚“x‚ȏˆ—‚ŕƒKƒŠƒKƒŠ‘‚Ż‚é‚Š‚çD‚ŤB

C‚ĆƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ލD‚Ť‚ž‚Š‚çA•ś–@“I‚É‚ŕ‚ľ‚Á‚­‚č—ˆ‚éB
ăˆĘŒÝŠˇ‚ĚPerl‚ŕ‘ĺD‚ŤB

391ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 14:37:59
>>376‚Ĺ‚ˇ‚ށA’N‚ŕ‚Š‚Ü‚Á‚Ä‚­‚ę‚Č‚˘‚Ě‚ĹŽâ‚ľ‚ł‚ĹŽ€‚É‚ť‚¤‚Ĺ‚ˇB

392ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 14:52:08
>>391
‚Ç‚ę‚Ĺ‚ŕD‚Ť‚Č‚Ě‚đ‘I‚×

1. xgawk‚đ‰ü‘˘
2. ƒGƒ‰[‚É‚Č‚éXML‚đŽ–‘O‚ɏCł‚ľ‚Äwell-formed‚É‚ľ‚Ä‚Š‚çH‚í‚š‚é
3. xgawk‚ÍŽĚ‚Ä‚Ä•Ę‚ĚŒžŒęAƒ‰ƒCƒuƒ‰ƒŠ‚đŽŽ‚ˇ

393ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/09/28(‰Î) 17:23:08
jawk‚Şjwalk‚ÉŒŠ‚Ś‚Ä‚ľ‚Ü‚¤

394ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/01(‹ŕ) 11:21:26
“Ž‚­ŠÂ‹Ť‚Ě‘˝‚ł‡‚ɃCƒ“ƒ^ƒvƒŠƒ^‚đ‘I‚Ô‚ń‚Č‚çA

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg > awk >>> perl >>>>> python >>>>> ruby >>> haskel etc.

‚Ć‚Č‚é‚ž‚낤‚ȁB

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚̓VƒFƒ‹ˆË‘ś‚Č•”•Ş‚Ş‘˝‚­Aperl ‚Ů‚Ç‚‹@”\‚Č‚ŕ‚Ě‚ŕ—v‚ç‚Č‚˘B
‚ť‚ń‚ČŽžAŹ‚ł‚Č’[––‚Ĺ‚ŕƒXƒ}[ƒg‚É“Ž‚˘‚Ä‚­‚ę‚é awk ‚É‚ż‚ń‚ą–u‚B

>>389
ŒžŒę‚ÉŽĚ‚Ä‚é‚ŕE‚¤‚ŕ‚Č‚˘‚ćB‚ť‚ĚŽžX‚É“s‡‚Ě—Ç‚˘‚ŕ‚Ě‚đ‘g‚ݍ‡‚í‚š‚ÄŽg‚¤‚Ě‚ŞUNIX“I‚Č”­‘zB

395ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/01(‹ŕ) 15:33:40
>>394
uˆę”­‚â‚낤v‚Ĺ‚ˇ‚ˁI

396ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/09(“y) 04:40:48
awkĹ‹ß•×‹­‚ľ‚Ä‚éBperl‚ć‚č‘S‘RŠČ’PB
‚ą‚ę‚Ȃ牴‚Ĺ‚ŕÁÜ‚ľ‚Č‚­‚Ä‚ˇ‚Ý‚ť‚¤

397ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/09(“y) 04:57:14
>>396@‚Ş‚ń‚΁I

398ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/21(–Ř) 20:16:46
sjis‚ŏ‘‚˘‚˝
/[/{print}
‚đŽŔs‚ˇ‚é‚Ć

awk:
awk: ^ ł‹K•\Œť‚ޏI’[‚ł‚ę‚Ä‚˘‚Ü‚š‚ńB
awk: ’v–˝“I: [ ‚Ü‚˝‚Í [^ ‚ޑΉž‚ľ‚Ü‚š‚ńB: /[/{print}/

‚ĚƒGƒ‰[‚É‚Č‚Á‚Ä‚ľ‚Ü‚˘‚Ü‚ˇB
[‚Ě2ƒoƒCƒg–Ú‚Ş[‚Č‚š‚˘‚ž‚ĆŽv‚˘‚Ü‚ˇ‚ށA‚Ç‚¤‘Ήž‚ľ‚˝‚炢‚˘‚Ĺ‚ľ‚傤‚ŠH
“ü—̓tƒ@ƒCƒ‹‚Ísjis‚ŏ‘‚Š‚ę‚Ä‚˘‚āA•śŽšƒR[ƒh•ĎŠˇ‚Í‚Ĺ‚Ť‚Ü‚š‚ńB

399ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/21(–Ř) 20:55:41
>>398
ŠÂ‹Ť‚Ě–â‘č‚Č‚ń‚ž‚Š‚çAŽŔsŠÂ‹Ť‚­‚炢‚Ü‚Ć‚ŕ‚ɏ‘‚Ż‚ćB

400ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/21(–Ř) 21:38:24
>>398
gawk ‚đŽg‚¤

401ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/21(–Ř) 22:52:57
ŠÂ‹Ť‚ÍCentOS-5.5-x86_64‚ĹGNU Awk 3.1.5‚Ĺ‚ˇB
/bin/awk‚̓Vƒ“ƒ{ƒŠƒbƒNƒŠƒ“ƒN‚ŁAŽŔ‘Ě‚Ígawk‚Ĺ‚ľ‚˝B

402ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/21(–Ř) 23:49:35
>>401
--help ‰Ĺ

403ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/22(‹ŕ) 01:41:07
Windows‚V(64bit)‚ĹŽg‚Ś‚éawk‚ ‚č‚Ü‚ˇ‚ŠH

404ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/22(‹ŕ) 02:19:30
32bit”Ĺ‚Ěawk‚đ‚đŽg‚¤‚ń‚ś‚áƒ_ƒH

4053982010/10/22(‹ŕ) 07:32:34
‚ą‚¤‚ˇ‚é‚ą‚ƂőΉž‚Ĺ‚Ť‚Ü‚ľ‚˝B
/\x81\[/{print}

406ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/22(‹ŕ) 09:41:36
‚ť‚ę‚Ĺ‚˘‚˘‚Č‚çA/[[]/‚Ĺ‚ŕ‚˘‚˘ŠóƒKƒXB
Ş–{“I‚Č‰đŒˆ‚É‚Č‚Á‚Ä‚Č‚˘‚Ż‚Ç‚Ë‚ĽB

407ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/22(‹ŕ) 13:52:10
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚âƒ_ƒuƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚ĚŽg‚˘•Ş‚Ż‚ś‚á‚ˁ`

4083982010/10/22(‹ŕ) 19:55:53
Ş–{“I‚Č‰đŒˆ‚ˇ‚é‚Ć‚ľ‚˝‚ç•śŽšƒR[ƒh‚đ•Ď‚Ś‚é‚ą‚Ć‚Ĺ‚ľ‚傤‚ŠH

409ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/22(‹ŕ) 20:03:18
“ú–{Œę‚Ě•śŽšƒR[ƒh‚ɑΉž‚ľ‚Ä‚éawk‚đŽg‚¤A‚Ć‚˘‚¤•ű–@‚ŕ‚ ‚éB
Ą‚ ‚é‚Ě‚Š‚Ç‚¤‚Š’m‚ç‚Č‚˘‚Ż‚ǁB

410ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/22(‹ŕ) 20:28:38
Ą‚Ěgawk‚Í•’Ę‚ÉUnicode‘Ήž‚ľ‚Ä‚é‚Ý‚˝‚˘

$ echo '‚Ä‚ˇ‚Ć' | gawk '/[‚Ÿ-‚ń]/ { print length($0) }'
3

UTF-8ƒƒP[ƒ‹‚Ĺ‚ľ‚ŠŽŽ‚ľ‚Ä‚Č‚˘‚Ż‚Ç
cygwin‚Ĺ‚ŕ‘ĺä•v

411ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/23(“y) 01:29:00
>>404
gawk‚Ĺ‚˘‚˘‚Š‚Č

4123992010/10/23(“y) 06:55:10
>>405

–â‘č‚Í‰đŒˆ‚ľ‚˝‚Ě‚Š‚ŕ‚ľ‚ç‚ń‚ށAˆę‰žB
ˆČ‰ş2‚‚ĚWin—pƒoƒCƒiƒŠ‚Í–â‘č‚Č‚˘‚̂ŁAƒ\[ƒX‚ŕ‚ç‚Á‚ÄLinuxă‚ĹƒRƒ“ƒpƒCƒ‹‚ľ‚Ä‚Ý‚˝‚çH

ttp://gnuwin32.sourceforge.net/packages/gawk.htm
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/

4133982010/10/23(“y) 10:53:14
ƒT[ƒoŠÇ—ŽŇ‚ś‚á‚Č‚˘‚Ě‚ĹƒT[ƒo‚đ‚˘‚ś‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘‚Ĺ‚ˇB
‚ą‚ę‚É‚ľ‚˝‚çsjis‚Ĺ‚ŕ“Ž‚­‚悤‚É‚Č‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH

414ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/10/23(“y) 12:27:19
>>413
­‚Č‚­‚Ć‚ŕŽŠ•Ş‚ŞŽŽ‚ľ‚˝Windows2003ă‚ł͂ȁB

¤tes.awk Śsjis
/[/{print}
˘

CentOS5.5ă
$ gawk -f tes.awk readme.ja
awk: tes.awk:1:
awk: tes.awk:1: ^ ł‹K•\Œť‚ޏI’[‚ł‚ę‚Ä‚˘‚Ü‚š‚ńB
awk: tes.awk:1: ’v–˝“I: [ ‚Ü‚˝‚Í [^ ‚ޑΉž‚ľ‚Ü‚š‚ńB: /[/{print}/

Windows2003ă
> gawk -f tes.awk readme.ja
Ëƒ}ƒbƒ`‚ľ‚˝•¨‚Ş•\ŽŚ‚ł‚ę‚é

Linuxă‚ĹƒƒP[ƒ‹‚đsjis.japanese‚Ć‚Š‚É‚ˇ‚ę‚΂˘‚˘‚Ě‚Š‚ĆŽv‚Á‚˝‚ށAƒƒP[ƒ‹•ĎXŽŠ‘Ě‚Ş‚¤‚Ü‚­‚˘‚Š‚Č‚Š‚Á‚˝‚íB
˘‚Á‚Ă鎖‚Ş‚ ‚é‚Č‚çAĹI“I‚ɉ˝‚Ş‚ľ‚˝‚˘‚ŠŒž‚Á‚˝‚Ů‚¤‚Ş‚˘‚˘‚ćB

4153982010/10/23(“y) 12:40:31
Windows2003‚ž‚Ć‚ż‚á‚ń‚Ć“Ž‚­‚ń‚Ĺ‚ˇ‚ˁB
˘‚Á‚Ä‚˘‚˝‚ą‚Ć‚Í405‚Ĺ‰đŒˆ‚ľ‚˝‚Ě‚Ĺ‘ĺä•v‚Ĺ‚ˇB
Ą‚́uŞ–{“I‚Č‰đŒˆv‚É‹ť–Ą‚Ş‚ ‚Á‚˝‚Ě‚Ĺ‚¨•ˇ‚Ť‚ľ‚˝ŽŸ‘ć‚Ĺ‚ˇB

416‰SŽŇ2010/11/04(–Ř) 22:14:10
awk‚ĹƒVƒFƒ‹‚ĚPATH•Ď”‚đƒ}ƒbƒ`‚ł‚š‚é‚Ć‚Ť‚ɃXƒ‰ƒbƒVƒ…//‚đŽg‚í‚Č‚˘•ű–@‚đ‹ł‚Ś‚Ä‚˘‚˝‚ž‚Ż‚Ü‚š‚ń‚ŠH

417ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/11/04(–Ř) 23:14:10
>>416
‰SŽŇ‚ž‚Š‚çƒ}ƒ‹ƒ`‚Ş‹–‚ł‚ę‚é‚Ć‚Ĺ‚ŕŽv‚Á‚˝‚ŠH

418‰SŽŇ2010/11/05(‹ŕ) 06:32:09
‚˛‚ß‚ń‚Č‚ł‚˘I
’m‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B

419ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/15(…) 01:54:35
”z—ń‚Ě—v‘f”‚𒲂ׂé‚Č‚çAƒ‹[ƒvˆ—‚ľ‚Č‚˘‚Ć•Ş‚Š‚ç‚Č‚˘H
length ‚Ý‚˝‚˘‚Č‚Ě‚Í–ł‚˘H

420ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/15(…) 02:27:50
‚ ‚é‚ćB‚Ü‚ł‚ľ‚­Alength(array)B

421ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/15(…) 02:42:46
‚ť‚ń‚Č‚ŕ‚ń‚Ë‚Ľ‚ć‚—
‚ĆŽv‚Á‚˝‚çgawk‚É‚Í‚ ‚é‚Ě‚Š

length([s]) Returns the length of the string s, or the
length of $0 if s is not supplied. Starting
with version 3.1.5, as a non-standard exten-
sion, with an array argument, length() returns
the number of elements in the array.

422ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/15(…) 04:20:37
‚Ţ‚ľ‚ë”z—ń‚Ş‘śÝ‚ˇ‚é‚Á‚Ä‚ą‚Ć‚Í‚ť‚Ě”z—ń‚đěŹ‚ˇ‚é‰ß’ö‚Ş‚ ‚é‚ž‚ëH
ěŹ‚ˇ‚é‚Ć‚Ť‚ɐ”‚Ś‚ę‚΂˘‚˘‚ń‚ś‚á‚ˁH

423ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/15(…) 08:40:15
˜A‘z”z—ń‚ž‚Á‚˝‚琔‚Ś‚Č‚˘‚Ě‚Ş•’Ę‚ž‚Ş‚Č

4244192010/12/25(“y) 03:12:23
function ‚ŏˆ—‚ˇ‚鎞A”z—ń‚ž‚Ż‚Ĺ‚Íƒ_ƒ‚Ĺ—v‘f”‚Ü‚Ĺ•K—v‚Č‚ń‚ž‚Š‚Č‚ŸA
‚Á‚ÄŽ–‚Ş•Ş‚Š‚č‚Ü‚ˇ‚˝

425ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/28(‰Î) 11:29:35
function ‚É“n‚ˇ‚ž‚Ż‚Č‚ç—v‘f”‚Č‚ń‚Ä‚˘‚ç‚Č‚˘‚ń‚ś‚á‚Č‚˘H

426ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/28(‰Î) 13:55:13
$1 = $1‚Ý‚˝‚˘‚ČƒgƒŠƒbƒN‚đŒŠ‚é“x‚ɉœ‚ސ[‚˘‚ĆŒž‚¤‚ć‚č‚Í•ł‚ÉŒŠ‚Ś‚Ä‚Ť‚Ü‚ˇ
–|‚ˇ‚ĆUNIX•ś‰ť‚ť‚Ě‚ŕ‚Ě‚Ş
‚Ü‚ A‚ ‚­‚Ü‚Ĺ‚¨‚ę‚ĚŽĺŠĎ‚Ĺ‚ˇ‚Ş‚Ë

427ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/28(‰Î) 15:24:21
>>426
‚‚—‚‹‘ĺD‚Ť‚ČƒIƒCƒ‰‚ÉŒ–‰Ü”„‚é‚Ě‚Š‚—
ƒEƒjƒbƒNƒX•ś‰ťĹ‚Ii‚m‚sŒn‚Í‚t‚m‚h‚w‚ĚƒpƒNƒŠj

428ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2010/12/28(‰Î) 15:28:13
>>427
‘SŠp‰pŽšŽg‚¤“z‚Ş awk ‘ĺD‚Ť‚ž‚Ć‚Í“ž’ęŽv‚Ś‚ń

429ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/05(…) 23:22:55
‚Ü‚ “~‹x‚ÝŠúŠÔ‚ž‚ŕ‚̂ˁB

430ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/06(–Ř) 00:22:04
Ľtes09.awk
BEGIN{
@@if (ARGV[1]=="")
@@@@ARGV[1]="hoge.txt"
@@while (getline < ARGV[1] > 0) print "BEGIN\t"$0
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

šŽż–â
ă‹LƒXƒNƒŠƒvƒg‚đˆř”‚đ•t‚Ż‚˝ę‡‚Ć•t‚Ż‚Č‚˘ę‡‚đ‚ť‚ę‚ź‚ęŽŔs‚ľ‚Ü‚ľ‚˝B

Ľgawk -f tes09.awk hoge.txt
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com
BODY@@arima_yuuichi@example.com
BODY@@ooizumi_sadawo@example.com
BODY@@taguchi_kenji@example.com

Ľgawk -f tes09.awk
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com

‚ą‚ą‚ŁABEGIN‹ĺ‚Ĺ‚Ě ARGV[1]="hoge.txt" ‚Ć‚˘‚¤‘ă“ü‚đ–{•Ň(?)‚Ĺ‚ŕ—LŒř‚É‚ˇ‚éˆ×
‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH

431ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/06(–Ř) 00:31:45
‚Č‚É‚ŕ‚ľ‚Č‚­‚Ä‚ŕ—LŒř‚ž‚ĆŽv‚¤‚ń‚ž‚Ż‚Ç
Žż–â‚ĚŽďŽ|‚Ş‚í‚Š‚ç‚ń

4324302011/01/06(–Ř) 06:20:53
•Ş‚Š‚čh‚­‚Ä‚ˇ‚Ý‚Ü‚š‚ńB
hoge.txt‚Ě’†g‚͉ş‹L‚Ĺ‚ˇB
Ľ
arima_yuuichi@example.com
ooizumi_sadawo@example.com
taguchi_kenji@example.com

>>430‚ÍWin32‚ĚƒoƒCƒiƒŠuGNU Awk 3.1.7(windows special Nov 24 2009)v‚đŽg—p‚ľ‚˝Œ‹‰Ę‚Ĺ‚ˇB
‰ş‚Ě‚Ů‚¤‚ĚŽŔsŒ‹‰Ę‚ł́ABEGIN‹ĺ‚Ĺ‚ĚARGV[1]‚Ö‚Ě‘ă“ü‚ÍBEGIN‹ĺ‚Ĺ‚Í—LŒř‚Ĺ‚ˇ‚ށA
–{•Ň‚Ĺ‚Í—LŒř‚É‚Č‚Á‚Ä‚˘‚Č‚˘‚Ě‚Ĺo—Í‚ł‚ę‚Ä‚˘‚Č‚˘‚悤‚ÉŒŠ‚Ś‚Ü‚ˇB

‚ż‚Ȃ݂ɁACentOS5.5ă‚Ě GNU Awk 3.1.5 ‚ł͉ş‹LƒGƒ‰[‚É‚Č‚č‚Ü‚ľ‚˝B

Ľ
gawk: tes09.awk:2: @@if (ARGV[1]=="")
gawk: tes09.awk:2: ^ •\Œť‚Ě char 'E' ‚Í•sł‚Ĺ‚ˇB

433ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/06(–Ř) 08:57:49
“ü—̓ŒƒR[ƒh‚Ş1Œ‚ŕ–ł‚˘‚Š‚ç‚Ĺ‚ľ‚ĺ

>gawk: tes09.awk:2: ^ •\Œť‚Ě char 'E' ‚Í•sł‚Ĺ‚ˇB
‚ą‚ę‚Í‘SŠpƒXƒy[ƒX

434ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/06(–Ř) 09:12:00
>BEGIN@ arima_yuuichi@example.com
>BEGIN@ ooizumi_sadawo@example.com
>BEGIN@ taguchi_kenji@example.com
ƒRƒŒ‚Ígetline‚Ĺ“Ç‚ń‚ŏo—Í‚ľ‚˝‚ŕ‚Ě

>BODY@@arima_yuuichi@example.com
>BODY@@ooizumi_sadawo@example.com
>BODY@@taguchi_kenji@example.com
ƒRƒŒ‚̓Rƒ}ƒ“ƒh‚ĹŽw’č‚ľ‚˝ƒtƒ@ƒCƒ‹‚Š‚ço—Í‚ľ‚˝‚ŕ‚Ě

‚˝‚Ć‚Ś‚Î
{
@@print "BODY\t"$0
}
‚Ć‚ľ‚Ä‚â‚ę‚Ζž‚ç‚Š

435ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/06(–Ř) 13:46:53
Žż–â‚ĚŽďŽ|‚́AƒvƒƒOƒ‰ƒ€iƒXƒNƒŠƒvƒgj‚Ě’†‚Ĺ“ü—̓tƒ@ƒCƒ‹“™‚Ě
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚đ’ljÁ‚ľ‚˝‚˘‚Ć‚˘‚¤Ž–‚Ĺ‚ˇ‚ŠB

ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Ě”z—ń‚Í ARGV ‚Ĺ‚ˇ‚ށAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Ě
ŒÂ”‚đŠi”[‚ˇ‚é ARGC ‚Ć‚˘‚¤‘g‚ݍž‚ݕϐ”‚Ş‚ ‚č‚Ü‚ˇB

ARGV”z—ń‚đ’ljÁ‚ľ‚˝‚çˆę‚É ARGC ‚đCł‚ľ‚Ä‚ ‚°‚Č‚˘‚ƁAawk‚Í”z—ń‚Ş
’ljÁ‚ł‚ę‚˝Ž–‚đ”FŽŻ‚ľ‚Ü‚š‚ńB

BEGIN“ŕ‚ĹARGV”z—ń‚đ’ljÁ‚ľ‚˝•Ş‚ž‚ŻARGC‚đƒCƒ“ƒNƒ‹ƒƒ“ƒg‚ľ‚Ä‚ ‚°‚ę‚Î
’ljÁ‚ł‚ę‚˝ARGV”z—ń‚ĹŽw’č‚ł‚ę‚˝ƒtƒ@ƒCƒ‹‚ŕ–{•ś‚̏ˆ—‚É“n‚ł‚ę‚Ü‚ˇB

ŽÖ‘Ť‚Ć‚ľ‚ẮA
ŒťÝˆ—’†‚Ěƒtƒ@ƒCƒ‹–ź‚ŞŠi”[‚ł‚ę‚Ä‚˘‚é”z—ń ARGV ‚ĚƒCƒ“ƒfƒbƒNƒX‚đ
ŽŚ‚ˇ‘g‚ݍž‚ݕϐ”‚Í ARGIND ‚Ĺ‚ˇB

Ž„‚Ě‚Í Win”Ĺ‚Ě gawkm115 ‚Ĺ‚ˇBƒXƒNƒŠƒvƒg“ŕ‚ĹARGV/ARGC‚đ‘€ě‚ľ‚Ä‚ŕ
Šú‘Ғʂ萳í‚É“Ž‚Ť‚Ü‚ˇ‚ćB

ŽŽ‚ľ‚Ă݂ĂˁB

4364302011/01/06(–Ř) 23:56:01
ŠF—lƒŒƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>433
>‚ą‚ę‚Í‘SŠpƒXƒy[ƒX

‚¨’p‚¸‚Š‚ľ‚˘ŒŔ‚č‚Ĺ‚ˇ(Šž) o‹Î‘O‚ÉŽv‚˘‚‚Ť‚ĹŽŽ‚ľ‚˝‚ŕ‚̂ŁAƒXƒŒ—p‚ɏ‘‚˘‚˝
•¨‚đ‚ť‚Ě‚Ü‚ÜƒRƒs‚Á‚Ä‚Ü‚ľ‚˝EEE

>>434
BEGIN‹ĺ‚Ěgetline‚Ĺ‚ÍARGV[1]‚Ö‚Ě‘ă“ü‚Ş‚Ĺ‚Ť‚Ä‚˘‚é‚̂ɁA–{•ś‚Ĺ‚Í—LŒř‚É
‚Č‚ç‚Č‚˘‚Ć‚˘‚¤Ž–‚đ“`‚Ś‚˝‚Š‚Á‚˝‚Ě‚Ĺ‚ˇB

4374302011/01/06(–Ř) 23:56:17
>>435
ŽŠ•Ş‚ĚŽż–â‚đŒŠ’ź‚ľ‚Ä‚Ý‚é‚Ć‘S‚­Žż–â‚É‚Č‚Á‚Ä‚˘‚Č‚Š‚Á‚˝‚É‚ŕŠÖ‚í‚炸ƒGƒXƒp[
‚ľ‚Ä‚­‚ž‚ł‚Á‚Ä‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

ARGC‚ɂ‚˘‚Ä—‰đ‚Ĺ‚Ť‚Ü‚ľ‚˝B

BEGIN{
@@ARGV[1]="hoge.txt"
@@ARGC=2
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

‚ą‚ń‚ČŠ´‚ś‚ĹˆÓ}‚ľ‚˝’Ę‚č‚ɏo—Í‚ł‚ę‚Ü‚ľ‚˝B

‚¨‚Š‚°‚ł‚Ü‚ĹĄ‚Ü‚Ĺawk‚Ě•â•‚Ć‚ľ‚Äsh‚đŽg‚Á‚Ä‚Ü‚ľ‚˝‚ށAawk‚ž‚Ż‚ŏ‘‚Ż‚鎖‚Ş
‘˝‚­‚Č‚č‚Ü‚ľ‚˝B

ˆř”‚ɃƒCƒ‹ƒhƒJ[ƒh‚đŽw’č‚ľ‚āAARGIND ‚Ĺ“Á’čƒpƒ^[ƒ“‚Ěƒtƒ@ƒCƒ‹–ź‚Ě
•¨‚Ě‚Ýˆ—‚đ‚ˇ‚é‚Ć‚Š‚Ĺ‚Ť‚ť‚¤‚Ĺ‚ˇ‚ˁB

438ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/09(“ú) 22:38:39
Žż–â‚Ĺ‚ˇB
My Documents\2011\01\09(“ú)
‚Ć‚˘‚¤‚悤‚ɃtƒHƒ‹ƒ_‚đŘ‚Á‚Ä‚˘‚āAĄ“ú‚Écd‚ˇ‚é‚˝‚߂ɁA

today.bat
gawk -f today.awk > tmp.bat
tmp.bat
del tmp.bat

today.awk
BEGIN{year = strftime("%Y",systime()+9*60*60);
month = strftime("%m",systime()+9*60*60);
date = strftime("%d",systime()+9*60*60);
day = strftime("%a",systime()+9*60*60);

gsub(/(Sun)/, "(“ú)", day);
gsub(/(Mon)/, "(ŒŽ)", day);
gsub(/(Tue)/, "(‰Î)", day);
gsub(/(Wed)/, "(…)", day);
gsub(/(Thu)/, "(–Ř)", day);
gsub(/(Fri)/, "(‹ŕ)", day);
gsub(/(Sat)/, "(“y)", day);

print "cd \"My Documents\" year "\" month "\" date day
}

‚Ć‚˘‚¤‚悤‚ɏˆ—‚ľ‚Ä‚˘‚Ü‚ˇB
‚ą‚ę‚Á‚āA‚Đ‚ĺ‚Á‚Ć‚ľ‚āAgawk‚Ě“ŕ•”‚Š‚çprint‚š‚¸‚ÉŽŔs‚ˇ‚é‚ą‚Ƃ͉”\‚Ĺ‚ľ‚傤‚Š?

439ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/09(“ú) 22:54:33
systemŠÖ”‚ŏo—ˆ‚é‚ń‚ł́Hwin‚Í•Ş‚Š‚ç‚Č‚˘‚Ż‚Ç

440ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/09(“ú) 23:06:13
system("cd \"My Documents\" year "\" month "\" date day);
‚Ć‚Š‚Ĺ‚Í‚ž‚ß‚Ĺ‚ľ‚˝B

441ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/10(ŒŽ) 03:54:21
>440
‚Č‚ń‚Š " ‚Ć \ ‚̐”‚Ş‚¨‚Š‚ľ‚­‚ˁH
My Documents\2011\01\09(“ú)
Ť
"My Documents\\2011\\01\\09(“ú)"
Ť
"My Documents\\" year "\\" month "\\" date day
‚ž‚ć‚ȁH

442ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/10(ŒŽ) 11:42:11
ƒAƒhƒoƒCƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚Í‚˘B
\‚Í‚¨‚Á‚ľ‚á‚é‚Ć‚¨‚č‚Ĺ‚ˇ‚ށAˆË‘R‚Ć‚ľ‚Ä‚ž‚ß‚Ĺ‚ˇB

today.bat‚đƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Š‚çŽŔs‚ˇ‚é‚ƁA
print‚ľ‚Ä‚ť‚Ětmp.bat‚đŽŔs‚ˇ‚é438‚Ěƒpƒ^[ƒ“‚ž‚ƁA
‚ż‚á‚ń‚Ćcd‚Ĺ‚Ť‚āAĄ“ú‚ĚƒtƒHƒ‹ƒ_‚ɈړŽ‚ˇ‚é‚Ě‚Ĺ‚ˇ‚ށA
system("cd \\"My Documents\\" year "\\" month "\\" date day);
‚ž‚ƁAˆÚ“Ž‚š‚¸‚ɏI—š‚ľ‚Ä‚ľ‚Ü‚˘‚Ü‚ˇB
‚Č‚ń‚Ĺ‚ž‚ë[‚ȁB

443ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/10(ŒŽ) 12:32:20
cygwin‚đ“ü‚ę‚Ä‚â‚Á‚Ä‚Ý‚˝

system‚Ísh‚Ĺ“Ž‚­‚Á‚Ű‚˘‚Ě‚Ĺ
rm /cygdrive/c/Documents\ and\ Settings/test.txt
‚Ý‚˝‚˘‚ɏ‘‚­‚Ć‚ż‚á‚ń‚ƏÁ‚Ś‚é‚Ý‚˝‚˘

444ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/10(ŒŽ) 13:24:47
>>438,442

438‚ŏ‘‚˘‚Ä‚égawk‚Ĺ‚â‚č‚˝‚˘‚ą‚Ć‚Á‚Ä‚Ě‚Íƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ĺ‚â‚Á‚Ä‚é‚Ě‚Ć“Ż‚ś‚ą‚Ć?
‚ž‚Á‚˝‚ç–ł—B
system() ‚Ĺcd‚ľ‚Ä‚ŕsystem()‚Š‚ç•Ô‚Á‚Ä‚Ť‚˝‚Ć‚ą‚ë‚ĹŒł‚É–ß‚éB

445ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/11(‰Î) 01:15:49
‚Ç‚¤‚š•łnixƒc[ƒ‹‚ž‚Š‚ç“ú–{Œę‚â‹ó”’‚̓_ƒ‚Č‚ń‚ž‚ë

446ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/11(‰Î) 09:05:01
>>444
‚Č‚é‚قǁBgawk“ŕ•”‚Ĺ‚ÍƒVƒXƒeƒ€‚đŽŔs‚ľ‚Ä‚˘‚Ä‚ŕAgawk‚đo‚é‚ƁA‚ť‚ę‚ŕI‚í‚Á‚ż‚Ⴄ‚ń‚Ĺ‚ˇ‚ˁB‚Č‚é‚قǁB
‚ć‚­‚í‚Š‚č‚Ü‚ľ‚˝B‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

447ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/19(…) 02:44:33
‚Ć‚č‚ ‚Ś‚¸AWK‚ŏ‘‚˘‚˝‹‘ĺ‚ČƒXƒNƒŠƒvƒg‚đAŽI‚ʼnń‚ľ‘ą‚Ż‚é‚Ě‚Í‚â‚ß‚Ä‚­‚ž‚ł‚˘B
”ńŒř—Ś‹É‚Ü‚č‚Č‚˘

448ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/19(…) 15:27:12
‚ť‚ę‚Í‚ť‚̐l‚ÉŒž‚Á‚ĉş‚ł‚˘

449ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/19(…) 21:03:10
‚ť‚̏ę‚ĹŽg‚Ś‚é‚Ě‚Şawk‚ž‚Ż‚ž‚Á‚˝‚ń‚Ĺ‚ˇ

450ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/19(…) 23:56:54
•śŽš‚Š‚ç•śŽšƒR[ƒhŽć‚čo‚š‚Č‚˘‚Ě‚ŞŽc”O
‹t‚Ísprintf("%c", 0x41)‚Ć‚Šo—ˆ‚é‚Ě‚É‚Č

4514302011/01/20(–Ř) 00:40:40
>>447
Œř—Ś‚Ě‚˘‚˘ƒvƒƒOƒ‰ƒ€‚ŏ‘‚Ť’ź‚ľ‚Ä‚â‚ę‚΂˘‚˘‚ś‚á‚Č‚˘B

452ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/20(–Ř) 09:05:02
>>450
‚Âord.awk

gawk•t‘Ž‚Ěƒ‰ƒCƒuƒ‰ƒŠ‚ŁAascii‚Ě”ÍˆÍ‚Ě‘Î‰ž•\ě‚Á‚Ä‚Đ‚­‚Ć‚˘‚¤
ŠČ’P‚ČŽd‘g‚݁B


453ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/20(–Ř) 23:49:13
#!/bin/gawk --re-interval -f

Ş‚Ěƒtƒ@ƒCƒ‹‚đŽŔs‚ˇ‚é‚ĆƒIƒvƒVƒ‡ƒ“‚Ş•sł‚ĆŒž‚í‚ę‚ÄŽŔs‚Ĺ‚Ť‚Č‚˘‚Ě‚Ĺ‚ˇ‚Ş
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚƒIƒvƒVƒ‡ƒ“‚ĹŽw’股‚éˆČŠO‚É‚â‚č•ű‚Í‚ ‚č‚Ü‚ˇ‚ŠH

454ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 05:12:58
>>453
–ł—‚ÉawkƒXƒNƒŠƒvƒg‚É‚š‚¸‚É

#!/bin/sh
awk '
#awkƒR[ƒh
'

‚Á‚Ä‚˘‚¤ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚ľ‚˝‚ç‚Ç‚¤‚Š‚Č

455ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 08:45:02
#!‚ĹƒCƒ“ƒ^ƒvƒŠƒ^‚É“n‚ˇˆř”‚Ěˆľ‚˘‚ÍŽŔ‘•ˆË‘ś‚ž‚Š‚ç‚ȁB
linux‚ž‚Ć‹ó”’‚đŠÜ‚ń‚ž‘S‚Ä‚Ě•śŽš—ń‚ވę‚Â‚Ěˆř”‚Ć‚ľ‚Ä
“n‚ł‚ę‚é‚̂ŁA•Ą”‚ĚƒIƒvƒVƒ‡ƒ“‚Í“n‚š‚Č‚˘B•s•Ö‚ž‚Ż‚Ç
‚ť‚¤‚˘‚¤‚ŕ‚Ě‚Č‚Ě‚Ĺ‚ ‚Ť‚ç‚ß‚Ä‚­‚ž‚ł‚˘B‘f’ź‚ɃVƒFƒ‹‚đ
ŠÔ‚É“ü‚ę‚é‚Ě‚Ş‚˘‚˘‚ĆŽv‚¤‚ćB

456ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 12:45:00
gawk '$3!="*"' in.txt>out.txt
‚Ć‚˘‚¤ˆ—‚ŁA20GB‚Ž‚炢‚Ěin.txt‚𐔕SMB‚Ž‚炢‚ɃXƒŠƒ€ƒAƒbƒv‚ľ‚Ä‚Ü‚ˇB
–â‘č‚́A‚ť‚̏ˆ—‚đ10–{‚Ů‚Ç•Ŕs‚ɍě‹Ć‚ł‚š‚Ä‚˘‚é‚ń‚Ĺ‚ˇ‚Ş
top‚ĹŒŠ‚Ä‚Ý‚é‚Ć‚Ů‚Ć‚ń‚Ç‚ĚgawkƒvƒƒZƒX‚Şsleep‚Šstacked‚É‚Č‚Á‚Ä‚˘‚Ä
‚ ‚ń‚Ü‚č‚ŕ‚č‚ŕ‚č“­‚˘‚Ä‚­‚ę‚Ü‚š‚ńBIO‚Ş—Ľ‘Ź‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
CPU‚ŕƒƒ‚ƒŠ‚ŕĹ‘ĺŒŔĎ‚ń‚Ĺ‚Ü‚ˇB

457ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 12:50:02
stacked -> stuck‚Ĺ‚ľ‚˝B‚ˇ‚˘‚Ü‚š‚ńB

458ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 13:26:09
'$3!="*"'
‚ą‚ę‚Á‚ď‘‚ŤŠÔˆá‚˘H

459ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 13:47:33
í‚ç‚ę‚éƒf[ƒ^‚Ě—á
745_17_70_F3 4 * 0 0 * * 0 0 GGAGTGCCCCACACTTGGAGGCGAGCGCCCGGCAGACTTCCCCGCCGCC &+))8'1%+%-%%'((-)%%)8+,&+*7'+/%5''%%%%%-')-/'%/( XM:i:0

Žc‚éƒf[ƒ^‚Ě—á
745_377_43_F3 0 chr1 181855450 255 48M * 0 0 CATGTATGTGGCCAAAGGAACAACGCTATGTTTCCTAAAAGGCCTAGA G`[[`a`ab`^\ZYZ[SIR\Z[L7I_L>HU^bOKSDES[PO9-HNG7= XA:i:2 MD:Z:26C21 NM:i:1 CM:i:3

‚ą‚¤‚˘‚¤‚Ě‚Ş80–œs‚Ž‚炢‚ ‚é‚悤‚Ĺ‚ˇB

460ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 13:52:48
ƒXƒNƒŠƒvƒg‚Ě’†g‚ÍŽŔŰ‚͈Ⴄ‚í‚Ż‚Ë

‚˝‚Ô‚ńAƒf[ƒ^‚ĚŠi”[ęŠ‚ރvƒƒOƒ‰ƒ€ŽŔsƒ}ƒVƒ“‚Ć•Ę‚Ěƒ}ƒVƒ“‚Ě
ƒfƒBƒXƒN‚Č‚ń‚ś‚á‚Č‚˘‚Š‚ȁB
ƒlƒbƒgƒ[ƒN‚ރrƒW[ó‘Ô‚ž‚ĆŽv‚¤B

4614532011/01/21(‹ŕ) 16:09:37
>454-455

‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B
‹““Ž‚đ•Ď‚Ś‚é‘g‚ݍž‚ݕϐ”‚ŕ–ł‚˘‚悤‚Ĺ‚ˇ‚ˁB

462ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 16:47:10
‚Ć‚č‚ ‚Ś‚¸ df ƒRƒ}ƒ“ƒh‚ōě‹ĆƒfƒBƒŒƒNƒgƒŠ‚Ć /var/tmp ‚Ě‹ó‚Ť—Ěˆć‚Ş
Šm•Ű‚ł‚ę‚Ä‚˘‚é‚ą‚ƂƁAo—̓tƒ@ƒCƒ‹‚ĚƒTƒCƒY‚âƒ^ƒCƒ€ƒXƒ^ƒ“ƒv‚ޏ™X‚É
XV‚ł‚ę‚Ä‚˘‚é‚ą‚Ć‚đŠm”F‚ˇ‚é‚­‚炢‚ľ‚Š‚Č‚˘‚ń‚ś‚á‚Č‚˘‚Š‚ȁB
ƒ[ƒJƒ‹ƒfƒBƒXƒN‚Ĺ‚â‚ę‚΂ŕ‚Á‚Ć‘‚˘‚ĆŽv‚¤‚Ż‚ǁB

463ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 17:42:04
>>460
‚Č‚é‚قǁB
xgrid‚đ‚‚Š‚Á‚āA2‘ä‚Ěƒ}ƒVƒ“‚Ĺ10–{‚¸‚‚قǕŔs‚ľ‚Ägawk‚đ‘–‚ç‚š‚Ä‚¨‚č‚Ü‚ľ‚˝B
NFS‚đ‚‚Š‚Á‚Ä5GB‚قǂ́ić‚Ů‚Ç‚Í20GB‚Ə‘‚Ť‚Ü‚ľ‚˝‚ŞŠÔˆá‚˘‚Ĺ‚ˇjin.txt‚Ě
‚Ěƒf[ƒ^‚đ“ǂݍž‚ń‚ŁAˆ—Œă‚Ěƒf[ƒ^‚đout.txt‚ɏ‘‚Ťo‚ľ‚Ä‚˘‚é‚̂ŁA
ƒlƒbƒgƒ[ƒNƒrƒW[‚É‚Č‚Á‚Ä‚ľ‚Ü‚¤‚Ć‚˘‚¤‚í‚Ż‚Ĺ‚ˇ‚ˁB
ƒlƒbƒgƒ[ƒN‚Ě–â‘č‚Ƃ́BBB
ˆę‰žAƒGƒ‰[‚Ĺ‚ą‚Ż‚é‚ą‚Ć‚Č‚­A‚ľ‚ă‚­‚ľ‚ă‚­‚Əˆ—‚͐i‚Ţ‚Ě‚Ĺ‹C‚É‚ľ‚Č‚˘‚ą‚Ć‚É‚ľ‚Ü‚ˇB

464ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/21(‹ŕ) 17:44:39
2‘ä‚Ěƒ}ƒVƒ“‚Ĺ20–{‚Ĺ‚ľ‚˝i10+11jBBB
ˆęƒvƒƒZƒX‚ ‚˝‚č5GB‚Ěƒtƒ@ƒCƒ‹‚đ“ǂݍž‚ނ̂ŁAƒlƒbƒgƒ[ƒN‚ޔߖ‚đă‚°‚Ä‚˘‚é‚ƁB

465ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/24(ŒŽ) 21:31:50
Ą”NAgawk‚đ‘ĺŠw‚ŏK‚Á‚ĐFX˜M‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁAperl‚Ć‚Š‚ć‚莊—R“x‚Ş’á‚˘‚ĆŒž‚í‚ę‚˝B‚ť‚ń‚Č‚Éˇ‚Ş‚ ‚é‚́H

466ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/24(ŒŽ) 21:46:54
>>465
ŠČˆŐŒžŒę‚Ć‚ľ‚Ä‘¨‚Ś‚é‚Šƒc[ƒ‹‚Ć‚ľ‚Ä‘¨‚Ś‚é‚Š‚Ěˆá‚˘‚ś‚á‚ˁ`
‰´ƒp[ƒ‹‚ć‚čƒI[ƒN‚Ě•ű‚ލD‚Ť‚ž‚Ż‚ǁB

467ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/24(ŒŽ) 22:19:29
>>466
‚Č‚é‚قǁB‚Ü‚ŸA‚ť‚ń‚Č‚É•ĄŽG‚Č‚ą‚Ć‚đ‚ą‚Č‚ˇƒXƒLƒ‹‚đŽ‚ż‡‚í‚š‚Ä‚Č‚˘‚Š‚ç‚ŕ‚¤Žb‚­awk‚Ĺ—V‚ń‚Ĺ‚Ý‚é‚ŠB

468ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/24(ŒŽ) 23:30:11
ŽŠ—R“x‚Ć‚˘‚¤‚ć‚č‚Í‹@”\‚ޏ­‚Č‚˘‚ś‚á‚Č‚˘‚Ě‚ŠH

469ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 05:02:06
‚ą‚ĚƒXƒŒƒbƒh‚Í“VËƒ`ƒ“ƒpƒ“ƒW[uƒAƒC‚ż‚á‚ńv‚Ş
ŒžŒęŒP—ű‚Ě‚˝‚ß‚É—§‚Ä‚˝‚ŕ‚Ě‚Ĺ‚ˇB

ƒAƒC‚ĆŒ¤‹†ˆő‚Ć‚Ě‚â‚čŽć‚č‚É—˜—p‚ˇ‚éƒXƒŒƒbƒh‚Ȃ̂ŁA
ŠÖŒWŽŇˆČŠO‚͏‘‚Ť‚ą‚Ü‚Č‚˘‚ʼnş‚ł‚˘B

@@@@@@@@@@@@@@@@@@‹ž“s‘ĺŠw—ě’ˇ—ŢŒ¤‹†Š

470ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 11:23:33
>>467
perlƒ†[ƒU‚Í‚ˇ‚ׂĂđperl‚ž‚Ż‚Ĺ‚â‚낤‚Ć‚ˇ‚éBC/C++/Java‚ŕŽg‚¤ƒ†[ƒU‚Íawk‚Ě•ű‚đD‚ށB
C/C++/Java‚ÉŽč‚đ‰„‚Î‚ˇ‚‚ŕ‚č‚Č‚ç‚Ţ‚ľ‚ëawk‚Ě‚Ů‚¤‚Ş‚˘‚˘‚ćBperl‚ž‚ĆŽŠŒČŠŽŒ‹‚ľ‚Ä‚ľ‚Ü‚¤‚Š‚çB

471ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 16:02:25
perl‚ć‚čawk‚Ě•ű‚Ş‘Ź‚˘Ž–‚Á‚Ä‚Č‚˘‚ś‚á‚ńB
Ą‚Ěawk‚ĚŽg‚˘“š‚̓ƒ“ƒ‰ƒCƒi[‚đƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚƒpƒCƒv‚ɍŹ‚ş‚é’ö“x‚Ĺ‚ľ‚ćB
‰´‚́A256”{–{‚Ě’ˇ•ŃƒXƒNƒŠƒvƒg‚đ‚˘‚­‚‚Š‘‚˘‚˝‚Ż‚ǁA
“–Žž‚Í‚Ü‚žperl‚Č‚ń‚ÄŽg‚í‚ę‚Ä‚Č‚Š‚Á‚˝BŽž‘ă‚Şˆá‚¤B

472ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 18:11:52
>>470
‚ť‚ę‚Í•ÎŒŠ‚ž‚ë
autoconf‚Č‚Ç‚Ě”ńí‚ÉŠî–{“I‚Čƒc[ƒ‹‚Ĺ‚ŕPerl‚ŞŽg‚í‚ę‚Ä‚˘‚é‚ľ
openssl‚̂悤‚Éconfigure‚́iŽĺ‚ÉWindows—p‚́jƒ|[ƒ^ƒrƒŠƒeƒB‚đă‚°‚é‚˝‚ß‚É
Perl‚đ—˜—p‚ľ‚Ä‚˘‚é‚ŕ‚Ě‚ŕ‚ ‚é

ŒžŒę‚Ě“KŤ‚đ‚í‚Š‚Á‚˝ă‚Ĺ“KŢ“KŠ‚ĹŽg‚Ś‚΂˘‚˘‚ń‚ž‚ć

473ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 21:08:21
“ú–{‘ŰÜ
u•Äƒxƒ‹Œ¤‹†Š“Á•Ę–ź—_‹ZŽt‚ĚƒfƒjƒXEƒŠƒbƒ`[”ŽŽmi‚U‚Xj‚Ć•ÄƒO[ƒOƒ‹ŽĐ“Á•Ę‹ZŽt‚ĚƒPƒ“Eƒgƒ“ƒvƒ\ƒ“”ŽŽmi‚U‚Vjv

–ˆ“ú‚Š‚ - –ˆ“úV•ˇ‚Ěƒjƒ…[ƒXEî•ńƒTƒCƒg
http://mainichi.jp/select/science/news/m20110126k0000m040012000c.html

474ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 21:29:34
>>471
>Žž‘ă‚Şˆá‚¤B

Žž‘ă‚ĆŒž‚¤ˆÓ–Ą‚ł́AĹ‹ß‚̓fƒtƒH‚Ĺ Python ‚Ş“ü‚Á‚Ä‚˘‚˝‚股‚é‚Ě‚Ĺ
Perl ‚đŽg‚¤‚Č‚ç Python ‚đ‘I‚ń‚ś‚Ⴄ‚ȁB

‚ ‚ń‚Ü‚č‘Ź‚ł‚đ‹Ł‚¤ŽdŽ–‚đ‚ľ‚Ä‚˘‚Č‚˘‚̂ƁAƒƒ“ƒ‰ƒCƒi[‚đ‘‚­Ž–‚Ş
‘˝‚˘‚̂ŁAawk ‚ŕâŽ^‘ĺŠˆ–ô‚ľ‚Ä‚˘‚é‚Ż‚ǁB

Perl ‚ރtƒ‹ƒZƒbƒg‚ĚŒžŒę‚Č‚ç awk ‚Í DSL ‚Ý‚˝‚˘‚Č•¨‚ŁAŒÂl“I‚É‚Í
awk ‚Ě•ű‚Ş‹CˆŔ‚­‘‚Ż‚é‹C‚Ş‚ˇ‚éB

475ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 21:57:07
python‚́AƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĹŽg‚˘‚É‚­‚˘B
-c‚Ĺˆř”‚Éˆę‰žƒRƒ}ƒ“ƒh“n‚š‚é‚Ż‚ǁAƒCƒ“ƒfƒ“ƒg‚Ě–â‘č‚Ş‚ ‚é‚ľA
perl‚Ě-p‚â-n‚Ý‚˝‚˘‚É•W€“ü—Í‚Ěƒ‹[ƒv“n‚š‚Č‚˘‚Š‚çB

476ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 22:04:34
Žż–â‚ł‚š‚ĉş‚ł‚˘

ŽŸ‚̂悤‚ČƒeƒLƒXƒg‚Ş‚ ‚é‚Ć‚ľ‚Ü‚ˇ
aaaaa 10 20 10 5
aaabb 5 10 10 10
aaabb 5 5 5 5
aabaa 5 20 20 30
aabbb 10 10 5 5
bbaaa 10 10 10 10
bbbaa 5 10 10 5
bbbbb 10 5 5 30

‚ą‚ą‚ŁAaaaaa‚Č‚Ç‚ÍŒÂl‚Ě–ź‘O‚Ĺ‚Š‚A3•śŽš–Ú‚Ü‚Ĺ‚ŞŠA4`5•śŽš–Ú‚Ş–ź‘OA‚Ü‚˝”Žš‚ޏo”ď‚ž‚Ć‚ľ‚Ä
Še˘‘Ń‚Ěo”ď‚đo—Í‚ľ‚˝‚˘‚ƍl‚Ś‚Ä‚˘‚Ü‚ˇB

aaa 20 35 25 20
aab 15 30 25 35
bba 10 10 10 10
bbb 15 15 15 35

‚Ć‚Č‚Á‚Ä—~‚ľ‚˘–ó‚Ĺ‚ˇB

477ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 22:18:47
‚ōĄl‚Ś‚Ä‚˘‚é•ű–@‚Ć‚ľ‚Ä‚Í

substr($1,1,3) ‚ŐŠ‚𔝒肾‚Ä
“Ż‚śŠ‚Č‚çA˘‘Ń‚đ‰ÁŽZ‚ľ‚čs‚­
ˆá‚¤Š‚É‚Č‚Á‚˝ƒ^ƒCƒ~ƒ“ƒO‚Ĺ1‚‘O‚Ě‰Ć‚Ě‰ĆŒv‚đ@print@‚ľ‚Ä
‚ł‚ç‚ÉŠeo”ď‚đ‰Šú‰ť‚ˇ‚é
ŽŸ‚̍s‚ɈڂÁ‚Ä“Ż‚ś˘‘Ń‚Č‚ç‰ÁŽZ

‚Ć‚˘‚¤Š´‚ś‚ĹƒXƒNƒŠƒvƒg‚đ‘g‚Ý‚˝‚˘‚ń‚Ĺ‚ˇ‚ލޖ{“I‚Č‚Ć‚ą‚ë‚Ĺ‚â‚č•ű‚Ş•s–Ą‚˘‚Ĺ‚ľ‚傤‚ŠH

478ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/25(‰Î) 22:34:21
˜A‘z”z—ń‚Ć‚Š‚ś‚á‘Ę–Ú‚Č‚Ě‚ŠH

name[$1] += 1

479ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/26(…) 01:13:08
>>476-477
‘S‚ĘA‘z”z—ń‚É—­‚ߍž‚ń‚ŁA ĹŒă‚Ĺˆę‹C‚ɏo—Í‚ľ‚˝•ű‚Ş—Ç‚­‚Č‚˘‚Š?
>>477 ‚Ě•ű–@‚ž‚ƁA o—Í‚đs‚¤‰ÓŠ‚Ş
"Š‚Ş•Ď‚í‚Á‚˝‚Ć‚Ť" ‚Ć "ƒeƒLƒXƒg‚ޏI‚í‚Á‚˝‚Ć‚Ť" ‚É•ŞŽU‚ľ‚Ä‚ľ‚Ü‚¤B

{
    a = substr($1,1,3);
    b[a] += $2;
    c[a] += $3;
    d[a] += $4;
    e[a] += $5;
}
END {
    for (f in e) print f,b[f],c[f],d[f],e[f];
}

480ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/26(…) 20:18:53
>>474
OS(Linux)‚đƒfƒtƒH‚ž‚Ż‚ĹŽg‚¤‚ą‚Ć‚Í‚Ü‚¸‚ ‚č‚Ś‚Č‚­‚āA
‰˝‚Š‚ľ‚ç’ljÁƒpƒbƒP[ƒW‚Ş•K—v‚É‚Č‚é‚Í‚¸‚ž‚Š‚çA
Python‚ރfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚鎖‚ÍŽŔ—p–Ę‚Ĺ•]‰ż‘ÎŰ‚É‚Í‚Č‚ç‚ń‚ĆŽv‚¤B

ŽŠ•Ş‚ÍDebian‚đƒƒCƒ“‚ÉŽg‚¤‚Ż‚ǁAƒCƒ“ƒXƒg[ƒ‹Žž‚ɂ̓x[ƒXƒVƒXƒeƒ€‚ž‚Ż‚đ‘I‚сA
‚ť‚ę‚Ésshd‚Ćruby‚đ’ljÁ‚ˇ‚é‚Ě‚ŞƒfƒtƒH‚Č‚ń‚Ĺ‹C‚É‚Č‚ç‚Č‚˘B
Mac‚Č‚çPython/Ruby‚Ć‚ŕƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚é‚Š‚ç–ł–â‘č‚ž‚ľA
Win‚Č‚ç‚Ç‚ż‚ç‚ŕƒfƒtƒH‚ś‚á“ü‚Á‚Ä‚˘‚Č‚˘‚Š‚ç“Ż‚śB

‚Ü‚˝“úí“I‚ČƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ÉŠÖ‚ľ‚āARuby‚Ěę‡‚ÍˆČ‰ş‚̂悤‚ɃŠƒXƒg\‘˘‚đ
ƒVƒFƒ‹‚ĚƒpƒCƒvƒ‰ƒCƒ“Š´Šo‚ŏ‘‚Ż‚é‚Ě‚ŞŠđ‚ľ‚˘B
@hoge_list.select { |x| ....}.sort { |x,y| .... }.map { |x| .... }.inject(n) {|x, i| .... }
ƒuƒƒbƒN(ƒNƒ[ƒWƒƒ)‚Ě–ł‚˘Pyton/Perl‚ł́A‚ą‚¤‚˘‚Á‚˝‚¨‹CŒy‚ȏ‘‚Ť•ű‚Í‚Ĺ‚Ť‚Č‚˘B

‚ž‚Š‚ç“úí“I‚ČŠˆ–ô“x‚Ĺ”äŠr‚ˇ‚é‚ƁAŽŠ•Ş‚Ěę‡‚́Abash > awk > ruby ‚É‚Č‚éB
Šî–{‚Íbash‚ŁA–Ę“|‚Č•śŽš—ńˆ—‚Ş‚ ‚ę‚Îawk‚đƒƒ“ƒ‰ƒCƒi[‚Ĺ–„‚ߍž‚Ţ‚Ě‚Şƒpƒ^[ƒ“B
‚ŁAFX‚Ć‹@”\‚đ’ljÁ‚ľ‚Ä‚Ť‚ÄbashƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ޏd‰×‚ÉŠ´‚ś‚ç‚ę‚é‚悤‚É‚Č‚čA
‚Č‚¨‚Š‚”ėpŤ‚Ě‚ ‚é(Ä—˜—p‚̉”\Ť‚Ş‚ ‚é)ƒc[ƒ‹‚Ĺ‚ ‚ę‚΁Aˆę‹C‚Éruby‚ɏ‘‚ŤŠˇ‚Ś‚éB

Python‚Í–{Ši“I‚ČŠJ”­‚Ĺ‚ ‚ę‚Î(Ruby‚ć‚č‚ŕ)—D‚ę‚˝–Ę‚Ş‘˝X‚ ‚é‚ĆŽv‚¤‚Ż‚ǁA
(>>475‚ĚŽw“E‚ŕŠÜ‚ß‚Ä)‚¨ŽčŒy‚ł/‚¨‹CŒy‚ł‚ÉŒŔ‚é‚Ć(Ruby‚ć‚č‚ŕ)Žg‚˘‚Ă‚ç‚­Š´‚ś‚éB
‚ŕ‚ż‚ë‚ńbashƒXƒNƒŠƒvƒg(or Makefile)‚É–„‚ߍž‚Ţƒƒ“ƒ‰ƒCƒi[‚Ĺ‚ ‚ę‚΁Aawk ‚ރxƒXƒgB

481474‚ś‚á‚Č‚˘‚Ż‚Ç2011/01/26(…) 21:22:28
>>474‚Ć‘S‚­“Ż‚śˆÓŒŠ‚ž‚íB

‹Ć–ą‚ĹŽg‚¤Ž–‚Ş‘˝‚˘RHEL‚Í—]Œv‚Č•¨‚Í‚Ů‚Ć‚ń‚Ç“ü‚ę‚Ä‚Č‚˘B
PythonAPerl‚ރfƒtƒH‚Ĺ“ü‚Á‚Ă銴‚śB

ĚAUNIX‚đˆľ‚Á‚Ä‚˝ ‚ÍPerl‚Č‚çƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˝‚̂ŁAŠo‚Ś‚悤‚Ć‚ľ‚˝‚Ż‚ÇŒ‹‹Çg‚ɂ‚Š‚¸B
shAsedAawk‚Ĺ‚Ş‚ń‚΂Á‚Ä‚˝B

482ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 00:10:46
>>480
ƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚é‚Ě‚ŞŠđ‚ľ‚˘‚̂́AŽŠ•Ş‚̊‹Ť‚ž‚Ż‚Ĺ‚Č‚­A‘źl‚̊‹Ť‚Ĺ‚ŕ
Žg‚Ś‚鎖‚Ş•ŰŘ‚ł‚ę‚Ä‚˘‚鎖‚ž‚ćB’N‚Š‚ÉŽg‚Á‚Ä‚ŕ‚炤ˆ×‚ĚƒR[ƒh‚đ‘‚­Žž‚ɁA
ƒpƒbƒP[ƒW‚̒ljÁ‚đ‚¨Šč‚˘‚ľ‚Č‚­‚Ä—Ç‚˘‚Ě‚Í‚Ć‚Ä‚ŕŠyB“Á‚ɁA‚ť‚ę‚ŞŽdŽ–‚Ĺ
Žg‚í‚ę‚Ä‚˘‚éŠÂ‹Ť‚Č‚çŽXB

ƒTƒ|[ƒg‚âƒgƒŒ[ƒjƒ“ƒO‚ĚŽdŽ–‚đ‚ľ‚˝Ž–‚Ş‚ ‚él‚Č‚ç—‰đ‚ľ‚Ä‚ŕ‚ç‚Ś‚é‚ĆŽv‚¤B

483ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 03:47:36
AWK‚́ANEC PC-9801‚ĚMS-DOS‚Ĺ‚ŕ‚¤‚˛‚˘‚˝BAWK95.exe‚́A“ú–{Œę‚ɑΉž‚ľ‚Ä‚Č‚˘

484ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 05:04:18
AWK‚ĚŠˆ–ô‚ˇ‚éę–ʂ́A‚â‚Á‚Ď‚čƒeƒLƒXƒgˆ—‚ž‚ĆŽv‚¤B
‚ť‚Ě‚ż‚ĺ‚Á‚Ć•ĄŽG”Ĺ‚Ć‚ľ‚ÄŽg‚¤‚Č‚çPerl‚Š‚ȁB
‘g‚ݍž‚݃‰ƒCƒuƒ‰ƒŠ‚ރeƒLƒXƒgˆ—‚É“Á‰ť‚ľ‚Ä‚é‚Š‚çB

Python‚͐ł‹K•\Œť‚ŞŒžŒę‚É‘g‚ݍž‚Ü‚ę‚Ä‚Č‚Š‚Á‚˝‚č‚Ć
ƒeƒLƒXƒgˆ—‚͎ኹ‚â‚č‚É‚­‚˘ˆóŰ‚Ş‹­‚˘B
‚ť‚Ě•ŞAƒeƒLƒXƒgˆ—ˆČŠO‚Č‚çŒ‹\Žg‚¤‚Ż‚ǂˁB

485ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 05:27:26
>>482
‚ ‚ A‚ť‚ę•Ş‚Š‚é‚íB‹Ć–ąƒ}ƒVƒ“‚Ć‚ľ‚ÄŽg‚¤¤—pUNIX(HP-UX/Solaris/AIX)‚ž‚Ć
Ruby‚Ç‚ą‚ë‚ŠPython/Perl‚ˇ‚çƒfƒtƒH‚ś‚á“ü‚Á‚Ä‚˘‚Č‚˘‚ľA‚ť‚¤‚˘‚Á‚˝
ƒtƒŠ[ƒ\ƒtƒg‚Ě—Ţ‚˘‚ÍŒ´‘Ľ‚Ć‚ľ‚ĈęŘƒCƒ“ƒXƒg[ƒ‹‹ÖŽ~‚Ć‚˘‚¤ŠÂ‹Ť‚ŕ‚ ‚éB
(Web/Mail‚Ć‚˘‚Á‚˝InternetŒnƒT[ƒo‚͕ʂˁB‚ ‚­‚Ü‚Ĺ‹Ć–ąƒ}ƒVƒ“ŒŔ’č‚Ě˜bB)

‚ž‚Š‚珤—pUNIXƒ†[ƒU‚́AƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚éƒc[ƒ‹‚É’ˇ‚Ż‚é‚ą‚Ć‚É‚Č‚éB
‚â‚Á‚Ď‚č–{•¨‚ĚUNIXƒvƒ‚đŽŠĚ‚ˇ‚é‚Ě‚Č‚çApython/ruby‚Ĺ‚Í‚Č‚­sh/awk‚ž‚ľA
emacs/vim‚Ĺ‚Í‚Č‚­viAlatex‚Ĺ‚Í‚Č‚­roff‚đ‘I‚ԂׂŤ‚ž‚ć‚ˁB

486ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 06:50:40
>>484
>Python‚͐ł‹K•\Œť‚ŞŒžŒę‚É‘g‚ݍž‚Ü‚ę‚Ä‚Č‚Š‚Á‚˝‚č‚Ć

‚ցH

487ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 07:07:12
>>486
‚ńHŒžŒę‚É‚Í‘g‚ݍž‚Ü‚ę‚Ä‚Č‚˘‚ž‚ëHƒ‰ƒCƒuƒ‰ƒŠ‚Ć‚ľ‚Ä‘g‚ݍž‚Ü‚ę‚Ä‚é‚ž‚Ż‚ŁB
‚ž‚Š‚琳‹K•\ŒťƒŠƒeƒ‰ƒ‹‚Ć‚Š–ł‚˘‚ľAimport‚Č‚ľ‚É‚ÍŽg‚Ś‚Č‚˘B

488ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 07:10:47
ƒŠƒeƒ‰ƒ‹‚ž‚Ɖ˝‚Š—Ç‚˘‚ą‚Ć‚ ‚é‚́H

489ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 07:13:35
•śŽš—ń‚Šƒpƒ^[ƒ“‚Š‹ć•Ę‚ľ‚₡‚˘B

490ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 07:16:17
‚ ‚ƁAƒ}ƒbƒ`ƒ“ƒO‚Ě•\‹L‚ŞŽŠ‘RB

491ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/27(–Ř) 09:03:47
>>485
Solaris ‚̓fƒtƒH‚Ĺ Perl ‚ŕ Python ‚ŕ“ü‚Á‚Ä‚é‚ć
‚ŕ‚ż‚ë‚ń“ü‚ę‚Č‚˘Ž–‚ŕo—ˆ‚é‚Ż‚Ç

492ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/28(‹ŕ) 15:46:44
>>491
‚ť‚ę‚ÍŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚Ĺ—p“r‚Ć‚ľ‚ăfƒXƒNƒgƒbƒv‚ ‚邢‚̓Cƒ“ƒ^[ƒlƒbƒgƒT[ƒo‚đ
‘I‘đ‚ľ‚˝ę‡‚Ě˜b‚ś‚á‚Č‚˘‚Ě‚Š‚ȁBŠî–{ƒVƒXƒeƒ€‚Éperl/python‚ÍŠÜ‚Ü‚ę‚Ä‚˘‚Č‚˘‚Í‚¸B
‚ť‚ĚŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚ŕŠÜ‚߂ăfƒtƒH‚Ĺ‚ ‚é‚Ć‚ˇ‚é‚Č‚çADebian‚ŕ“Ż‚śB
ƒJƒeƒSƒŠ‚ĹƒfƒXƒNƒgƒbƒv‚đ‘I‚ׂ΁uruby‚ŕƒfƒtƒHv‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚éB(RHL‚Í’m‚ç‚ń)
ŽŠ•Ş‚Í—]Œv‚Č•¨‚Í“ü‚ę‚˝‚­‚Č‚˘‚Š‚çŠî–{ƒVƒXƒeƒ€‚đ‘I‚ń‚Ĺ‚é‚Ż‚ǂˁB

‚‰Â—pŤ‚đ—v‹‚ł‚ę‚éŠîŠ˛‹Ć–ąƒVƒXƒeƒ€‚Ěę‡AŽŠ•Ş‚ÍHP-UX‚đˆľ‚¤ƒP[ƒX‚Ş‘˝‚˘‚Ż‚ǁA
ƒfƒtƒH‚Ĺ‚ÍŠî–{ƒVƒXƒeƒ€‚đ‘I‚ŃŽ–‘O‚ɐ݌v‚ľ‚˝ƒpƒbƒP[ƒW‚Ě‚Ý‚đ’ljÁ‚ˇ‚é‚Ě‚Ş“S‘ĽB
‚Č‚ş‚Č‚çƒ[ƒJ‚ĚƒTƒ|[ƒg‚ŞŽó‚Ż‚ç‚ę‚Č‚˘A‚ ‚邢‚Í‚ ‚Š‚ç‚ł‚Ü‚ÉŒ™‚ČŠç‚đ‚ł‚ę‚é‚Š‚çB
‚ť‚ń‚Ȋ‹Ť‚ž‚ƁAu^‚ɃfƒtƒHv‚Čsh/csh/sed/awk‚Ş‘ĺŠˆ–ô‚ľ‚Ä‚˘‚˝‚股‚éB

493ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/28(‹ŕ) 17:06:59
>>492
Solaris ‚ĚƒfƒtƒHƒ‹ƒg‚Í "Entire Distribution" ‚Ć‚˘‚¤ƒpƒbƒP[ƒW‚ĚƒZƒbƒg‚ž‚ćB
ƒCƒ“ƒXƒg[ƒ‰[‚ĹƒfƒtƒHƒ‹ƒg‚Ĺ‘I‘đ‚ł‚ę‚Ä‚˘‚é‚Ě‚Ş‚ą‚ę‚ž‚ľAƒvƒŠƒCƒ“ƒXƒg[ƒ‹
‚ł‚ę‚Ä‚˘‚é‚Ě‚ŕ‚ą‚ę‚É‹ß‚˘‚ŕ‚́B‚ť‚ą‚É‚Í Perl ‚ŕ Python ‚ŕ“ü‚Á‚Ä‚éB
ƒCƒ“ƒXƒg[ƒ‹‚ˇ‚éŰ‚Ě‘I‘đŽˆ‚Ĺ "Core System" ‚đ‘I‚ׂΠPerl ‚â Python ‚Í
“ü‚ç‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚Ż‚ǁA‚ą‚ę‚đƒfƒtƒHƒ‹ƒg‚ĆŒÄ‚Ô‚Ě‚Í‚ż‚ĺ‚Á‚Ć–ł—‚Ş‚ ‚é‚ĆŽv‚¤‚íB

‚ť‚ę‚ƁAŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚Ć‚ŠƒJƒeƒSƒŠ‚ĹƒfƒXƒNƒgƒbƒv‚Ć‚Š^‚ɃfƒtƒH‚ĆŒž‚Á‚˝•¨‚Í
Solaris ‚É‚Í‘śÝ‚ľ‚Č‚˘BDebian ‚Í’m‚ç‚ńB

494ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/28(‹ŕ) 20:11:40
Solaris2.6‚ ‚˝‚č‚ĚƒfƒtƒH‚ĹPerl‚Í“ü‚Á‚Ä‚˝‹L‰Ż‚Ş‚ ‚éB
15”N‚­‚炢‘O‚ĚHP-UX‚ž‚ĆPerl‚Ş“ü‚Á‚Ä‚Č‚Š‚Á‚˝‹L‰Ż‚ށB

495ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 00:42:19
‰´‚ŕHP-UXƒƒCƒ“‚ž‚Ż‚ÇPerl“ü‚Á‚Ä‚Č‚˘‚í

496ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 00:47:55
Šm‚Š‚ɁASolaris‚ÉŠľ‚ę‚Ä‚˘‚ÄHP-UXŽg‚í‚ł‚ę‚é‚ĆŽg‚˘‚É‚­‚˘‚í[

497ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 07:33:12
‚ĆŒž‚¤‚í‚Ż‚ŁAUN*XƒT[ƒoŠÇ—ŽŇ‚Ěę‡‚Íawk‚đŽg‚Ś‚é‚悤‚É‚Č‚Á‚Ä‚¨‚Ż‚ÎŠÔˆá‚˘‚ ‚č‚Ü‚š‚ń‚ˁB

498ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 10:56:30
ŠÂ‹Ť‚đ‘I‚΂Ȃ˘ƒT[ƒoŠÇ—‚ž‚Á‚˝‚çAsh,grep,sed,tr,cut,paste,sort,uniq‚ ‚˝‚č‚ŁB
nawk‚Ćgawk‚ĚŽd—lˇ‚ŞŒ‹\‚ ‚é‚̂ŁAawk‚ÍŽg‚˘‚É‚­‚˘B

499ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 13:15:51
‚ą‚¤‚˘‚¤˜b‘č‚ĚŽž‚ÉSolaris‚Ć‚ŠHP-UX‚͏o‚é‚Ě‚ÉAIX‚͏o‚Č‚˘ƒCƒ[ƒW

500ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 13:40:55
“ú–{’jŽ™‚Č‚çHI-UXA“Á‚ÉHI-UX/WE2‚ž‚ëBíŽŻ‚â‚Ë

501ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 14:15:09
‚¤‚Ţ

502ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 16:56:12
‚˘‚â‚ą‚ą‚ÍedƒXƒNƒŠƒvƒg‚Ĺ

503ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 18:47:15
Solaris‚́A/usr/bin/awk /usr/bin/nawk /usr/xpg4/bin/awk
3‚•ʁX‚Č‚Ě‚Ş“ü‚Á‚Ä‚˝‹C‚Ş‚ˇ‚é‚ȁB
‚ŁAˆę”Ô‚Ü‚Ć‚ŕ‚Č‚Ě‚Ş3”ԖڂȂ̂ŁA‚ć‚ť‚Š‚玝‚Á‚Ä‚Ť‚˝ƒXƒNƒŠƒvƒg‚́Ać“Ş‚Ě#!‚đ
‘‚ŤŠˇ‚Ś‚Č‚˘‚Ć‚˘‚Ż‚Č‚˘‚Ć‚˘‚¤AƒJƒIƒX‚ȏó‘Ô‚ś‚á‚Č‚Š‚Á‚˝‚ž‚낤‚ŠB

504ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 19:23:53
>>503
ŽŠ•ŞƒAƒJƒEƒ“ƒg‚ĚƒpƒX‚͐^‚Áć‚É /usr/xpg4/bin/‚đŽ‚Á‚Ä‚Ť‚Ä‚˝‚íB

505ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 19:25:17
ƒXƒNƒŠƒvƒg‚đ‘g‚ŢŽž‚Í‚ž‚˘‚˝‚˘ nawk ‚đŽg‚¤
‘źl‚ĚƒXƒNƒŠƒvƒg‚đŠŰƒpƒNƒŠ‚ˇ‚é‹@‰ď‚Ş–ł‚˘‚Ě‚ĹƒJƒIƒX‚ÍŠ´‚ś‚˝Ž–‚Ş–ł‚˘

506ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 19:32:53
>>505
˜b‚Ě—Ź‚ę‚Ş>>497 >>498‚Ȃ̂ŁA‰Â”ŔŤ‚Ş–â‘č‚Č‚ń‚ž‚ćB

507ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/29(“y) 19:39:08
ƒEƒ`‚Í RHEL ‚Ć Solaris ‚ž‚Żl‚Ś‚ę‚Ηǂ˘‚Š‚çAawk ‚Ĺ–â‘č‚Ş‚ ‚鎞‚Í Perl ‚Š Python ‚ĹĎ‚Ü‚ˇ‚í

508ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/01/30(“ú) 05:43:19
#!/usr/bin/env [gn]*awk
‚ž‚ëíl

509ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/01(‰Î) 10:39:45
shebangs‚É /usr/bin/env ‘‚­‚Ě‚Á‚Ä‚ ‚ń‚Ü—Ç‚˘‚ĆŽv‚Ś‚Č‚˘‚ń‚ž‚ć‚Č‚ 
•Ą”‚Ěˆř”‚Ěˆľ‚˘‚Ć‚ŠAŠÂ‹Ť•Ď”‚đ‚ť‚ą‚܂ŐM—p‚ľ‚Ä—Ç‚˘‚ŕ‚Ě‚Č‚Ě‚Š‚Ć‚Š
‚ ‚Ć /usr/bin/ ‚É env ‚Ş‚ ‚é‚ą‚Ć‚Í–{“–‚É•ŰŘ‚Ĺ‚Ť‚é‚Ě‚Š‚Ć‚Š
/bin/sh ‚đ‘‚˘‚˝‚Ů‚¤‚Ş—Ç‚˘‚ń‚ś‚á‚Č‚˘‚Š‚Á‚ÄŽv‚Á‚Ä‚ľ‚Ü‚¤

510ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/01(‰Î) 11:45:20
‚ą‚Ě˜b‘č‚ŕ’č”Ô‚ž‚ȁB‘OƒXƒŒ‚Ě558-564‚Ĺ‚ŕ‚â‚Á‚Ä‚˝‚źB‚Ć‚č‚ ‚Ś‚¸Œ‹˜_‚ž‚Ż‚đˆř—p‚ľ‚Ć‚­‚íB

>’˛‚ׂĂ݂˝‚ç#!‚ɃCƒ“ƒ^[ƒvƒŠƒ^‚Ěˆř”‚đ2‚ÂˆČă—^‚Ś‚˝‚Ć‚Ť‚Ě
>‹““Ž‚ÍOS‚É‚ć‚Á‚ĈႤ‚悤‚ž‚Á‚˝B
>
>FreeBSD4.2: 2‚ÂˆČă‚ ‚Á‚Ä‚ŕ“n‚é(/usrbin/env gawk -f foo)
>Linux(2.6.8): ‹ó”’‚đŠÜ‚ß‚Ä1‚Â‚Ěˆř”‚Ć‚ľ‚Ä“n‚é(/usr/bin/env "gawk -f" foo)
>Soraris(5.8): 2‚Â‚ßˆČ~‚Ěˆř”‚Í–łŽ‹(/usr/bin/env gawk foo)
>
>Œ‹‹Ç/usr/bin/envŽg‚Á‚˝‘‚Ť•ű‚Ígawk‚ĚƒCƒ“ƒXƒg[ƒ‹ˆĘ’u‚̍ˇ‚đ
>‹zŽű‚ľ‚悤‚Ć‚ľ‚Ä‚é‚ń‚ž‚낤‚ށA“Žě‚ÍOS‚É‚ć‚Á‚Ä‚Ä‚ń‚ł΂ç‚΂ç
>‚Č‚Ě‚Ĺ‚ ‚܂肨ŠŠ‚ß‚Ĺ‚Ť‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć‚ž‚낤‚ŠB

511ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/02(…) 00:12:39
ruby ŠEŒG‚Ĺ‚ŕ—Źs‚Á‚Ä‚é‚Č
ˆÓ–Ą‚ŕ”ť‚炸u‚¨‚Ü‚ś‚Č‚˘v‚ĆĚ‚ľ‚ÄŽg‚Á‚Ă邤‚ż‚É
“sŽs“`ŕ‰ť‚ľ‚Ä‚˘‚­‚ń‚ž‚Č

512ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/03(–Ř) 22:33:59
‚Č‚ş gawk ‚É‚Í tr ‚Ş–ł‚˘‚Ě‚ž
tr("‚`-‚y","A-Z")‚Ć‚Š‚ľ‚˝‚˘‚ź

513ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/04(‹ŕ) 03:31:02
‚Â Python

514ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/04(‹ŕ) 09:10:06
>>512

BEGIN {
hankaku="0 1 2 3 4 5 6 7 8 9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z a b c d e f g h i j k l m n o p q r s t u v w x y z "
zenkaku="‚O‚P‚Q‚R‚S‚T‚U‚V‚W‚X‚`‚a‚b‚c‚d‚e‚f‚g‚h‚i‚j‚k‚l‚m‚n‚o‚p‚q‚r‚s‚t‚u‚v‚w‚x‚y‚‚‚‚ƒ‚„‚…‚†‚‡‚ˆ‚‰‚Š‚‹‚Œ‚‚Ž‚‚‚‘‚’‚“‚”‚•‚–‚—‚˜‚™‚š"
}
{
for (i=0; i<length(hankaku); i+=2) {
gsub(substr(hankaku,i+1,1),substr(zenkaku,i+1,2))
}
}

515ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/04(‹ŕ) 09:20:39
‚ť‚ę‚ž‚Ćtr('ab', 'ba')‚Ş‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚ń‚ž‚ć‚Č‚ŸB

516ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/04(‹ŕ) 09:54:40
“Ż‚śŽ–‚ś‚á‚ń

517ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/04(‹ŕ) 19:22:21
”Ä—p“I‚É‚P‚ě‚Á‚Ć‚Ż‚΂˘‚˘‚ś‚á‚ń

518ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/05(“y) 20:23:34
>514‚Ý‚˝‚˘‚Čƒxƒ^‘Ĺ‚ż‚ś‚á‚Č‚­‚Ä

A-Z‚ -‚ń

‚ą‚¤‚˘‚¤•\‹L‚Ĺ’uŠˇ‚ˇ‚é•ű–@‚ ‚éH

519ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/05(“y) 20:37:26
>>518
tr Žg‚Ś‚΁H

520ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/06(“ú) 03:05:39
tr ƒRƒ}ƒ“ƒh‚Á‚Ċ‹Ť‚É‚ć‚Á‚ă}ƒ‹ƒ`ƒoƒCƒg‚Ěˆľ‚˘‚ވá‚í‚ˁHƒEƒ`‚Ěę‡
Ubuntu10.04‚É“ü‚Á‚Ä‚étr(GNU coreutils)7.4‚Í‚Ç‚¤‚â‚ç2•śŽšˆľ‚˘‚É‚ľ‚ż‚Ⴄ‚ç‚ľ‚˘‚Ş
MacOSX10.5‚É“ü‚Á‚Ä‚étriƒo[ƒWƒ‡ƒ“”ť‚ç‚ń‚ŞmanŒŠ‚é‚ĆBSDŒn‚Ű‚˘j‚Í1•śŽšˆľ‚˘‚É‚ľ‚Ä‚­‚ę‚˝

521ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/06(“ú) 05:00:06
UNICODE = •śŽš”
mbcs = ƒoƒCƒg”

522ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/07(ŒŽ) 08:10:44
‚ń[‚ƁA‚Ç‚ä‚ą‚ƁH
gnome-terminal‚̓†ƒjƒR[ƒhÝ’č‚Ě‚Í‚¸‚Č‚ń‚ž‚ށc
‘ź‚É‚â‚ç‚Č‚Ť‚Ⴂ‚Ż‚Č‚˘‚ą‚Ć‚Ş‚ ‚é‚Á‚Ä‚ą‚ƁH

523ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/09(…) 23:11:37
awk++Žg‚Á‚Ä‚él‚˘‚éH
http://awk.info/?doc/dsl/awkplusplus.html

524ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/10(–Ř) 14:20:51
Ĺ‹ßAawk‚Ě‘śÝ‚đ’m‚č‚Ü‚ľ‚˝B
‚˘‚ë‚ń‚ČŒžŒę‚đG‚Á‚Ă͍ÁÜEEEG‚Á‚Ă͍ÁÜEEE‚đŒJ‚č•Ô‚ľ‚Ä‚˘‚Ü‚ľ‚˝B
awk‚͉˝‚Ć‚Č‚­ƒ}ƒXƒ^[o—ˆ‚ť‚¤‚Č‹C‚Ş‚ľ‚Ü‚ˇB
‚ą‚ę‚Š‚çŠć’Ł‚č‚Ü‚ˇII
‚Q‚T‚U”{‚Ě–{‚đĄ‚Í“Ç‚ń‚Ĺ‚¨‚č‚Ü‚ˇB

525ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/16(…) 02:02:44
gawk‚ĹƒtƒB[ƒ‹ƒh‚đƒ\[ƒg‚ľ‚Ä•\ŽŚ‚ľ‚˝‚˘‚ń‚ž‚Ş
{split($0, a);asort(a);for(i=1;i<NF;i++){printf("%s%s", a[i], FS);}printf("%s\n", a[NF]);}
‚ć‚č‚ŕƒXƒ}[ƒg‚Č•ű–@‚ ‚éH

$1`$NF‚Ş“ü‚Á‚˝“ÁŽę”z—ń‚Ý‚˝‚˘‚Č‚Ě‚Ş‚ ‚Á‚˝‚炤‚ę‚ľ‚˘‚Ě‚ž‚ށB

526ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/16(…) 07:22:58
>>525
$i‚Ć‚Š‘‚Ż‚é‚ľ‘ă“ü‚ŕ‚Ĺ‚Ť‚é‚Š‚ç
$1`‚đ•Ű‘ś‚ľ‚Č‚­‚Ä‚˘‚˘‚Ě‚Č‚çAŒă”ź‚Í

for(i=1;i<=NF;i++){$i=a[i]} print

‚Ə‘‚Ż‚΂ż‚ĺ‚Á‚Ć’Z‚­‚Č‚é‚ȁB

527ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/16(…) 12:11:40
>>526
‚Č‚é‚قǁA‚ť‚¤‚Ĺ‚Ť‚é‚Ě‚ŠB‚ ‚č‚Ş‚Ć‚¤B

528ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/17(–Ř) 01:07:36
http://www.kt.rim.or.jp/~kbk/gawk-3.1/ ‚É’u‚˘‚Ä‚ ‚Á‚˝
win32—pgawk‚Ş‚˘‚‚̊ԂɂŠŒöŠJ’âŽ~‚É‚Č‚Á‚Ä‚˘‚˝B

wn32‚Ěgensub‚ŞŽg‚Ś‚Ä“ú–{Œę‚ވľ‚Ś‚āA
‚Š‚Âexe‚݂̂ʼnғŽ‚ˇ‚é‚Ě‚ĹƒCƒ“ƒXƒg[ƒ‹•s—v‚Č‚Ě‚Ş•Ö—˜‚Ĺ
ŒöŽ„‚É‚í‚˝‚Á‚Ĉ¤—p‚ľ‚Ä‚˘‚˝‚̂ŁA”ńí‚ɔ߂ľ‚˘ĽĽĽ

529ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/17(–Ř) 02:14:57

530ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/18(‹ŕ) 11:30:36
‚ť‚ę‚͏­‚ľŒĂ‚˘.
gawk-mbcs-win32-20090920.zip ‚ŞŽčŒł‚É‚ ‚é‚Ě‚Ĺ•K—v‚Č‚çÄ”z•z‚ˇ‚é‚Ş?

5315282011/02/19(“y) 01:36:10
>>530
‚ŕ‚ľŽ„‚ÉŒž‚Á‚Ä‚­‚ę‚Ä‚˘‚é‚Ě‚Ĺ‚ ‚ę‚΁A
exe‚Ě‚Ý‚ž‚Ż‚Ç2009/11/24”Ĺ‚ŞŽčŒł‚É‚ ‚é‚̂ŁA
‚ą‚ę‚đŽg‚˘‘ą‚Ż‚悤‚ĆŽv‚¤B‚ ‚č‚Ş‚Ć‚¤B

532ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/19(“y) 08:18:59
‰´‚ĚŽčŒł‚ɁAgawk-mbcs-win32-20091124.zip ‚Ş‚ ‚Á‚˝B
—~‚ľ‚˘l‚Ş‚˘‚āA‚Š‚Ĕz•z‚É–â‘č–ł‚˘‚Ć‚˘‚¤Ž–‚Ş‚í‚Š‚ę‚΂ǂÁ‚Š‚É‚¤‚‚ˇ‚é‚ŞB

‚ľ‚Š‚ľ‚Č‚ń‚Ĺ”z•z‚â‚ß‚ż‚á‚Á‚˝‚ń‚ž‚ë‚ˁB
‚Ç‚ą‚Š‚ç‚Š”qŽŘ‚ľ‚˝ƒR[ƒh‚Ć‚Š‚Ěƒ‰ƒCƒZƒ“ƒX–â‘č‚Č‚Ě‚Š‚ȁH

533ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/19(“y) 22:51:02.65
AWK++‚É‚ć‚éƒIƒuƒWƒFƒNƒgŽwŒü“ü–ĺ
http://ja.wikibooks.org/wiki/AWK%2B%2B%E3%81%AB%E3%82%88%E3%82%8B%E3%82%AA%E3%83%96%E3%82%B8%E3%82%A7%E3%82%AF%E3%83%88%E6%8C%87%E5%90%91%E5%85%A5%E9%96%80

awk++‚Í–Ę”’‚ť‚¤‚ž‚Ż‚ǁAŒťŽŔ‚É‚Íawk‚ĹOO‚đ‚â‚él‚Í‚Ů‚Ć‚ń‚Ç‚˘‚Č‚˘‚ž‚낤B
‚ť‚ŕ‚ť‚ŕawkŽg‚˘‚ÍOO‚đ—‰đ‚Ĺ‚Ť‚Č‚˘‚—îŽŇ‚Ş‚Ů‚Ć‚ń‚Ç‚ž‚ľB
‚Ĺ‚ŕAgawk‚ރfƒtƒHƒ‹ƒg‚ĹOO‚ɑΉž‚ˇ‚ę‚Îawk‚ĹƒIƒuƒWƒFƒNƒgŽwŒü‚ˇ‚él‚ŕ‘‚Ś‚é‚Š‚ŕ‚ˁB

534ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/19(“y) 23:05:51.24
>>533
ƒfƒtƒH‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚éawk‚Ĺ‚Ĺ‚Ť‚é”ÍˆÍ‚Ě‚ą‚Ć‚ľ‚Š‚â‚ç‚Č‚˘‚ć

535ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/20(“ú) 00:59:51.51
“ŻŠ´B„ƒfƒtƒH‚Ĺ‚Ĺ‚Ť‚é”͈Í
’ˇ‚ß‚ĚƒXƒNƒŠƒvƒg‚đ‘‚˘‚˝Ž–‚Ş‚ ‚Á‚˝‚Ě‚ĹOO‚ ‚é‚Ć•Ö—˜‚ĆŽv‚¤‚Ż‚Ç
‚í‚´‚í‚´ƒCƒ“ƒXƒg[ƒ‹‚ˇ‚é‚Č‚çperlArubyApython‚Ş‚ ‚é‚ľ‚Č‚Ÿ

536ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/02/22(‰Î) 10:31:51.00
awk‚ŏ‘‚Š‚ę‚˝awk++‚Á‚Ä‚Č‚˘‚́H

537ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/02(…) 23:14:41.35
gawk‚Ĺ•˝‰ź–źEƒJƒ^ƒJƒi‚Ě•”•Ş‚𔲂Ťo‚ľ‚˝‚˘‚ĆŽv‚Á‚Ä‚Ü‚ˇB
—á‚Ś‚΁uawk‚ɂ‚˘‚ÄŒę‚éƒXƒŒv‚ž‚Á‚˝‚ç
"‚ɂ‚˘‚Ä" "‚éƒXƒŒ" ‚đ•Ď”‚É“ü‚ę‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚˘‚˘•ű–@‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚ŠH

5385372011/03/02(…) 23:17:39.07
u‚ɂ‚˘‚āv‚Ɓu‚éƒXƒŒv‚Í‚ť‚ę‚ź‚ę•Ę‚̕ϐ”‚É“ü‚ę‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇ

539ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/02(…) 23:27:45.29
ƒAƒ‹ƒtƒ@ƒxƒbƒgˆČŠO‚Ě•”•Ş‚ž‚Á‚˝‚çAƒAƒ‹ƒtƒ@ƒxƒbƒg‚đFS‚ÉŽw’č‚ľ‚Äwhile‚ʼnń‚š‚΂˘‚˘‚Ż‚ǁA
ŠżŽš‚ŕ”˛‚­‚Ě‚Í“ď‚ľ‚˘‚ȁB
‚ť‚ę‚ɁAŽ–ŽŔă•Ď”‚Í–łŒŔ‚ɐśŹ‚ˇ‚é‚Á‚ÄŽ–‚ŠB

540ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/02(…) 23:58:57.50
match‚Ě‘ć2ˆř”‚É/[‚ -‚ńƒA-ƒ“]+/‚đŽ‚Á‚Ä‚­‚é‚Ć‚Š?

541ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/03(–Ř) 13:28:46.50
$0,$1...$NF‚đ‰ó‚ľ‚Ä‚ŕ‚˘‚˘‚ń‚ž‚Á‚˝‚çAŽ„‚Č‚ç‚ą‚¤‚ľ‚Ü‚ˇB

gsub‚ĚŒŸő•śŽš“S‚ɂ͐ł‹K•\Œť‚đŽg—p‚ˇ‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚é‚Š‚çA
‚Đ‚ç‚Ş‚Č‚ĆƒJƒ^ƒJƒiˆČŠO‚Ě•śŽš‚đƒXƒy[ƒX‚É’u‚ŤŠˇ‚Ś‚éB

gsub(/[^[‚Ÿ-‚ńƒ@-ƒ“]/," ")

‚Đ‚ç‚Ş‚Č‚ĆƒJƒ^ƒJƒiˆČŠO‚Ě•śŽš‚Í”źŠpƒXƒy[ƒX‚Q‚‚ɒu‚ŤŠˇ‚í‚éB
‚ ‚Ć‚ÍNF‚đŒŠ‚Ä•\ŽŚ‚ľ‚˝‚˘‚悤‚ɏˆ—‚ˇ‚éB

’ˆÓ‚ˇ‚ׂŤ‚́AWindows”ł̐V‚ľ‚˘ƒo[ƒWƒ‡ƒ“‚Ě‚ŕ‚̂ł́A
ł‹K•\Œť‚Ć‚ľ‚āA‚Đ‚ç‚Ş‚Č‚đ ‚Ÿ-‚ń ‚ŁAƒJƒ^ƒJƒi‚đ ƒ@-ƒ“ ‚Ĺ
Žw’č‚Ĺ‚Ť‚Č‚˘‚ŕ‚Ě‚Ş‚ ‚č‚Ü‚ˇB
‚˝‚ľ‚Šƒ}ƒ‹ƒ`ƒoƒCƒgŠg’Ł‚ʼn󂳂ꂽB

5425372011/03/03(–Ř) 14:28:35.14
>541
‚Ü‚žŽŽ‚ľ‚Ä‚Ü‚š‚ń‚ށA—~‚ˇ‚é•śŽšˆČŠO‚đÁ‚ľ‚ăSƒjƒ‡ƒSƒjƒ‡‚ˇ‚ę‚΂˘‚Ż‚ť‚¤‚Ĺ‚ˇB
>539-540‚ł‚ń‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B

543ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/03(–Ř) 19:41:21.36
BEGIN {
str = "ƒfƒ“ƒRŠżŽš‚΂ń‚´‚˘Œł‹Cabcde‚ž‚Š‚ç"
c = split(str, a, "[^[ƒ@-ƒ“‚Ÿ-‚ń]")
for (i = c; i>=1; i--) {
if ( a[i] !~ /^$/ ) { print a[i] }
}
}

544ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/03(–Ř) 19:44:47.65
ƒ{ƒP‚Š‚Ü‚ľ‚˝
4s–Ú‚Í•’Ę‚É
for ( i = 1; i <=c; i++) {
‚ĹOKB

545ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/03(–Ř) 22:55:52.84
c‚đŽc‚ł‚Č‚­‚Ć‚ŕ
for (i in a){if (a[i]) print a[i]}
‚ĹŠÔ‚É‡‚¤‚悤‚ȁB

546ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/04(‹ŕ) 01:04:03.52
for-in‚ž‚Ə‡˜‚Ş•Űá‚ł‚ę‚Č‚˘‚ń‚ś‚á‚Č‚Š‚Á‚˝‚Á‚Ż?

547ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/04(‹ŕ) 08:34:52.75
for ( i = 1; i in a ; i++) ‚Á‚ď‘‚Ť•ű‚ŕ‚Ĺ‚Ť‚é‚ć

548ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 14:14:11.11
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
....

‚̂悤‚ɁAƒtƒB[ƒ‹ƒh”‚ރoƒ‰ƒoƒ‰‚ŁAƒtƒB[ƒ‹ƒh‚ވę’v‚ˇ‚éę‡‚ŕ‚ ‚ę‚Î
ˆę’v‚ľ‚Č‚˘ƒf[ƒ^‚Ş‚ ‚é‚Ě‚Ĺ‚ˇ‚ށAd•Ą‚đ
a1 a2 a3
b1
c1
d1 d2
‚̂悤‚É‚Ü‚Ć‚ß‚ ‚°‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
‚ł‚ˇ‚ނɃOƒO‚Á‚ăRƒsƒy‚Ć‚˘‚¤–ó‚É‚ŕ‚˘‚Š‚¸BBB

549ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 14:31:25.16
>>548
‚˘‚낢‚ë‚â‚č•ű‚Í‚ ‚é‚ĆŽv‚¤‚Ş

awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}'

550ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 14:53:42.21
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚ť‚ę‚ź‚ęA4‚d•Ąƒf[ƒ^‚Ě‚ ‚Á‚˝‚ŕ‚Ě‚Í3‚‚ɁA2‚‚̂ŕ‚Ě‚Í1‚Â‚É‚ĆŒ¸‚Á‚˝‚Ě‚Ĺ‚ˇ‚Ş
‚ť‚ęˆČăŒ¸‚Á‚Ä‚Ü‚š‚ńB“Ż‚śƒRƒ}ƒ“ƒh‚đŒJ‚č•Ô‚ľ‚Š‚Ż‚Ä‚Ý‚˝‚Ě‚Ĺ‚ˇ‚ށA•Ď‰ť‚Í‚Č‚Š‚Á‚˝‚Ĺ‚ˇB

a1 a1 a1 a1
b1 b1 b1
...‚Ě•”•Ş‚Ş
a1 a1 a1
b1 b1
‚É‚Í‚Č‚Á‚˝‚Ć‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
‚ŕ‚¤­‚ľ‚¨‚‚Ť‚ ‚˘‚˘‚˝‚ž‚Ż‚Č‚˘‚Ĺ‚ľ‚傤‚ŠBBB

551ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 15:06:41.15
ŽčŒł‚Ĺ‚Íˆę‚‚ɂȂ邯‚Ç‚Č‚ŸBŒ´—‚Í‚í‚Š‚é‚ž‚낤‚Š‚ç‚ ‚Ć‚Í‚Ş‚ń‚΂ęB
s‚˛‚Ć‚ÉƒtƒB[ƒ‹ƒh‚Ě“YŽš‚ɂ‚˘‚㋁[ƒv‚ˇ‚é‚Ě‚Ć˜A‘z”z—ń‚ŏoŒťƒ`ƒFƒbƒN‚ރLƒ‚B

% cat hoge.txt
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
% awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}' hoge.txt
a1 a2 a3
b1
c1
d1 d2

552ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 15:14:33.26
0610005C13Rik 0610005C13Rik 0610005C13Rik
0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik

‚ą‚¤‚˘‚¤Š´‚ś‚Ě•śŽš—ń‚Č‚ń‚Ĺ‚ˇ‚Ş
a1‚Ć‚Šb1‚Ĺ—á‚Ś‚Ä‚ŕ‘ĺä•v‚ž‚Á‚˝‚Ĺ‚ˇ‚ŠH

553ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 15:38:11.62
‹ó”’‚Ĺ‹ćŘ‚ç‚ę‚˝•śŽš—ń‚Č‚ç‚Č‚ń‚Ĺ‚ŕ‚˘‚˘‚ށA‚ť‚ĚƒŒƒxƒ‹‚ĚŽż–â‚Ş
o‚é‚悤‚ś‚á‚ŕ‚¤‚ˇ‚ą‚ľŠî‘b‚đ•×‹­‚ľ‚Č‚˘‚Ć‚ž‚ß‚Š‚ŕ‚Č‚ŸB

554ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 15:50:13.69
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“Žg—p‚ĚƒTƒ“ƒvƒ‹‚Ĺ–â‘č‚Č‚˘‚ĆŒž‚¤Ž–‚́`
‚t‚m‚h‚wŠÂ‹Ť‚Č‚Ě‚Š‚ȁ`

555ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 15:58:11.87
Mac OSX‚Ěƒ^[ƒ~ƒiƒ‹‚đŽg‚Á‚Ä‚Ü‚ˇB
>>551‚Í‚ť‚Ě‚Ü‚Ü‚¤‚Ü‚­“Ž‚Ť‚Ü‚ľ‚˝B
‚˘‚܏¸‡‚ĹŽč“Ž‚ōě‹Ć‚ľ‚Ä‚Ü‚ˇ‚ށA‚Ü‚žz‚𔲂Ż‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚š‚ńB
‚ŕ‚¤Žč‚Ş‚Â‚č‚ť‚¤‚Ĺ‚ˇ

556ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 16:04:33.75
ˆęs–ě˜Y‚đ•Ş‰đ‚ľ‚ÄƒXƒNƒŠƒvƒg‚É‘g‚Ý’ź‚ľ‚ĘM‚ę‚ΓŽěŠm”Fo—ˆ‚é‚ĆŽv‚¤

557ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 16:21:10.50
‚˘‚Üw‚Ü‚Ĺ‚Ť‚Ü‚ľ‚˝B‚ŕ‚¤‚ž‚ß‚Ĺ‚ˇB
ˆę‰žAƒtƒ@ƒCƒ‹‚đ‚¨‚˘‚Ä‚Ý‚Ü‚ˇBBB
http://www5.puny.jp/uploader/download/1299482386.zip
ƒpƒX‚Í1234‚Ĺ‚ˇB

558ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/03/07(ŒŽ) 17:18:15.93
‚Ü‚ž‚â‚Á‚Ä‚é‚Ě‚Š`
ƒtƒ@ƒCƒ‹‚́@O‚l@‚Ş–â‘č‚Ý‚˝‚˘‚ž‚Š‚ç
‚b‚q‚k‚e‚Ěƒtƒ@ƒCƒ‹Œ`ŽŽ‚É•ĎŠˇ‚ľ‚ďă‚Ěˆęs–ě˜Y‚Ĺ–â‘č‚Č‚˘‚Ý‚˝‚˘‚ž‚Á‚˝‚ćB

559ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/04/19(‰Î) 03:07:46.46
#•Ą”s‚Ě“ü—Í’†Ać‚̍s‚Ě11ƒJƒ‰ƒ€–Ú‚ÉOUT‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚Š‚ÂŽŸ‚̍s‚Ě11ƒJƒ‰ƒ€–Ú‚ÉIN‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é2s‚Ş‘ľ‚Á‚˝ŽžA2s‚đo—Í
$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
prev="";
}

560ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/04/19(‰Î) 15:55:50.78
# 7.awk
NR >= 2{
if($0 ~ /^>'=+/){
if($0 ~ /~$/){
print "A";
}else{
print "NAA";
}
}else if($0 ~ /^>\^(Q=)+/){
if($0 ~ /~~$/){
print "B";
}else{
print "NAB";
}
}else{
print "NAC";
}
}

7.txt
3
>'======#======~
>^Q=Q=Q=Q=Q=Q=Q=Q=~~
>'===#====~
NAA
NBB
NAA@@@‚Ć‚Č‚éB‰˝‚ŁH
A
B
A@@‚Ć‚Č‚Á‚Ä‚Ů‚ľ‚˘‚̂ɁEEEgawk 3.1.7‚Ĺ‚ˇEE

561ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/04/19(‰Î) 16:30:51.01
‰´‚ĚŽčŒł‚Ěgawk 3.1.7‚Ĺ‚ÍŠú‘Ň’Ę‚č‚ĚŒ‹‰Ę‚É‚Č‚é‚Č‚ B

s––‚Ş‚ç‚Ý‚ž‚ƉüsƒR[ƒh‚ވá‚Á‚Ä‚˝‚čŒŠ‚Ś‚Č‚˘‹ó”’‚Ş
“ü‚Á‚Ä‚˝‚č‚Ć‚˘‚¤‚Ě‚Ş‚ć‚­‚ ‚é‚Ě‚ĹŠm”F‚ľ‚Ă݁B

562ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/04/19(‰Î) 16:32:43.45
>>560
‚ ‚Ć

/^>'=+/

‚Á‚ăLƒƒƒvƒ`ƒƒ‚Ć‚Š‚ľ‚Ä‚é‚í‚Ż‚ś‚á‚Č‚˘‚Š‚ç+‚Í–ł‘Ę‚ś‚á‚Č‚˘‚ŠB

563ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/04/19(‰Î) 16:45:20.75
>>561
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B‰üsƒR[ƒh‚đunixŒ`ŽŽ‚É‚ľ‚˝‚ço—ˆ‚Ü‚ľ‚˝B
ĄŒă‚Ć‚ŕ‚ć‚ë‚ľ‚­‚¨Šč‚˘’v‚ľ‚Ü‚ˇB

564ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/04/19(‰Î) 17:00:39.34
>>559

IN‚Ş‚ ‚é‚Ć‚Ť‚É‚ľ‚Šprev‚ރNƒŠƒA‚ł‚ę‚Ä‚˘‚Č‚˘‚Š‚çAOUT‚ޏoŒť‚ľ‚˝ˆČ~‚É
•Ą”s‚ŞŒo‰ß‚ľ‚Ä‚ŕIN‚ޏoŒť‚ˇ‚é‚Ćprint‚ł‚ę‚éƒXƒNƒŠƒvƒg‚É‚Č‚Á‚Ä‚˘‚é‚ćB

5655592011/04/20(…) 01:08:11.06
http://okwave.jp/qa/q6672025.html
‚Ć‚Š‚Ě“ü—Í‚đƒCƒ[ƒW‚ľ‚Ä‚˝‚ŕ‚Ě‚Ĺ...

$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
}
$11!~/OUT/{ prev=""; }

566ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/01(“ú) 16:22:39.39
http://okwave.jp/qa/q6660984.html
#2—ń–Ú‚Ě€–Ú‚Şdisk1`4‚Ü‚Ĺ•s‘Ť•”•Ş‚Ş–„‚Ü‚é‚悤‚É‚ľA•s‘Ť‚ľ‚Ä‚˘‚˝•”•Ş‚Ě1—ń–Ú‚É‚Í‘O‚ĚŽžŠÔA3—ń–Ú‚É‚Í0‚Ĺ–„‚ß‚˝‚˘
BEGIN{ dt=prevDt="00:00:00"; }
NF>=3{ dt=$1; tgt=$2; n=$3; }
NF==2{ tgt=$1; n=$2; }
{ gapDisp(prevTgt,tgt); disp(dt,tgt,n); prevDt=dt; prevTgt=tgt; }
END{ gapDisp(tgt,"disk1"); }

function disp(dt,tgt,n){ print dt, tgt, n; }
function gapDisp(disk,endDisk, cnt)
{
for(cnt=add(getNo(disk)); cnt!=getNo(endDisk); cnt=add(cnt)) disp(prevDt, sprintf("disk%d", cnt), 0);
}
function add(cnt){ return ((++cnt>4)?(1):(cnt)); }
function getNo(disk){ sub(/disk/,"",disk); return disk; }

567ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/01(“ú) 19:40:09.87
BEGIN { reset() }
NF == 2 { $3 = $2; $2 = $1; $1 = last_t }
{ last_t = $1 }
{ if ($2 < last_disk) { p(); reset() } last_disk = $2 }
{ n[$2] = $3 }
{ for(i in n) { if (i >= $2) { t[i] = $1 } } }
END { p() }
function p() {
for (i = 1; i <= 4; i++) {
d = "disk" i
print t[d], d, n[d]
}
}
function reset() {
for (i = 1; i <= 4; i++) {
d = "disk" i
t[d] = t["disk4"]
n[d] = 0
}
}

568ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/03(‰Î) 14:58:05.53
ŠÔˆá‚Á‚Ä‚é‚ć
‚ľ‚Š‚ŕ’ˇ‚­‚Ä”ü‚ľ‚­‚Č‚˘‚ć

569ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/03(‰Î) 15:13:19.32
http://okwave.jp/qa/q6711117.html
...‚ą‚ń‚ČŠ´‚ś‚Š‚Ë‚ĽH@@ awk -f sum.awk ƒf[ƒ^ | sort
----- sum.awk -----
$1!~/¤“X–ź/{ tbl[$1 "," $2]+=$3; }
END{
@for(key in tbl){
@@split(key, item, /,/);
@@print item[1], item[2], tbl[key];
@}
}
-----

570ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/03(‰Î) 15:33:28.80
>>566
NF==3 {
disp();
for(i=1;i<=4;i++) {
disk_time[i]=$1
disk_val[i]=0
}
disk_val[substr($2, 5, 1)]=$3
}
NF==2 {
disk_val[substr($1, 5, 1)]=$2
}
END{
disp()
}
function disp() {
for(i=1;i<=4;i++) {
if(i in disk_time) printf("%s disk%d %s\n", disk_time[i], i, disk_val[i])
}
}

571ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/03(‰Î) 16:12:56.67
BEGIN {
    # ć“Ş‚Ş‚˘‚Ť‚Č‚č "disk2 15" ‚Ě‚Ý‚ĹŽn‚Ü‚Á‚˝‚č‚ľ‚Č‚Ż‚ę‚Î
    # ‚ą‚̏‰Šú‰ť‚Í•s—vB
    a = "00:00:00";
}
NF == 3 {
    if (NR > 1) put();
    a = $1;
    b[$2] = $3;
}
NF == 2 {
    b[$1] = $2;
}
END {
    put();
}
function put(    i) {
    for (i = 1; i <= 4; i++) {
        print a, "disk" i, b["disk" i] + 0;
        b["disk" i] = 0;
    }
}

572ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/03(‰Î) 16:20:05.55
>>569 awk‚Ě”z—ń‚Á‚Ä‚Ç‚ę‚­‚炢Šm•Ű‰Â”\‚Ȃ́H
ć‚Ésort‚ľ‚˝‚ç‚Ç‚¤‚Š‚ȁH sort ƒf[ƒ^ | awk -f sum.awk
----- sum.awk -----
$1!~/¤“X–ź/{ if(store==$1 && item==$2) val+=$3; else{ disp(); store=$1; item=$2; val=$3; } }
END{ disp(); }
function disp(){ if(store!="" || item!="") print store, item, val; }
-----

ƒwƒbƒNƒVƒ‡ƒ“

574ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 00:54:22.24
$ uname -sr
CYGWIN_NT-6.1 1.7.9(0.237/5/3)
$ awk --version
GNU Awk 3.1.8

‚ą‚̊‹Ť‚ŁA
awk 'BEGIN {for(i=j=1;i<50;++i) {print j; j*=10}}'
‚ą‚ęŽŔs‚ˇ‚é‚ƁAj‚Ş23Œ…’´‚Ś‚˝‚ ‚˝‚č‚Š‚çA‚¨‚Š‚ľ‚­‚Č‚é‚ń‚ž‚Ż‚ǁB

awk‚̐Ž”‚Á‚ďăŒŔ‚ ‚é‚́HiƒEƒ`‚ž‚Ż‚ŠHj

575ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 01:09:59.27
long double•Ó‚č‚̐¸“x‚ľ‚Š‚Č‚˘‚ćB

576ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 09:18:39.10
>>574
‚¨‚ę‚Ě‚o‚b‚Ĺ‚Í•’Ę‚É 1 ‚Š‚ç 1e+048 ‚Ü‚Ĺ•\ŽŚ‚ł‚ę‚Ü‚ˇ‚ށBBB

577 ”E–@’ŸyLv=25,xxxPTz 2011/05/06(‹ŕ) 09:54:18.77

578ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 11:30:10.09
>>576
–{“–‚Ĺ‚ˇ‚ŠI‚ć‚ë‚ľ‚Ż‚ę‚Ί‹Ť‚đ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B

>>577
‚ ‚č‚Ş‚Ć‚¤B‚ą‚ąawk‚ŕ’Ł‚ę‚˝‚ń‚žBŒ‹‰Ę‚Ş’ˇ‚ˇ‚Ź‚袂Á‚Ä‚˝‚Ě‚ćB
ł‚É‚ą‚ń‚ČŒ‹‰Ę‚É‚Č‚éB

POSIX‚Ĺ•Űá‚ł‚ę‚Ă鐸“x‚Í>>575‚Á‚Ä‚ą‚ƁH
‚Ä‚ą‚Ƃ́Aawk‚Í“ŕ•”‚ł́A‘S‚Ă̐”‚Şdoubleˆľ‚˘‚Ȃ́H

579ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 14:20:04.87
>>578
576‚Ĺ‚ˇBWindowsXP + GNU Awk 3.0.6 + multi-byte extension 1.15 ‚Ĺ‚ˇB

580ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 18:58:28.81
>>579
‚ ‚č‚Ş‚Ć‚¤B
‚ ‚Ü‚čˆá‚˘‚Ş‚Č‚˘‚ȁBWin7‚ÍŠÖŒW‚Č‚˘‚ž‚낤‚ľB
multi-byte extension‚Ş‚ť‚Ě•Ó‚č‚ŕ˜M‚Á‚Ä‚˘‚é‚Ě‚Šc

‚ť‚¤‚˘‚Ś‚΁A1e+048‚Ý‚˝‚˘‚ČŽw”‚Ĺ•\ŽŚ‚ł‚ę‚é‚́H
o—Í‚Ě‚Ć‚ŤŠŰ‚ß‚é‚Š‚çA‚ż‚á‚ń‚ĆŒvŽZ‚Ĺ‚Ť‚Ä‚é‚悤‚ÉŒŠ‚Ś‚é‚Ě‚Š‚ȁB

581ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/06(‹ŕ) 23:07:48.20
awk‚ł͐”’l‚Í‚ˇ‚ׂÄdouble‚Ĺˆľ‚˘‚Ü‚ˇB
‚Ĺ‚ˇ‚Š‚ç‚ť‚̐¸“x‚Ĺ‚ ‚é53bit•ŞA‘ĺ‘Ě15Œ…‚ż‚ĺ‚Á‚Ć‚đ’´‚Ś‚é‚ƐłŠm‚Č’l‚đ•ŰŽ‚Ĺ‚Ť‚Ü‚š‚ńB

23Œ…‚ ‚˝‚č‚܂Őł‚ľ‚­•\ŽŚ‚Ĺ‚Ť‚Ä‚é‚Á‚Ä‚Ě‚Í‚ć‚­‚í‚Š‚č‚Ü‚š‚ń‚ށA
3.0.6‚É‚ľ‚Ä‚ŕo—ÍŽž‚̏‘ŽŽŽw’č‚Şˆá‚¤‚ž‚Ż‚Ĺ“ŕ•”“I‚É‚Í“Ż‚ś‚悤‚É•słŠm‚Č’l‚É
‚Č‚Á‚Ä‚ľ‚Ü‚Á‚Ä‚é‚ĆŽv‚˘‚Ü‚ˇB

582ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/07(“y) 01:38:55.53
‚ž‚Š‚çAŽŔŽżlong double‚̐¸“x‚É‚Č‚Á‚Ä‚˘‚é‚ń‚ž‚Á‚Ă΁B

583ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/07(“y) 11:11:15.94
>>582
uŽŔŽżv‚Ć‚˘‚¤‚Ě‚Í‚Ç‚¤‚˘‚¤ˆÓ–Ą?

#define AWKNUM double

‚Á‚Ä‚Ě‚Ş‚ ‚é‚ľAlong double ‚É‚ľ‚Ä‚ŕ‰ź”•”‚Í64bit‚ž‚Š‚ç23Œ…‚É‚Í‘Ť‚č‚Č‚˘‚ć?
x87‚ĚƒŒƒxƒ‹‚ĹŠg’Ł¸“x‚É‚Č‚Á‚Ä‚Ä‚ŕA•\ŽŚ‚â‚ç‚Č‚ń‚â‚炡‚é‚Ć‚ą‚ë‚Ĺ”{¸“x‚É
ŠŰ‚ß‚ç‚ę‚ż‚Ⴄ‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB

584ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/07(“y) 13:09:06.68
http://codepad.org/4GaxJcGp
ŠŽ‘S‚Ɉę’vB‚Ç‚¤ŒŠ‚Ä‚ŕ double ‚Ĺ‚ˇB–{“–‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝

585ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/07(“y) 21:19:09.46
>>581
‚ ‚¤A‚ť‚¤‚Č‚Ě‚Š[B‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB˘‚Á‚˝‚Č‚ŸB
10i‚ĹŽŔ”ˆľ‚Ś‚Ć‚Ü‚Ĺ‚ÍŒž‚í‚Č‚˘‚Ż‚ǁAŽ”‚Í—~‚ľ‚˘B
”‚đ‚˘‚ë‚ń‚ČŒ^‚Ĺˆľ‚Ś‚鏈—Œn‚Č‚ń‚Ä‚Č‚˘‚ŠB

586ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/07(“y) 23:01:38.63
>>583
‚ [Along double‚ĆŒž‚Á‚˝‚Ě‚ŞŮ‚Š‚Á‚˝‚ˁB10‚Ě™p‚Ěę‡‚ÍŽŔŽżdouble‚đ‘ĺ‚Ť‚­‰z‚Ś‚˝¸“x‚É‚Č‚Á‚Ä‚˘‚é‚ĆŒž‚˘‚˝‚Š‚Á‚˝B

10‚Í2‚Ć5‚̐ςž‚Š‚çA10”{‚đŒJ‚č•Ô‚ˇ‚Ć‚Ť‚ɉź”•”‚Í5”{‚¸‚‚ɂľ‚Š‚Č‚ç‚Č‚˘B
IEEE‚Ědouble‚̐¸“x‚ž‚Ć5‚Ě22ć‚Ĺ53ƒrƒbƒg‚đŽg‚˘‰Ę‚˝‚ˇ‚̂ŁA‚ť‚ą‚Ü‚Ĺ‚ÍŒëˇ‚ސś‚ś‚Č‚˘B
Œž‚˘Šˇ‚Ś‚ę‚΁A10‚Ěę‡‚Í53ƒrƒbƒg+22ƒrƒbƒgA‘Ś‚ż75ƒrƒbƒg•Ş¸“x‚Ş‚ ‚é‚悤‚ÉŒŠ‚Ś‚éB

‚Ü‚ŸA>584‚đ10”{‚ś‚á‚Č‚­‚Ä5”{‚É‚ľ‚āAdouble‚đlong long‚É‚ľ‚Ä%.f‚đ%llx‚É‚ľ‚ărƒbƒg”‚𐔂Ś‚Ä‚Ý‚ę‚΂킊‚é‚Ĺ‚ľ‚ĺB

587ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/09(ŒŽ) 21:13:05.37
gawk‚Ěƒ†[ƒUƒKƒCƒh‚ɁA‘ź‚̏ˆ—Œn‚ł́A•W€ƒGƒ‰[‚đŽg‚¤‚˝‚߁A
@print "Serious error detected!" | "cat 1>&2"
‚Ć‚˘‚¤•ű–@‚ľ‚Š‚Č‚˘‚Ć‚ ‚č‚Ü‚ˇB
gawk‚Í/dev/stderr‚đ“Á•Ę‚Ɉľ‚¤‚˝‚߁A
@print "Serious error detected!" > "/dev/stderr"
‚Ə‘‚­‚Ě‚Ş“KŘ‚Ć‚ ‚č‚Ü‚ˇB

‚ą‚ę‚ɂ́A‚ǂ̂悤‚Čˆá‚˘‚Ş‚ ‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
/dev/stderr‚Ş‚ ‚éOS‚Č‚çAcat‚ĚƒvƒƒZƒX‚ސśŹ‚ł‚ę‚é‘ź‚́Aˆá‚˘‚Í‚Č‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
ŠÂ‹Ť‚⏈—Œn‚đ–â‚킸“Žě‚ł‚š‚˝‚˘‚Č‚çAă‚̏‘‚Ť•ű‚Ě•ű‚Ş‚ć‚˘‚Ě‚ŠA‹C‚É‚Č‚Á‚Ä‚˘‚Ü‚ˇB

‚ć‚ë‚ľ‚­‚¨Šč‚˘‚ľ‚Ü‚ˇB

588ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/10(‰Î) 00:17:11.81
‘ź‚̏ˆ—Œn‚Á‚āA‘ź‚Ěawk‚Á‚ÄŽ–‚ž‚ćB

/dev/stderr‚Ş‚ ‚éOS‚Á‚ÄŽ–‚Ŕ‚á‚Č‚­‚āA
gawk‚Í“ÁŽę‚Čƒtƒ@ƒCƒ‹–ź‚Ć‚ľ‚Ä/dev/stderr‚Ć‚ŠŽg‚Ś‚é‚ćA‚Á‚ÄŽ–‚ž‚ćB

‚Č‚Ě‚Ĺ‘ź‚ĚOS‚Ĺ‚ŕ gawk ‚ž‚Á‚˝‚çprint‚Ć‚Š‚̏o—͐ćƒtƒ@ƒCƒ‹–ź‚Ć‚ľ‚Ä /dev/stderr Žg‚Ś‚é‚Á‚Ęb‚ž‚ˁB
/dev/stderr‚Ć‚Š‚đƒTƒ|[ƒg‚ľ‚Ä‚˘‚Č‚˘gawkˆČŠO‚Ěawk‚Ĺ‚ŕ“Žě‚ł‚š‚é‚Č‚ç ƒpƒCƒv‚Ć"cat 1>&2"‚đŽg‚¤•ű–@‚ľ‚Š‚Č‚˘B‚ށAWinŒn‚Ícat‚ž‚Ć...

589ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/10(‰Î) 09:20:21.36
‚ť‚ą‚Ü‚Ĺ‚Ě‚ą‚Ć‚đ‚ˇ‚é‚Č‚çPerl/Ruby/Python“™‚Ě‚ż‚á‚ń‚Ć‚ľ‚˝
ƒXƒNƒŠƒvƒgŒžŒę‚ŏ‘‚˘‚˝•ű‚Ş‚˘‚˘‚ń‚ś‚á‚Č‚˘‚Š‚ȁB‚ą‚¤‚˘‚¤
‚Ç‚¤‚Ĺ‚ŕ‚˘‚˘‚Ć‚ą‚ë‚Ĺ”Y‚Ü‚Č‚­‚ÄĎ‚Ţ‚ćB

awk‚Íawk‚ĹŽčŒy‚ɏ‘‚Ż‚é”ÍˆÍ‚Č‚ç‘ź‚̒ǐ‚đ‹–‚ł‚Č‚˘‚ĆŽv‚¤‚Ş
‚ť‚Ě˜g‚đ‚͂ݏo‚悤‚Ć‚ˇ‚é‚Ć“r’[‚É‘ĺ•Ď‚É‚Č‚éB‚ť‚ą‚ŞŠy‚ľ‚˘‚Ć
‚˘‚¤‚Ě‚Č‚ç–ł—‚É‚ÍŽ~‚ß‚Č‚˘‚Ż‚Çw


590ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/10(‰Î) 14:35:51.09
>>589
‚ť‚¤A‚ť‚ę‚ŞŠy‚ľ‚˘‚ń‚ž

591ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/11(…) 00:36:20.77
>>588
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
cat‚Ş‚Č‚˘ŠÂ‹Ť‚ž‚ƁA‚Ç‚¤‚ľ‚悤‚ŕ‚Č‚˘‚Ĺ‚ˇ‚ˁc

>>589
ƒRƒ“ƒ}‹ćŘ‚č‚Ěƒf[ƒ^‚đAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ŏˆ—‚ľ‚Ä‚˘‚˝‚̂ŁA
‚ť‚ę‚đawk‚ɈڐA‚ľ‚Ä‚˘‚Ü‚ľ‚˝Bˆę”ÔŽčŒy‚ž‚Á‚˝‚Ě‚Ĺ‚ˇB

‚ż‚Ȃ݂ɁA2ŽžŠÔ”źˆČă‚Š‚Š‚Á‚Ä‚˘‚˝ˆ—‚ށA1•ŞˆČ“ŕ‚É’Zk‚ł‚ę‚Ü‚ľ‚˝B
ƒƒ‰ƒ^B@@@ƒƒ‰ƒ^c

592ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/11(…) 10:19:43.16
C‚ŏ‘‚Ť’ź‚ľ‚˝‚琔•b‚ĹŽŔsŠŽ—š‚Ě—\Š´‚—

593ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/11(…) 12:14:45.46
‚[‚Ä‚ŕawk‚Ć‚Š‚ť‚Ě‘ź‚ĚƒXƒNƒŠƒvƒg‚ĹƒTƒNƒb‚Ə‘‚Ż‚é‚悤‚Č•śŽš—ńˆ—‚đ
CŒžŒę‚Ć‚Š‚Ĺ‚Í‚ ‚ń‚Ü‚č‘‚Ť‚˝‚­‚Č‚ç‚ń‚ĆŽv‚¤‚źw

594ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/24(‰Î) 10:19:27.54
‚Č‚č‚Ü‚š‚ń

595ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/25(…) 20:17:22.02
‚ ‚Ÿ‚ ‚ ‚Ÿ‚Ÿ‚Ÿ```–ł—‚ž‚Á‚˝‚ŠAA–ł—‚Č‚Ě‚Š[Ia[0][0] = 1 ¨ syntax error

596ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/25(…) 21:58:46.38
>>595
gawk‚Ěę‡ƒCƒ“ƒfƒbƒNƒX‚đSUBSEP(=\034‚ރfƒtƒHƒ‹ƒg)‚đ‹˛‚ń‚ĹƒVƒŠƒAƒ‰ƒCƒY‚ľ‚˝ƒCƒ“ƒfƒbƒNƒX‚Ĺ‘˝ŽŸŒł”z—ń‚đ•\Œť‚ˇ‚é
a[0,0] = 1;
‚Č‚çOK‚Ě‚Í‚¸B‚ą‚Ě‚Ć‚Ť‚ĚƒCƒ“ƒfƒbƒNƒX‚Í"0\0340"‚ž‚Š‚çAa["0\0340"] == 1B

597ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/26(–Ř) 18:46:04.99
>>596
‚ ‚č‚Ş‚Ć‚¤BŽn‚ß‚Š‚ç‚ť‚ę‚đˆÓŽŻ‚ľ‚ď‘‚˘‚Ä‚˝‚ç‚ć‚Š‚Á‚˝‚ń‚ž‚Ż‚ǂˁB

god["name"] = "Kaname Madoka"
god["msg"] = "Mahoushoujo ha watashi dakede juubun dayo."
homerun["name"] = "Akemi Homura"
homerun["msg"] = "Madoka ha watashi no yome."
‚ą‚ń‚Č•—‚ɏ‘‚˘‚Ä‚˘‚˝‚Ě‚đA

puella_magi["god"] = god
puella_magi["homerun"] = homerun
‚Ý‚˝‚˘‚ɂ܂Ƃ߂悤‚Ć‚ľ‚˝‚çA‚ ‚΂΂΂Î

awk‚Ě”z—ń‚Á‚ďˆ—Œn‚É‚ć‚Á‚Ä‚Í“Y‚ŚŽš‚ސŽ”‚Ěę‡Aˆ—‚ŞĹ“K‰ť‚ł‚ę‚Ä‘‚­‚Č‚Á‚˝‚股‚é‚Ě‚Š‚ȁH
\‘˘‘Ě‚Ě‘ă‚í‚č‚Ý‚˝‚˘‚ÉŽg‚˘‚˝‚Š‚Á‚˝‚Ě‚ž‚ށB

598ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/27(‹ŕ) 00:57:28.69
name["god"] = "Kaname Madoka"
msg["god"] = "Mahoushoujo ha watashi dakede juubun dayo."
name["homerun"] = "Akemi Homura"
msg["homerun"] = "Madoka ha watashi no yome."

‚Ĺ‚ć‚­‚ˁH

599ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/30(ŒŽ) 21:25:51.88
awk‚Á‚Ä *‚Ç‚ĚŽŔ‘•‚Ĺ‚ŕ* ˆę“x‚ŕŽg‚Á‚˝‚ą‚Ć‚Ş‚Č‚˘•Ď”‚Ě“ŕ—e‚Á‚āAƒXƒJƒ‰‚Č‚ç0‚Š""‚É‚Č‚Á‚Ä‚é‚́H
•Ď”‚ވę“x‚ŕ‘ă“ü‚ł‚ę‚Ä‚˘‚Č‚˘‚ą‚Ƃ𔝒股‚é‚˝‚߂ɁA(x==0 && x=="")‚Á‚ď‘‚˘‚ĉ˝‚Š–â‘č‚Č‚˘H

600ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/30(ŒŽ) 21:31:52.21
>>599
•]‰ż‚ł‚ę‚é‚Ć‚Ť‚ɕϐ”‚Ş‘śÝ‚ľ‚Č‚Ż‚ę‚΍쐬‚ł‚ę‚éB‚Í‚¸
”z—ń‚Ě—v‘f‚Č‚ç in ‚Ĺ’˛‚ׂç‚ę‚é‚Ż‚Ç
•Ď”ŽŠ‘Ě‚Ć‚Č‚é‚Ć‚Ç‚¤‚ž‚낤‚Ë

601ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/30(ŒŽ) 21:32:47.76
>>599
‰˝“x‚ŕ‘ă“ü‚ľ‚˝ŒăAĹŒă‚É 0 or "" ‚đ‘ă“ü‚ľ‚˝•Ď”‚Ć‹ć•Ę‚Ĺ‚Ť‚Č‚˘B

602ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/30(ŒŽ) 23:19:06.92
>>600-601
‚ ‚č‚Ş‚Ć‚¤B‹ć•Ę‚Ĺ‚Ť‚Č‚˘‚Á‚āA‚Ç‚¤‚˘‚¤ó‘Ô‚É‚Č‚é‚́H0‚đ‘ă“ü‚ľ‚˝‚ç0‚Š"0"‚É•]‰ż‚ł‚ę‚éB
‚ ‚ A""‚đ‘ă“ü‚ľ‚˝‚ç0‚Š""‚É•]‰ż‚ł‚ę‚Ä‘Ę–Ú‚Á‚Ä‚ą‚Ć‚ŠIH

603ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/31(‰Î) 00:05:27.97
‚ ‚ęHŽŽ‚ľ‚˝‚ç‚Ç‚Á‚ż‚đ‘ă“ü‚ľ‚Ä‚ŕ599‚ĚŽŽ‚Í0‚É•]‰ż‚ł‚ę‚˝‚ćB‹ć•Ę‚Ĺ‚Ť‚Č‚˘ƒP[ƒX‚Á‚Ä‚Ç‚¤‚˘‚¤ę‡H

604ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/31(‰Î) 06:28:27.99
BEGIN {
    # ‰Šú‰ť’źŒă (–˘Žg—p) ‚̕ϐ”‚͐”’l (0) ‚Ć•śŽš—ń ("") ‚Ě—ź•ű‚ĚŒ^‚đŽ‚ÂB
    print x == 0, x == ""; # —ź•ű‚Ć‚ŕ^

    x = 0;
    print x == 0, x == ""; # ‘OŽŇ‚̂ݐ^B

    x = "";
    print x == 0, x == ""; # ŒăŽŇ‚̂ݐ^B

    # ‘ź‚Ě–˘Žg—p‚̕ϐ”‚đ‘ă“ü‚ˇ‚é‚Ć "Ä‰Šú‰ť" ‚Ĺ‚Ť‚éB
    x = y;
    print x == 0, x == ""; # —ź•ű‚Ć‚ŕ^B
}

605ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/05/31(‰Î) 22:57:53.71
> ‰Šú‰ť’źŒă (–˘Žg—p) ‚̕ϐ”‚͐”’l (0) ‚Ć•śŽš—ń ("") ‚Ě—ź•ű‚ĚŒ^‚đŽ‚ÂB
IEEE Std 1003.1 ‚Ě awk ‚Ě EXTENDED DESCRIPTION ‚Ě
Variables and Special Variables ‚ɏ‘‚˘‚Ä‚ ‚é‚ˁB uninitialized value ‚Ć‚˘‚¤‚ç‚ľ‚˘B
POSIX‚ɏ€‹’‚ľ‚Ä‚éawk‚Č‚ç‚ą‚¤‚Č‚é‚Ý‚˝‚˘‚ž‚Ż‚ǁAƒIƒŠƒWƒiƒ‹‚Í’m‚ç‚ńB

Ä‰Šú‰ť‚ˇ‚é‚Č‚ç$(NF+1)Žg‚¤‚Ů‚¤‚Ş‚˘‚˘‚Š‚ŕ‚ˁB–˘Žg—p‚̕ϐ”‚đ—pˆÓ‚ľ‚Č‚­‚Ä‚˘‚˘B
‚ž‚Ż‚ǁA‚ť‚ę‚Ş•K—v‚ȏę–Ę‚ŞŽv‚˘•‚‚Š‚΂Ȃ˘‚ށB

ŠÖŒW‚Č‚˘‚Ż‚ǁAabsŠÖ”‚Á‚Ä‚Č‚˘‚ń‚ž‚ˁB•Ę‚É—Ç‚˘‚Ż‚ǁAƒÎ‚âA
0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”‚Í’č‹`‚ľ‚Ä‚Ä‚Ů‚ľ‚˘‚Č‚ B

606ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/02(–Ř) 10:09:14.37
>>605
> Ä‰Šú‰ť‚ˇ‚é‚Č‚ç$(NF+1)Žg‚¤‚Ů‚¤‚Ş‚˘‚˘‚Š‚ŕ‚ˁB–˘Žg—p‚̕ϐ”‚đ—pˆÓ‚ľ‚Č‚­‚Ä‚˘‚˘B
ƒtƒB[ƒ‹ƒh•Ď”‚͏í‚É•śŽš—ńŒ^‚ŁA ”’lŒ^‚ÍŽ‚˝‚Č‚˘B

607ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/02(–Ř) 22:47:31.10
ƒÎ‚Íatan2(0,-1)‚Ĺ‚˘‚˘‚Ć‚ľ‚Ä
u0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”v‚Á‚Ä‚Ç‚¤’č‹`‚ľ‚Ä‚˘‚ÂŽg‚¤‚Ě?

608ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/03(‹ŕ) 13:48:37.95
u0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”v‚Ć‚˘‚¤‚Ě‚Ş‰˝‚đŠó–]‚ľ‚Ä‚˘‚é‚Š‚É‚ć‚éB
ˆČ‰ş‚Ě3Ží—Ţ‚Ş‚ ‚éB

(1) ĹŹ‚̐ł‚Ě”ńł‹K”
(2) ĹŹ‚̐ł‚̐ł‹K”
(3) 1.0‚É‘Ť‚ľ‚ÄŠŰ‚ß‚˝Œ‹‰Ę‚Ş1.0‚ć‚č‘ĺ‚Ť‚­‚Č‚éĹŹ‚̐”

609ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/03(‹ŕ) 23:58:11.26
>>606
‚ ‚ż‚áI‚ť‚¤‚Ĺ‚ľ‚˝B$‚Ĺ–ß‚é‚Ě‚Í•śŽš—ń‚ž‚Á‚˝B
‚ť‚ĚŽd—l‘“Ç‚ń‚Ĺ‚é‚ƁANF‚đŠg’Ł‚ľ‚˝‚Ć‚ŤAŒłX‚Č‚Š‚Á‚˝Š‚Íuninitialized value‚É‚Č‚é‚Á‚Ä‚ ‚Á‚˝‚̂ŁB

>>607
‚ť‚ę‚Ĺ‚˘‚˘‚ń‚ž‚Ż‚ǁAPI‚Ć‚Š‚ĹŽQĆ‚Ĺ‚Ť‚˝‚ç‚ŕ‚Á‚Ć‚˘‚˘A‚ĆŽv‚Á‚˝‚Ě‚Ĺ‚ˇB
>>608
”’lŒvŽZ‚Ě‚˝‚߂ɁAC‚ĚDBL_EPSILON‚Ě‘ă‚í‚č‚É‚Č‚é’萔‚Ş—~‚ľ‚˘‚ȂƁB
”CˆÓ‚̐¸“x‚ĹŠŰ‚ß‚ç‚ę‚éŠÖ”‚ŕ‚Č‚˘‚Ĺ‚ˇ‚ľB

610ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/04(“y) 09:41:48.63
DBL_EPSILON‚Ş>>608‚Ě(1)`(3)‚Ě‚Ç‚ę‚Š‚í‚Š‚ç‚Č‚˘H
”’lŒvŽZ‚ĚŠî–{‚Č‚ń‚ž‚ށB

611ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/10(‹ŕ) 21:49:33.34
•Ď”–ź‚ȂǁAŽŠ‘O‚Ĺ‚ ‚Á‚Ä‚ŕ‹K‘Ľ‚đˆÓŽŻ‚ľ‚Ä‚˘‚é•ű‚˘‚Ü‚ˇ‚ŠH
awk‚ž‚ƁA‚b•—‚ވę”Ę“I‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
ˆę”ԍŏ‰‚ŞVBA‚ž‚Á‚˝‚̂ŁA’ˇ‚˘–ź‘O‚ĆČ—Ş‚ŞŹ‚´‚Á‚Ä‚ľ‚Ü‚Á‚Ä
ŽŠ•Ş‚ĹƒCƒ‰ƒCƒ‰‚ľ‚Ä‚˘‚Ü‚ˇB
‚Ý‚Č‚ł‚ń‚́A’ʏí‚̕ϐ”‚Í‚ą‚¤A”z—ń‚Í‚ą‚¤A’萔‚Í‚ą‚¤A•śŽšŒ^‚Í‚ą‚¤ĽĽĽ
‚Ć‚˘‚¤‚ŕ‚Ě‚đŽQl‚É‚ľ‚˝‚˘‚Ĺ‚ˇB

612ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/10(‹ŕ) 22:10:28.97
>>611
ƒVƒXƒeƒ€ƒnƒ“ƒKƒŠƒAƒ“‚đĚ—p‚ˇ‚é‚Š‚Ç‚¤‚Š”Y‚Ţ‚Ů‚Ç‘ĺ‚Ť‚Č‚ŕ‚Ě‚đawk‚ŏ‘‚˘‚˝‚ą‚Ć‚Ş–ł‚˘

613‚Š‚ ‚˝2011/06/13(ŒŽ) 18:37:34.88
A5‚Č‚í‚â‚ ‚Ó‚§t( ())

614ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/15(…) 21:51:26.93
>>611
’xƒŒƒX‚ž‚ށAŒ^_“ŕ—e‚Ěŕ–ž_–ź‘O‚Ý‚˝‚­‚ľ‚Ä‚éB–ź‘O‚Şˆę•śŽš‚ž‚Ć‚ť‚Ě‚Ü‚Ü‚ž‚Ż‚ǁB
ƒOƒ[ƒoƒ‹•Ď”‚Ćƒ[ƒJƒ‹•Ď”‚Ě‚Ç‚Á‚ż˜M‚Á‚Ä‚é‚Ě‚Š•Ş‚Š‚č‚₡‚˘‚悤‚ɁAƒ[ƒJƒ‹•Ď”‚Í•K‚¸l‚ĹŽn‚ß‚é‚悤‚É‚ľ‚Ä‚éB
d_per_shouhizei = 5.0‚Ć‚Š‚ˁB

615ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/20(ŒŽ) 18:37:26.17
gawk‚ĹBINMODE‚đÝ’股‚ę‚΃oƒCƒiƒŠ[‚Ě“üo—Í‚Ş‚Ĺ‚Ť‚é‚Ě‚Í‚í‚Š‚é‚Ě‚Ĺ‚ˇ‚ށA
“ü—Í‚ł‚ę‚˝ƒoƒCƒiƒŠ[‚đ16iƒ_ƒ“ƒv‚ľ‚Ä•\ŽŚ‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
od“™‚ĚŠO•”ƒRƒ}ƒ“ƒh‚đŽg‚¤ˆÓŠO‚É•ű–@‚Ş‚ ‚ę‚΂¨‹ł‚Ś‚­‚ž‚ł‚˘B

616ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/06/20(ŒŽ) 19:17:07.50
printf("%02x\n", $1);

617“VŽg ŸuL5esZLBSE 2011/07/05(‰Î) 00:15:13.83
“ń“x‚Ć˜b‚Š‚Ż‚ń‚Č‚ć
‚¨‘O‚ç‚Á‚Ä‚Ç‚¤‚Ý‚Ä‚ŕƒSƒ~‚ž‚ć‚Č

618ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/07/06(…) 14:04:55.24
ƒSƒ~‚ń‚Č‚ł‚˘

619ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/07/14(–Ř) 23:55:15.84
>>595
gawk4.0.0‚Ĺa[0][0]=1‚ŕ‰Â”\‚É‚Č‚Á‚˝‚ś‚á‚Č‚˘‚Š

620ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/07/30(“y) 19:46:15.81
’´‰SŽŇ‚ĚŽż–â‚Ő\‚ľ–ó‚ ‚č‚Ü‚š‚ńBˆČ‰ş‚̂悤‚Čƒf[ƒ^‚đ
aaa 10
bbb 20
ccc 30
aaa 30
bbb 30
aaa 15
ccc 30
ddd 20
ˆČ‰ş‚̂悤‚É‚Ü‚Ć‚ß‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚Ç‚¤‚ľ‚˝‚炢‚˘‚Ĺ‚ľ‚傤‚ŠH
aaa 55
bbb 50
ccc 60
ddd 25

621ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/07/30(“y) 19:53:38.97
ddd 20 ‚Ĺ‚Í‚Č‚˘‚Š‚ĆŽv‚¤‚Ş‚ą‚ń‚ČŠ´‚ś‚Š‚Č
awk '{a[$1]+=$2} END {for (b in a) {print b " " a[b]}}' | sort

622ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/07/30(“y) 23:15:27.52
Gawk4‚Č‚çPROCINFO["sorted_in"]‚̐ݒč‚ĹĹŒă‚Ěsort‚Ş—v‚ç‚Č‚­‚Č‚é

6236202011/07/30(“y) 23:22:20.03
>621
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇI‚¤‚Ü‚­‚˘‚Ť‚Ü‚ľ‚˝B

624ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/07/31(“ú) 15:24:48.76
gawk‚Í‚ŕ‚¤•ĘŒžŒę‚ČƒCƒ[ƒWB•’imawkŽg‚Á‚Ä‚é‚Ć

625ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/16(‰Î) 22:48:21.64
‚ą‚ą‚Á‚Đś‚Ť‚Ä‚Ü‚ˇ‚ŠH

626ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/18(–Ř) 01:56:26.63
ś‚Ť‚Ä‚Ü‚ˇ‚ń

627ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/19(‹ŕ) 00:53:44.39
ś‚Ť‚Ä‚˘‚é‚ą‚Ć‚đŠč‚Á‚ÄŽż–â‚đB
WIN32‚ĚEXEˆę‚‚ŁA‰ş‚ĚTEST.AWK‚ރ}ƒgƒ‚‚É“Ž‚­AWK‚đ’T‚ľ‚Ä‚˘‚Ü‚ˇB
‚ą‚ę‚çˆČŠO‚É‚ ‚č‚Ü‚ˇ‚ŠH

http://hinadori.atnifty.com/~wills/program/gawkm115.zip
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/376460/pack/win95/util/text/awk/gawk-mbcs-win32-20051223.zip?ds
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/80308/pack/win95/util/text/awk/mw32r27.lzh?ds

Cygwin”Ĺ‚ŕŽŽ‚ľ‚˝‚Ě‚Ĺ‚ˇ‚ރ_ƒ‚Ĺ‚ľ‚˝B

TEST.AWK
{ gsub("[0-9]","x",$0) ; gsub("ż","ƒ\",$0) ; gsub("T","‚s",$0) ; print }

TEST.DAT
ą˛ł´ľśˇ¸šşťź˝žż
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT

6286272011/08/19(‹ŕ) 01:00:20.60
TEST.DAT‚́A‹ó”’‚Ş“ü‚Á‚Ä‚˘‚Ü‚ˇB
ęƒuƒ‰‚Ěƒ|ƒbƒvƒAƒbƒv‚đƒRƒsƒy‚ľ‚ĉş‚ł‚˘B

629ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/19(‹ŕ) 06:26:54.92
ƒEƒ`‚É‹A‚Á‚Ä‚Š‚ç’˛‚ׂĂ݂é‚ć

630ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/19(‹ŕ) 11:02:41.54
>>627|628
cygwin‚Ěawk(GNU Awk 3.1.8)‚Ĺ“Ž‚­‚Ż‚ǁA‚Ç‚¤‚Č‚é‚Í‚¸‚Ş‚Ç‚¤“Ž‚Š‚Č‚˘‚ĆŒž‚Á‚Ä‚˘‚é?
>627‚Ětest.dat‚Č‚çA“–‘Ruƒ\v‚ž‚Ż‚Ş•ĎŠˇ‚ł‚ę‚é‚Ż‚ǁB

631ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/19(‹ŕ) 11:55:06.25
iCygwin‚Č‚çUTF8‚ś‚á‚Č‚˘‚Ć‚¤‚Ü‚­“Ž‚Š‚Č‚˘‚Ż‚ǁjShift JIS‚Ĺ“Žě‚ł‚š‚˝‚˘‚Á‚Ä‚ą‚Ć‚Š‚ȁH
Ž–‘O‚ÉTEST.DAT‚đnkf -w‚É’Ę‚ľ‚˝‚ç‘Ę–Ú‚Š‚ȁB

6326292011/08/19(‹ŕ) 21:59:57.43
>>627
ƒXƒNƒŠƒvƒg‚ŕDAT‚ŕSJIS‚ĹŽŽ‚ľ‚˝‚Ż‚ǁAă‹L3‚‚̂¤‚żAgawk-mbcs-win32-20051223.zip‚̓_ƒ‚ž‚Á‚˝‚ćB
1s–Ú‚Ş‚ą‚ń‚Č‚ń‚Č‚éB

ąxx´ľśˇ¸xşťxxxƒ\

ŽčŽ‚ż‚Ě
GNU Awk 3.1.7(windows special Nov 24 2009)
‚ŁA--ctype=SJIS‚â‚Á‚Ä‚ŕ“Ż‚śŒ‹‰Ę‚É‚Č‚é‚ˁB

ƒXƒNƒŠƒvƒgADAT‚đUTF-8‚É‚ľ‚āA--ctype=UTF8‚â‚Á‚ăŠƒ_ƒCƒŒƒNƒg‚ľ‚˝ƒtƒ@ƒCƒ‹‚͐łí‚ČŒ‹‰Ę‚ޏo‚é‚ćB
ƒŠƒ_ƒCƒŒƒNƒg‚ľ‚Č‚˘‚ĹƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚É•\ŽŚ‚ł‚š‚é‚Ɖť‚Ż‚é‚Ż‚ǁB

633ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/19(‹ŕ) 23:18:25.14
EUC‚Ȃ生ŠpƒJƒi‚ŕ‚¤‚Ü‚­‚â‚Á‚Ä‚­‚ę‚é‚ń‚ž‚ށc

634ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/24(…) 08:07:37.54
gawk‚̓Kƒ“ƒKƒ“‹@”\‚đŠg’Ł‚ľ‚Ä‚é‚Ż‚ǁA
‚ť‚ë‚ť‚ëOOP‘Ήž‚ľ‚Ä‚­‚ę‚Č‚˘‚Š‚ȁB
awk++‚Ć‚Š‚ ‚é‚Ż‚ǁA•W€‚ĹOOP‚Ĺ‚Ť‚ę‚Í•Ö—˜B

635ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/24(…) 22:44:37.24
> OOP
...‚ŕ‚Í‚âawk‚Ĺ‚â‚éˆÓ–Ą‚Ş–ł‚˘w ‘ź‚É‚˘‚­‚ç‚Ĺ‚ŕ‚ ‚é•Ę‚ĚŒžŒę‚Ĺ‚˘‚˘‚ś‚á‚ń

636ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 01:14:17.45
awk‚ɍ݂é‚Ć•Ö—˜‚Š‚ŕ‚ĆŽv‚¤‚Ě‚ÍŽQĆ’l‚­‚炢‚Š‚Č

”z—ń‚âŠÖ”‚Ö‚ĚŽQĆ‚đ’l‚Ć‚ľ‚ÄŽć‚čo‚ľŠi”[‚ľ‚˝‚č
‹t‚É‚ť‚Ě’l‚Š‚çŒł‚Ě”z—ń‚ɃAƒNƒZƒX‚ľ‚˝‚čŒł‚̊֐”‚đŒÄ‚ń‚ž‚čo—ˆ‚é‚Ć
‘Š“–‚É•ĄŽG‚Čƒf[ƒ^\‘˘‚Ş•\Œť‰Â”\‚É‚Č‚éA‚ť‚ę‚ą‚ťOOP‚Á‚Ű‚˘‚ą‚Ć‚ŕ‰Â”\‚ž‚ľ

‚Ĺ‚ŕ‚ ‚ń‚Ü‚č‚â‚â‚ą‚ľ‚˘‚ą‚Ć‚â‚é‚Č‚çPerl‚Ĺ‚˘‚˘‚Š‚ç•K{‚Ĺ‚Í‚Č‚˘‚Ë

637ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 02:28:23.99
> ŠÖ”‚đŒÄ‚ń‚ž‚č

•Ď”‚Ě’l‚đŠÖ”–ź‚Ć‚ľ‚Ä
var = "sage";
@var();
‚Á‚Ä‚Ĺ‚Ť‚é‚Ż‚ǁA‚ť‚ę‚Ć‚Íˆá‚¤‚Ě‚ńH



638ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 04:07:56.67
‚¨‚ćA‚ŕ‚¤‚ ‚é‚Ě‚Šw
Ĺ‹ß‚Ěawk‚Í•Ş‚Š‚ç‚Ë‚Śc‚Á‚Ä‚ą‚Ƃ́A”z—ń‚Ö‚ĚŽQĆ‚đŽg‚Á‚Ä“ü‚ęŽq‚Ě”z—ń‚Ć‚ŠŠů‚ɍě‚ę‚ż‚á‚Á‚˝‚股‚é‚Ě‚ŠH

639ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 10:56:54.36
”z—ń‚Ě”z—ń‚͍ě‚ę‚é‚ćBgawk4‚Č‚çB

640ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 19:51:33.84
iL_TMjĚ°Ý

641ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 20:52:51.07
class human {
@@property name
@@property sex
@@property age
@@method new(x, y, z) {
@@@@name = x
@@@@sex = y
@@@@age = z
@@}
@@method say() {
@@@@printf("Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB\n",name, age, sex)
@@}
}
class japanese : human {
@@property name
@@property sex
@@property age
@@method say() {
@@@@printf("Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB\n", name, age, sex)
@@}
}
BEGIN {
@@alice = human.new("ƒAƒŠƒX", "—", 11)
@@taro = japanese.new("‘ž˜Y", "’j", 15)
@@yuka = japanese.new("—R‰Ŕ", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()
}

6426412011/08/25(–Ř) 20:58:10.41
>>635
http://code.google.com/p/lawker/source/browse/fridge/lib/bash/awk%2B%2B/
‚ą‚ę‚đŽg‚Ś‚΂ą‚Ě’ö“x‚ĚOOP‚Í‚Ç‚¤‚É‚Š‚Ĺ‚Ť‚éB
–{“–‚É‚ą‚Ě’ö“x‚Ĺ‚˘‚˘‚Š‚çOOP‚ɑΉž‚ľ‚Ä‚Ů‚ľ‚˘B
Žg‚¤l‚Í‚Ů‚Ć‚ń‚Ç‚˘‚Č‚˘‚ĆŽv‚¤‚ށA‘S‚­‚Ĺ‚Ť‚Č‚˘‚Ě‚ŕ˘‚éB

643ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/25(–Ř) 22:07:53.46
‚ť‚ę‚ÍĹ‘awk‚Ĺ‚ ‚é•K—v‚Ş‘S‚­–ł‚˘

644ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/26(‹ŕ) 06:00:04.19
function Human(self,name,sex,age) {
self["property___name"] = name
self["property___sex"] = sex
self["property___age"] = age
self["method___say"] = "Human___say"
}
function Human___say(self) {
printf "Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB\n", self["property___name"], self["property___age"], self["property___sex"]
}

function Japanese(self,name,sex,age) {
Human(self,name,sex,age)
self["method___say"] = "Japanese___say"
}
function Japanese___say(self) {
printf "Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB\n", self["property___name"], self["property___age"], self["property___gender"]
}

function methodcall(obj,methodname, m) {
m = obj["method___" methodname]
@m(obj)
}

BEGIN {
Human(alice, "ƒAƒŠƒX", "—", 11)
Japanese(taro, "‘ž˜Y", "’j", 15)
Japanese(yuka, "—R‰Ŕ", "—", 18)
methodcall(alice,"say")
methodcall(taro,"say")
methodcall(yuka,"say")
}

645ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/26(‹ŕ) 06:01:35.02
‚˛‚ß‚ńˆę•”gender‚É‚Č‚Á‚Ä‚é‚Š‚çsex‚É’ź‚ľ‚Ć‚˘‚Ä

‚Ć‚č‚ ‚Ś‚¸A‚ą‚ń‚ČŠ´‚ś‚Ĺgawk4‚Ĺ‚ŕOOPŽŠ‘Ě‚Ío—ˆ‚é‚ć‚Á‚Ęb

646ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/27(“y) 15:07:17.61
>>644
‚Č‚é‚قǂˁ[
‚Ć‚Ä‚ŕ•×‹­‚É‚Č‚č‚Ü‚ˇ

‚Ĺ‚ŕA‚â‚Á‚Ď‚čOOP—p‚̍\•ś‚ŞŽg‚Ś‚ę‚΃xƒXƒg‚Ĺ‚ˇ‚Ë
‚ť‚Ě‚Ů‚¤‚Ş‚í‚Š‚č‚₡‚˘‚ĆŽv‚˘‚Ü‚ˇ

647ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/27(“y) 15:58:44.09
‚â‚Á‚Ď•ĘŒžŒęŽg‚¤‚ׂŤ‚ž‚ë

648ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/27(“y) 16:10:36.72
–{“–‚É—~‚ľ‚˘‚ń‚Č‚çAgawk‚ĚML‚É‚ą‚¤‚ˇ‚ę‚ÎOOPŽŔŒť‚Ĺ‚Ť‚é‚ą‚Ć‚đ”­ŒŠ‚ľ‚˝‚ń‚ž‚Ż‚ǁA
‚ą‚ę‚Ě“œˆß\•ś‚đ—pˆÓ‚ľ‚Ä‚­‚ę‚Á‚Ä“Še‚ˇ‚é‚Ć‚˘‚˘‚ń‚ś‚á‚Ë
switch‚ŕŽŔ‘•‚ł‚ę‚Ä‚é‚ľA—~‚ľ‚˘l‚Ş‹‚é‚Ć•Ş‚Š‚ę‚Εt‚Ż‚Ä‚­‚ę‚é‚Š‚ŕ‚ć

649ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/27(“y) 16:25:08.65
#! /usr/bin/env python
# -*- coding: utf-8 -*-

class human:

@@def __init__(self, name, sex, age):
@@@@self.name = name
@@@@self.sex = sex
@@@@self.age = age

@@def say(self):
@@@@print("Ž„‚Í" + self.name + "B" + str(self.age) + "Î‚Ě" + self.sex + "‚Ĺ‚ˇB")

class japanese(human):

@@def __init(self):
@@@@super(human, self).__init__(self)

@@def say(self):
@@@@print("Ž„‚Í" + self.name + "B" + str(self.age) + "Î‚Ě" + self.sex + "‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB")

if __name__ == "__main__":

@@alice = human("ƒAƒŠƒX", "—", 11)
@@taro = japanese("‘ž˜Y", "’j", 15)
@@yuka = japanese("—R‰Ŕ", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()

650ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/27(“y) 16:26:25.23
python‚ŏ‘‚˘‚Ä‚Ý‚é‚ƁA
>>641‚Ć”ä‚ׂé‚Ć“Á‚É‚í‚Š‚č‚₡‚˘‚í‚Ż‚Ĺ‚ŕ‚Č‚˘‚Ż‚Ç
>>644‚ć‚č‚Í‚í‚Š‚č‚₡‚˘

651ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/08/27(“y) 16:53:49.92
‚ť‚č‚áawk‚ÍOOPL‚Ĺ‚Í‚Č‚˘‚Š‚ç‚Č
‚ ‚­‚Ü‚ĹƒVƒFƒ‹‚Ě‚¨‹Ÿ‚Ĺ‚˘‚˘‚ĆŽv‚¤‚ń‚ž
‚ť‚ľ‚Ä‚ť‚ą‚ɍ‚“x‚ČOOP‹@”\‚Í—v‚é‚Ć‚ÍŽv‚Ś‚Č‚˘
‚Ç‚ż‚ç‚Š‚ĆŒž‚Ś‚΃tƒB[ƒ‹ƒh’Šo‚Ć‚Š‚đ‚ŕ‚Á‚Ć•Ö—˜‚É‚ˇ‚ׂŤ‚ž‚ć

652ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/17(“y) 15:34:39.29
cygwinˆČŠO‚Ĺgawk4.0‚đwindows‚ĹŽg‚¨‚¤‚ĆŽv‚Á‚˝‚çAƒoƒCƒiƒŠ‚Í‚Ç‚ą‚Ĺ“üŽč‚Ĺ‚Ť‚ŕ‚¤‚ˇ‚Š‚ˁH

653ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/17(“y) 16:28:58.78
cygwin ‚Ĺ‘Ę–Ú‚Č——R‚Ş•Ş‚Š‚ç‚Č‚˘‚Š‚ç‹ł‚Ś‚ç‚ę‚Č‚˘B

654ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/18(“ú) 08:02:36.95

655ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/19(ŒŽ) 13:00:55.06
>654 ‚ł‚ń‚­‚ˇ‚ą

>653 awk‚ĚŽŔsŒ`ŽŽ‚ž‚Ż“üŽč‚ˇ‚ę‚Ηǂ˘‚悤‚É‚ľ‚˝‚˘‚Ě‚łB

656ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/19(ŒŽ) 14:01:43.39
ƒoƒCƒiƒŠŒÝŠˇ‚ĚWindows‚Ȃ̂ɁAcygwin‚Äexe‚đ‚ŕ‚Á‚Ä‚­‚ž‚Ż‚ś‚áŽg‚Ś‚Č‚˘‚́H

657ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/19(ŒŽ) 16:07:37.39
•¨‚É‚ć‚Á‚Ä‚ÍŽg‚Ś‚˝‚悤‚Č‹C‚Ş‚ˇ‚éB
cygwin1.dll‚ž‚Á‚ŻH‚ɃpƒX‚Ş’Ę‚Á‚Ä‚ę‚Αĺ‘ĚŽg‚Ś‚˝‚悤‚Č‹C‚Ş‚ˇ‚éB

658ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/09/19(ŒŽ) 17:00:12.76
Œ‹\‘ňŽR‚Ědll‚Ş—v‚é‚ć
ƒRƒ}ƒ“ƒh‚É‚ć‚é‚Ż‚Ç

659ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/10/24(ŒŽ) 01:55:49.24
‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B‰pŒę“žˆÓ‚Ȑl

http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
‚́@asort(), asorti()‚ĹŽg‚¤ƒ†[ƒU[’č‹`‚Ě”äŠrŠÖ”‚ɂ‚˘‚Ä
3”Ô–Ú‚Ěˆř”‚ĆPROCINFO["sorted_in"]‚ɐݒ股‚é‚Ě‚Ćˆá‚¤‚Ě‚Š“Ż‚ś‚Č‚Ě‚ŠH

‚ť‚ę‚Ć
http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
‚ɏ‘‚˘‚Ä‚ ‚é3”Ô–Ú‚Ěˆř”‚Ěŕ–ž("descending"‚Ć‚Š)‚Ş—ź—§‚ľ‚Ä‚ń‚́H

660ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/10/24(ŒŽ) 11:34:13.18
http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
As with PROCINFO["sorted_in"], this argument may be the name of a user-defined function, ....

http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
The third argument can also be a user-defined function name ....
‘ćŽOˆř”‚Ě’l‚Ć“Ż–ź‚̊֐”‚Ş’č‹`Ď‚Ý‚Č‚ç‚ť‚ę‚đ—˜—p‚ˇ‚é‚Ć‚ŠA
‚ť‚¤‚˘‚¤•ű–@‚Ĺ‹ć•Ę‚ľ‚Ä‚é‚ń‚ś‚á‚Č‚˘‚Ě

661ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/10/24(ŒŽ) 13:33:04.59
>>659
”äŠrŠÖ”‚Ě—^‚Ś•ű‚ÍPROCINFO["sorted_in"]‚Ěę‡‚Ć“Ż‚ś‚Á‚Ä‚ą‚Ć‚ž‚ëB

ŽŠ•Ş‚Ĺ’č‹`‚ľ‚˝ŠÖ”‚Ě–ź‘O‚Ĺ‚ŕ‚˘‚˘‚ľA11.2.1.2‚ɏ‘‚˘‚Ä‚ ‚é‚悤‚É‚ˇ‚Ĺ‚É—pˆÓ
‚ł‚ę‚Ä‚˘‚é@`‚đŽg‚Á‚Ä‚ŕ‚˘‚˘B


662ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/11/14(ŒŽ) 21:59:05.28
ŒÂl“I‚ɂ́AGAWK‚É‚Í‚ ‚ƁAC‚ŏ‘‚˘‚˝ŠÖ”‚ĚŒÄ‚Ńo‚ľ‚Ć‚˘‚¤‚Š
GAWK‚ĹŒÄ‚ÔŠÖ”‚đC‚ŏ‘‚Ż‚é‹@”\‚Ş—~‚ľ‚˘‚ĆŽv‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁA
‚ą‚ąŒŠ‚éŒŔ‚萢ŠÔ“I‚É‚Í‚ ‚ń‚Ü‚čŽů—v‚Č‚˘‚ń‚Š‚Ë‚ĽB

‚Ü‚ŸA‚ť‚ę‚â‚é‚­‚炢‚Č‚çGAWKŽŠ‘Ě‚É•ĎX‚đ‰Á‚Ś‚čăRƒ“ƒpƒCƒ‹‚ľ‚ë‚Á‚Ä‚ą‚Ć‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁB

663ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/11/15(‰Î) 01:44:31.01
P‚Ć‚ŠRŽg‚ŚŒž‚í‚ę‚é‚ĆŽv‚¤B

664ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/11/15(‰Î) 01:58:32.43
>>662
ttp://www.gnu.org/s/gawk/manual/html_node/Dynamic-Extensions.html
‚ś‚áƒ_ƒHŤ—ˆ“I‚É‚ł‚ç‚ÉŠg’Ł‚ł‚ę‚é‰Â”\Ť‚Í‚ ‚é‚Ý‚˝‚˘‚ž‚Ż‚Ç

665ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/12/09(‹ŕ) 00:35:09.18
Ĺ‹ßawkcard‚đ’m‚Á‚čŔ‰E‚É’u‚˘‚Ä‚é‚Ě‚ž‚ށA“ú–{Œę”Ĺ‚Á‚Ä‘śÝ‚ˇ‚é‚Ě‚ž‚낤‚ŠB

666ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/12/22(–Ř) 16:57:35.32
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_271
‚ą‚ą‚ɏ‘‚˘‚Ä‚ ‚é’Ę‚č‚É‚ľ‚Ä‚ŕ“ú–{Œę‚É–|–ó‚ł‚ę‚Ü‚š‚ń
‚Ç‚¤‚ľ‚Ä‚Ĺ‚ˇ‚ŠH
ŠÂ‹Ť‚Í LinuxMint12 A GNU Awk 3.1.8 ‚Ĺ‚ˇ

667ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/12/22(–Ř) 18:01:49.60
>>666
‚ť‚Ě’Ę‚č‚É‚â‚Á‚˝‚ĆŒž‚¤‚Ě‚Č‚çA‰˝ŒĚpoƒtƒ@ƒCƒ‹‚đ’ńŽŚ‚ľ‚Č‚˘‚Ě‚Š‚ˁAƒ_ƒ~ƒAƒ“ŒNB

668ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/12/22(–Ř) 18:07:45.38
>>667
po‚͍쐬‚ľ‚Ü‚ľ‚˝‚ľAmo‚ŕŠ’č‚ĚƒfƒBƒŒƒNƒgƒŠ‚É‚ ‚č‚Ü‚ˇB
po‚ÍŽŠ•Ş‚Ĺ•ŇW‚ľ‚Ä‚ŕA‚ť‚ĚƒTƒCƒg‚Ě“ŕ—e‚đƒRƒsƒy‚ľ‚Ä‚ŕƒ_ƒ‚Ĺ‚ľ‚˝B

$ cat gettext.po
#: gettext.awk:10
msgid "********** Count Prime Number **********"
msgstr " ‘f”‚𐔂Ś‚é "

#: gettext.awk:14
msgid "2 is a prime number."
msgstr "2 ‚Í‘f”‚Ĺ‚ˇB"

#: gettext.awk:24
msgid "%d is a prime number.\n"
""
msgstr "%d ‚Í‘f”‚Ĺ‚ˇB\n"

$ ls ja_JP/LC_MESSAGES/
gettext.mo

669ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2011/12/22(–Ř) 18:10:02.43
Œ‹‰Ę‚Í‚ą‚Ě’Ę‚č‚Ĺ‚ˇB

$ LC_ALL=ja_JP gawk -f gettext.awk 10
********** Count Prime Number **********
2 is a prime number.
3 is a prime number.
5 is a prime number.
7 is a prime number.

670ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/01/12(–Ř) 13:56:36.33
‚¸‚˘‚Ô‚ńawk‚Š‚ç—Ł‚ę‚Ä‚˘‚Ä‹v‚ľ‚Ô‚č‚ÉŽg‚Á‚˝‚ç
nawk‚É“ú–{Œę‚ĚƒoƒO‚Ş‚ ‚é‚ą‚Ć‚É‚ľ‚΂炭‹C‚Ă‚Š‚Č‚Š‚Á‚˝
substr()‚Ĺutf-8‚ĚƒeƒLƒXƒg‚đŘ‚čo‚ˇ‚Ć‚¨‚Š‚ľ‚Č’l‚É‚Č‚é
gawk‚Ĺ‚Í’ź‚Á‚Ä‚˘‚é

671ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/01/12(–Ř) 19:50:49.28
‚ť‚ŕ‚ť‚ŕUTF-8‚ɑΉž‚ľ‚Ä‚˝‚Á‚Ż

672ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/01/13(‹ŕ) 00:28:07.37
ttp://blog.livedoor.jp/corbie/archives/cat_94960.html
Žc”O‚Č‚Ş‚çAƒVƒtƒgJISAUTF-8—ź•ű‚Őłí‚É“Žě‚ľ‚ť‚¤‚ČWindows”Ĺgawk‚ÍŒó•â‚Ě’†‚É‚ ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B

673ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/01/13(‹ŕ) 07:52:50.95
Linux‚Ĺ‚Í•’Ę‚É“Ž‚­‚ށc

674ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/04/29(“ú) 21:07:39.93
ƒtƒ@ƒCƒ‹–ź‚Ş"*.txt"‚Ěˆę——‚đŽć“ž‚ˇ‚é‚Ć‚ŤA"\.txt"‚Ĺƒ}ƒbƒ`‚ł‚š‚é‚ƁA”CˆÓ‚Ěˆę•śŽš.(ƒhƒbƒg)‚ƉđŽß‚ł‚ę‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇ‚ށA‚˘‚˘•ű–@–ł‚˘‚Ĺ‚ľ‚傤‚ŠH

675ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/04/29(“ú) 22:04:14.36
GNU Awk 3.1.7‚ž‚Ćƒhƒbƒg‚Ƀ}ƒbƒ`‚ľ‚˝‚Ż‚Ç‚ť‚ŕ‚ť‚ŕawk‚Ě˜bH
‹ď‘Ě“I‚ɃRƒ}ƒ“ƒh‚Ş‚Ů‚ľ‚˘‚Č

676ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/04/29(“ú) 22:08:23.01
ş˜a‚̍ Šo‚Ś‚˝ƒAƒZƒ“ƒuƒ‰‚ĆCŒžŒę
‚ą‚ę‚Ş‚ ‚Á‚˝‚Š‚ç
‚˘‚Ü‚ž‚ÉŽŠ•Ş‚Ş‘š‚Č‹ĆŠE‚ŔтđH‚Á‚Ä‚é

677ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/04/29(“ú) 22:36:10.83
>>676
‚ť‚ą‚Š‚ç‚Š‚‚–‚‚ɍs‚Á‚ăXƒ}ƒzƒAƒvƒŠŠJ”­‚Č‚ç‚ŕ‚¤ˆę‰Ôç‚˘‚˝‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ë‚—

678ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/04/29(“ú) 23:09:38.43
”nŽ­‚É‚Í–ł—

6796742012/04/30(ŒŽ) 18:07:43.22
>>675
ls | awk '{ if( match($0,"\.txt") > 0) print $0 }'
Ş‰ďŽĐ‚ĚƒT[ƒoă‚Ĺ‚ą‚ń‚ČŠ´‚ś‚Ě‚ą‚Ć‚â‚낤‚Ć‚ľ‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށA
ugawk: Œx: ƒGƒXƒP[ƒvƒV[ƒPƒ“ƒX `\.' ‚Í `.' ‚Ć“Ż“™‚Ɉľ‚í‚ę‚Ü‚ˇv
‚ĆƒƒbƒZ[ƒW‚ޏo—Í‚ł‚ęAƒhƒbƒg‚Ş”CˆÓ‚Ěˆę•śŽšH‚ƉđŽß‚ł‚ę‚袂Á‚Ä‚˘‚Ü‚ľ‚˝‚ށA
ŽŠŒČ‰đŒˆ‚ľ‚Ü‚ľ‚˝B(ŽŠ‘î‚ĚLinuxPC‚Ĺ“ŽěŠm”F‚ľ‚Ü‚ľ‚˝BGAWK3.1.7‹y‚Ń4.0.1)
"\.txt"‚Ĺ‚Í–ł‚­‚āA".txt"‚Ĺ—Ç‚Š‚Á‚˝‚ń‚Ĺ‚ˇ‚ˁB
‚¨‘›‚Ş‚š‚ľ‚Ü‚ľ‚˝B

‚ŕ‚ľ‚Š‚ľ‚˝‚çA‰ďŽĐ‚ĚƒT[ƒo(RHEL)‚ĚGAWK‚ŞŒĂ‚­‚Ä‰đŒˆ‚Ĺ‚Ť‚Ä‚Č‚˘‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚ށB

680ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/04/30(ŒŽ) 20:27:16.48
>>679
match() ‚Ě‘ć“ńˆř”‚É•śŽš—ń‚đ—^‚Ś‚˝ę‡‚ÍŽ–‘O‚ɐł‹K•\Œť‚Ö‚ĚŒ^•ĎŠˇ‚ލs‚í‚ę‚é‚ŞA
‚ť‚ĚŰ‚ÉƒGƒXƒP[ƒv‚ŞŠO‚ę‚Ä /.txt/ ‚Ć“Ż“™‚É‚Č‚Á‚Ä‚ľ‚Ü‚¤A ‚Ć‚˘‚¤‚ą‚Ć‚Š‚ƁB
‚‚܂č "\\.txt" ‚Ć‚ˇ‚é‚ŠA ł‹K•\Œť‚Ě /\.txt/ ‚đ—^‚Ś‚ę‚΂悢B

The GNU Awk User's Guide ‚É‚ŕ‚ą‚ĚŒťŰ‚ɂ‚˘‚Ä‚Ěŕ–ž‚Í‚ ‚é‚ŞA
~ !~ ‰‰ŽZŽq‚ɂ‚˘‚Ä‚ľ‚ŠG‚ę‚ç‚ę‚Ä‚˘‚Č‚˘B
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_5.html#SEC32

681ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/05/24(–Ř) 00:27:31.74
gawk4.0.2•t‘Ž‚ĚŒ´”Ĺ‚Ĺ‚Ímatch‚Ěŕ–ž‚É‚ŕ‚ť‚̕ӐG‚ę‚ç‚ę‚Ä‚é‚ˁB
http://www.gnu.org/software/gawk/manual/html_node/String-Functions.html#String-Functions
’N‚Š‚ą‚Ěƒo[ƒWƒ‡ƒ““ú–{Œę‰ť‚ľ‚Ä‚Č‚˘‚Š‚ȁB

682ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/12(–Ř) 02:26:40.35
FIFO‚ČŠ´‚ś‚̐ć“ü‚ęćo‚ľ‚Ěƒoƒbƒtƒ@‚ɂ͉˝Žg‚Ś‚΂˘‚˘H
‚Ć‚˘‚¤‚ŠA
Array‚ŁA‚˝‚Ć‚Ś‚ÎA[3] ‚Š‚çA[8]‚Ü‚Ĺ‚Ěƒf[ƒ^‚đA[1]‚Š‚çA[6]‚É“Ž‚Š‚ˇ‚ɂ͉˝‚ވę”Ô‘‚˘H
‚Ĺ‚Ť‚ę‚Δz—ń‚Í‚P‚‚ľ‚ŠŽg‚˘‚˝‚­‚Č‚˘‚Ě‚ž‚ށA–ł—‚ž‚낤‚Šc

683ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/12(–Ř) 09:23:22.92
‘Ź‚ł‚đ‹‚ß‚é‚Č‚ç–ˆ“x‘S—v‘f‚¸‚炡‚ć‚čA“ǂݏo‚ľˆĘ’u‚Ə‘‚Ťž‚ÝˆĘ’u‚Ě“YŽšŽ‚Á‚Ä
ŠÇ—‚ľ‚˝•ű‚Ş‚˝‚˘‚Ä‚˘‘Ź‚˘

684ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/12(–Ř) 10:14:32.78
awk‚ɂ͘A‘z”z—ń‚ľ‚Š‚Č‚˘‚ľ‚Č

685ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/14(“y) 14:35:06.22
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ʼn˝‚Ć‚Š‚Č‚é‚Č‚çƒŠƒ“ƒOƒoƒbƒtƒ@‚Š‚Č

686ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/14(“y) 22:27:17.73
>>682
BEGIN{
@QMAX=3
@QTopPos=0;QTailPos=0;QNum=0;
@deQ();
@enQ("1");deQ();
@enQ("a");enQ("b");enQ("c");enQ("x");deQ();deQ();deQ();deQ();
}
function enQ(PushVal){
@if (QNum+1 > QMAX){print "‚¨‚Č‚Š‚˘‚Á‚Ď‚˘"; return;}
@nextPos = (QTopPos+1) % QMAX;
@queue[QTopPos] = PushVal;
@QTopPos=nextPosQNum++;
}
function deQ(){
@if (QNum < 1){print "‚Š‚ç‚Á‚Ű"; return}
@QNum--;@TailVal=queue[QTailPos]
@QTailPos = (QTailPos +1) % QMAX;
@print TailVal;
@return TailVal;
}

6876862012/07/14(“y) 22:54:06.64
Ş‚ĚŒ‹‰Ę‚Í‚ą‚ń‚ČŠ´‚śB
>‚Š‚ç‚Á‚Ű
>1
>‚¨‚Č‚Š‚˘‚Á‚Ď‚˘
>a
>b
>c
>‚Š‚ç‚Á‚Ű

>>685‚̏‘‚˘‚Ä‚˘‚郊ƒ“ƒOƒoƒbƒtƒ@ŽŔ‘•‚Ĺ‚ˇB
enqueue,dequeue‰ń”‚Ş‘˝‚˘‚Č‚çƒŠƒ“ƒOƒoƒbƒtƒ@‚Ĺ—Ç‚˘‚ĆŽv‚¤B
‘ĺ’ď‚Ěę‡‚ÍQMAX‚É‘ĺ‚Ť‚Č’l‚đÝ’股‚ę‚ÎŽ–‘Ť‚č‚éƒnƒY‚ž‚Ż‚Ç
ăŒŔ‚ŞŒˆ’č‚Ĺ‚Ť‚Č‚˘“™‚ĚŽ–î‚Ş‚ ‚ę‚Îdelete array‚đŽg‚Á‚˝’Pƒ‚Č”z—ńŠÇ—‚Š‚ȁB
‚˝‚ž“Y‚ŚŽš‚ސ”’lăŒŔ‚đ’´‚Ś‚Č‚˘—l‚ȍH•v‚Í•K—v‚ž‚ˁB

688ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/15(“ú) 21:09:36.15
ƒŠƒ“ƒO‚Ĺ‚ŕăŒŔ‚đ’č‚ß‚é‚Ć“ü—̓XƒgƒŠ[ƒ€‚̏ăŒŔ‚Ş•s–ž‚Čę‡‚Ü‚¸‚˘‚ą‚Ć‚É‚Č‚é‚̂ŁAŒťÝ‚Í
A=“ü—ÍArray,CˆęŽž•ŰŠÇ,i,k,n,p
  k=1;C[0]=0;
  for(i=1;i<=A[0];i++){n=0;while(k<i && A[k++]=C[n+=1]);if(n){
  delete C[C[0]+1];C[0]-=n;p=0;while(C[p+=1]=C[n+=1]);}p=1;
  while(match(substr(A[i],p),re)){p+=RSTART-1;n=substr(A[i],p,RLENGTH);
  if(k<i){A[k++]=n;}else{C[C[0]+=1]=n;};p+=RLENGTH;}};n=1;
  while(A[k++]=C[n]){delete C[n++];};A[0]+=C[0]-1;C[0]=0;
‚đŽg‚Á‚Ä‚˘‚éB
re=regexp‚Ć‚ľ‚āAArray A‚Ɉę’v‚ˇ‚éƒf[ƒ^‚Ş‚ ‚ę‚Ú‚ť‚ę‚đŽć“žAŒ‹‰Ę‚đArray A‚ɏo—́AA[0]‚ɍ‡Œv‚Ş‹LÚB

‚ą‚ęˆČăiƒR[ƒhƒTƒCƒYA‚ ‚é’ö“x‚Ě‘Ź“xAƒƒ‚ƒŠ‚ĚŽg—p—Ę‚đ‹É—͏­‚Č‚­j‚Ć‚˘‚¤đŒ‚ĹĹ“K‰ť‚Ĺ‚Ť‚é‚ž‚낤‚Šc
‚ž‚ę‚Š—Š‚ށB
“ü—Í‚Ćo—͐悪“Ż‚ś‚Ĺ‚ŕA•Ę‚Ĺ‚ŕě“Ž‚ˇ‚éƒR[ƒh‚Č‚çŽ‚Ě‚ą‚Ć—Ç‚˘‚Ě‚ž‚ށc

689ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/17(‰Î) 00:02:18.87
‚ą‚ę‚Í‚Đ‚Ç‚˘
ƒfƒoƒbƒO‚ŕŠg’Ł‚ŕ–ł—‚ś‚á‚Ë

690ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/17(‰Î) 22:03:00.62
Šî–{“I‚Ɉę“xě‚Á‚ÄŒă‚Í•K—v‚ɉž‚ś‚ăRƒsƒy‚ž‚Ş‚ç‚ȁB‘ź‚É‚Í
function grep( o, re, p, B, this, a ){
B[0]=0;if(o~"-v"){while((getline v < p)>0){if(!match(v,re))B[B[0]+=1]=v;}return B[0];};
if(o~"-o"){while((getline v < p)>0){a=v;while(match(a,re)){B[B[0]+=1]=substr(a,RSTART,RLENGTH);
a=substr(a,RSTART+RLENGTH);}};return B[0];};while((getline v < p)>0){if(match(v,re))B[B[0]+=1]=v;}return B[0];
}
‚Č‚ń‚Š‚ŕ—Ç‚­Žg‚¤Bgrep("-o","pattern","/var/log",data);‚Ý‚˝‚˘‚ČŠ´‚ś‚ŁB‘O‚Ě‚Íagrep("-v",pattern,B,C)‚Ěˆę•”•ŞB
“ú‚˛‚ë‚Ěƒƒ“ƒe‚Ĺ‚ż‚ĺ‚Á‚Ć‚ľ‚˝Žčě‹Ć‚ś‚á‚ß‚ń‚Ç‚˘‚Ě‘g‚Ţ‚Ć‚Ť‚ɁA‚قڐ”•Ş‚Ĺ‘g‚Ý‚ ‚Ş‚é‚Ě‚ŞŠy‚Č‚ń‚ž‚ćB
ƒTƒuƒvƒƒZƒX‚Ć‚ľ‚ÄgrepŒÄ‚яo‚ˇ‚Ě‚ŞƒRƒXƒg‚Š‚Š‚鎞‚Ć‚ŠAperl‚Ş”j‘š‚ľ‚˝ó‹ľ‚Ĺ‚ĚƒŠƒJƒoƒŠ[ƒXƒNƒŠƒvƒg‚Ć‚ľ‚Ä‘g‚ń‚ž‚Ě‚ŞŒł‚ž‚Ż‚ǁB
ƒJ[ƒlƒ‹‚ł‚Śś‚Ť‚Ä‚˘‚ę‚ÎŒă‚ÍawkƒoƒCƒiƒŠ—Ź‚ľž‚ß‚ÎŽg‚ŚAsh‚Ş”ź•ŞŽ€‚ń‚Ĺ‚˘‚Ä‚ŕ‚Č‚ń‚Ć‚Š“Ž‚­‚ľB

6916862012/07/21(“y) 23:12:03.74
>>688
BEGIN{
@QMAX=9007199254740991
@QTopPos=QTailPos=QNum=0;
@hitTop=0;
@A[++z]="hoge";
@A[++z]="1 2 3 4 5";
@A[++z]="fuga";
@A[0]=z;
@for(i=1;i<=A[0];i++){
@@p=1;
@@while(match(substr(A[i],p),/[0-9]+/)){
@@@p+=RSTART-1;
@@@enQ(substr(A[i],p,RLENGTH));
@@@p+=RLENGTH;
@@}
@@if(QNum>0){
@@@while(QNum && hitTop<i)A[++hitTop]=deQ();
@@}else{
@@@delete A[i];
@@}
@};
@if(QNum>0) while(QNum)A[++A[0]]=deQ();
@for(z=1;z<=A[0];z++)print "A[" z "]:" A[z];
}

6926862012/07/21(“y) 23:44:24.03
691‚Ě‘ą‚Ť
‚ż‚Ȃ݂ɁAA[1]`A[A[0]]‚đgrep‚ľ‚ÄŒ‹‰Ę‚ÍA[1]`A[?]‚É–ß‚ˇƒXƒNƒŠƒvƒg‚ˁB
•Ą”Œƒ}ƒbƒ`‚ˇ‚鎖‚Ş‚ ‚é‚Ě‚Ĺ–˘ˆ—s‚đă‘‚Ť‚ľ‚Č‚˘‚悤‚ɃLƒ…[Žg‚Á‚Ä‚éB
function enQ(PushVal){
@if (QNum+1 > QMAX){print "Queue Overflow"; exit;}
@nextPos = (QTopPos+1) % QMAX;
@QBody[QTopPos]=PushVal;
@QTopPos=nextPos
@QNum++;
}
function deQ(){
@if (QNum<1){print "Illigal dequeue"; exit;}
@QNum--;
@TailVal=QBody[QTailPos];
@delete QBody[QTailPos];
@QTailPos=(QTailPos +1) % QMAX;
@return TailVal;
}
ƒŠƒ“ƒOƒoƒbƒtƒ@‚̏ăŒŔ’´‚Ś‚˝‚çI—š‚ł‚š‚Ä‚é‚Ż‚Ç>>688‚ĚŽŔ‘•‚ŕăŒŔ’´‚Ś‚˝‚çƒoƒO‚é‚ľ‹–‚ľ‚āB
Œv‚Á‚Ä‚Č‚˘‚Ż‚ǃ‹[ƒv‚Ş‚Č‚˘•Ş‘‚˘”¤BƒR[ƒhƒTƒCƒY‚Í‚¨Ž@‚ľB
ƒƒ‚ƒŠ‚ÍA[]‚Ƀf[ƒ^•ř‚Ś‚Ă鎞“_‚ĹƒAƒEƒg‚ČŠ´‚ś‚ž‚Ż‚ÇA[]‚đ“K‹XÁ‚ˇ‚悤‚É‚ľ‚Ć‚˘‚˝B
o—͐ć‚đ•Ę‚É‚ľ‚˝‚˘‚Č‚çA[]‚ÉdeQ()‚š‚¸•Ę•Ď”‚É‚ˇ‚ę‚΂¨‚‹B
‚ą‚ę‚Ĺ—Ç‚˘H

6936882012/07/22(“ú) 09:36:17.43
>QMAX=9007199254740991
ƒƒƒ^www
‰´‚Ě‚ŕŠm‚Š‚Éwhile(C[p+=1]=C[n+=1]);‚Ě•”•Ş‚Ĺ•ŰŽ‚ľ‚Ä‚é‚Ě‚ˇ‚ׂďÁ”ď•Ş‚ž‚Żă‚ɈړŽ‚ł‚š‚Ä‚é‚Ě‚Ş–ł‘Ę‚Č‚Ě‚Ĺ
‚ť‚Ěƒ‹[ƒv‚Ş–ł‚˘•Ş‚ÍŠm‚Š‚É‘‚˘‚Í‚¸B

‚ ‚ƁA’p‚¸‚Š‚ľ‚Č‚Ş‚çq‚Ë‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‰´>>688‚ĚŽŔ‘•‚ŏăŒŔ’´‚Ś‚˝‚çƒoƒO‚é‚đkwsk
‚Č‚ń‚ŠŒŠ—Ž‚Ć‚ľ‚Ä‚˝‚Ě‚ŠĄX‚Č‚Ş‚çS”z‚É‚Č‚Á‚Ä‚Ť‚˝B
Ěě‚Á‚˝‚â‚‚Ȃń‚ŁAŒ‹\‚Č•p“xŽg‚Á‚Ä‚Ť‚˝‚Ě‚ž‚ލĄ‚Ü‚ĹƒoƒO‚É‹C‚Ă‚Š‚Č‚Š‚Á‚˝

‚ľ‚Š‚ľƒf[ƒ^‚đƒƒ‚ƒŠă‚É“WŠJ‚ˇ‚é‚Š‚ç‚Ç‚¤‚ľ‚Ä‚ŕăŒŔ‚ޏo‚Ä‚­‚é‚ȁc
awk‚Ĺ10GB‚Ž‚炢‚Ěˆľ‚¤Žž‚Ígetline‚Ĺ‚Č‚ń‚Ć‚Š‚Č‚é‚Ż‚ǁA‚â‚Í‚čƒƒ‚ƒŠƒ}ƒbƒv‚âƒ|ƒCƒ“ƒ^‚ŞŽg‚Ś‚˝‚ç•Ö—˜‚ž‚ć‚Č‚Ÿ
ƒpƒbƒ`ě‚Á‚˝‚çŽů—v‚ ‚é‚Š‚ȁH

694ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/07/22(“ú) 11:41:46.83
>>693
691A‚ż‚ĺ‚Á‚Ć’ůłB–ł‘Ę‚ÉƒLƒ…[Žg‚¤•ŞAŒłƒXƒNƒŠƒvƒg‚Š‚ç—ň‰ť‚ľ‚Ä‚˝B
> @@@p+=RSTART-1;
>-@@@enQ(substr(A[i],p,RLENGTH));
>+@@@if(hitTop+1<i){
>+@@@@A[++hitTop]=substr(A[i],p,RLENGTH)
>+@@@}else{
>+@@@@enQ(substr(A[i],p,RLENGTH));
>+@@@}
> @@@p+=RLENGTH;
‚ ‚ƁA—Ç‚­l‚Ś‚˝‚ço—͐ć‚đ•Ę‚É‚ˇ‚é‚Č‚çA‚ť‚ŕ‚ť‚ŕƒLƒ…[•s—vB

ƒoƒO‚Á‚Ä‚Ě‚Í687‚Ő”’lăŒŔ‰]X‚Ə‘‚˘‚˝‚Ć‚¨‚čA
hC[0]+=1h‚Şawk‚̐Ž”‚̐¸“xŒëˇ‚Č‚ľ‰‰ŽZ‰Â”\ăŒŔ‚đl—ś‚ľ‚Ä‚˘‚Č‚˘‚ž‚ŻB
‚Ç‚Ěawk‚ŕ‘˝•Ş‚ť‚¤‚ž‚ĆŽv‚¤‚Ż‚ǁAŽčŒł‚̊‹Ť‰ş‚Ĺ‚ĚŽŔsŒ‹‰ĘŤ
C:\>gawk --version
GNU Awk 3.1.7(windows special Nov 24 2009)
C:\>gawk "BEGIN{print 9007199254740990+1}" nul
9007199254740991
C:\>gawk "BEGIN{print 9007199254740991+1}" nul
9007199254740992
C:\>gawk "BEGIN{print 9007199254740992+1}" nul
9007199254740992

ŽŔŰ‚́ihdd‚⃁ƒ‚ƒŠ‚ސć‚ÉŽ€‚ʂ̂Łj
ˆęs‚Ĺ‚ą‚ę‚ž‚Żł‹K•\Œť‚Şhit‚ˇ‚鎖‚ÍŽ–ŽŔă–ł‚˘‚ľA
‰ź‚É”­ś‚ľ‚Ä‚ŕŒŸőŒ‹‰Ę‚ޒׂę‚é‚ž‚Ż‚ŁA‹C•t‚Š‚Č‚˘”¤B

6956882012/07/22(“ú) 13:39:49.16
>9007199254740992
—˜_ăA8192ƒyƒ^ƒoƒCƒg‚Ě“Ż‚śƒf[ƒ^[aaa...]‚Ĺregexp="."‚Ć‚ˇ‚ę‚΁A”­ś‚ˇ‚é‚ȁc
IEEE 754‚Ě52bit§ŒŔ‚ž‚Š‚çA‚ą‚ęˆČă‚Ě‚Ĺ‚Š‚˘”Žšˆľ‚¤‚Č‚çbig numbert‘Ήž‚Ěƒ‰ƒCƒuƒ‰ƒŠ‚Š,
"bc -q" |& ‚Ĺ“Ž‚Š‚ˇ‚ŠAxgawkAdnawk‚ ‚˝‚čŽg‚¤‚ׂŤ‚ž‚Č‚Ÿ

Ě’N‚Š‚Şbignum‚ĚawkƒXƒNƒŠƒvƒg‘‚˘‚Ä•ú—Ź‚ľ‚Ä‚˘‚˝Šo‚Ś‚Ş‚ ‚é‚Ě‚ž‚ށA
ƒOƒOƒb‚Ä‚ŕŒŠ‚‚Š‚ç‚ńBŽčŒł‚É‚ ‚é‚Ě‚Íƒrƒbƒg‰‰ŽZ‚Ě‚â‚‚ž‚Ż‚ž‚í
‚˘‚‚Š‚ť‚ę‚ž‚Ż‚Ěƒf[ƒ^‚đƒƒ‚ƒŠă‚É•ŰŽ‚Ĺ‚Ť‚éƒ}ƒVƒ“‚đˆľ‚Á‚Ä‚Ý‚˝‚˘‚ŕ‚Ě‚žc

696ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/03(‹ŕ) 02:35:23.75
awk‚Á‚Äabs‚Ć‚Šacos‚Č‚Ç‚ĚŠî–{“I‚ČŽZpŠÖ”‚Ş—pˆÓ‚ł‚ę‚Ä‚Č‚˘‚ń‚Ĺ‚ˇ‚Ë
ĄŒă‚ŕŽŔ‘•‚ł‚ę‚é‚ą‚Ć‚Í‚Č‚˘‚ń‚Ĺ‚ľ‚傤‚ŠH

ƒpƒCƒv‚ĹƒTƒNƒb‚Ƃ‚Ȃ˘‚Ĺƒƒ“ƒ‰ƒCƒ“‚ŏˆ—‚ˇ‚é‚Ě‚Éd•ó‚ľ‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށEEE
‘ă‚í‚č‚Ć‚Č‚é‚ƁA‰˝Žg‚¤‚Ě‚Ş‚ć‚ë‚ľ‚˘‚Ĺ‚ˇ‚ŠH
‚Ĺ‚Ť‚ę‚Îperl‚ÍŽg‚˘‚˝‚­‚Č‚˘‚Ĺ‚ˇi‚Ç‚¤‚ľ‚Ä‚ŕD‚Ť‚É‚Č‚ę‚Č‚˘

697ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/03(‹ŕ) 06:48:38.25
abs‚ÍŽŠ•Ş‚ŏ‘‚Ż‚΂˘‚˘‚ľAacos(x)‚Íatan2(x, ă(1.0 - x*x))‚Ə‘‚Ż‚é‚Š‚çA
‚Ç‚ż‚ç‚ŕŠî–{“I‚Ĺ‚Í‚Č‚˘‚Ć”ť’f‚ľ‚Ä‘g‚ݍž‚Ý‚ś‚á‚Č‚˘‚ń‚ž‚ĆŽv‚¤‚Ż‚ǁB

Python‚ŠRuby‚Ĺ‚˘‚˘‚ń‚ś‚á‚Č‚˘H@ƒƒ“ƒ‰ƒCƒi[Œü‚Ť‚Ĺ‚Í‚Č‚˘‚Ż‚ǁB

698ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/03(‹ŕ) 07:37:24.41
>>696
ƒ‰ƒCƒuƒ‰ƒŠ(?)‚đE‚Á‚Ä—ˆ‚Ä‚Í?

699ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/03(‹ŕ) 11:48:03.19
>>696
•K—v‚Ȋ֐”’l‚đŒvŽZ‚ˇ‚é‚ž‚Ż‚ĚƒvƒƒOƒ‰ƒ€‚đC‚ōě‚Á‚Ä‚¨‚˘‚˝‚ç?

700ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/03(‹ŕ) 20:21:59.43
Ě‚ť‚ę‚ĹƒxƒNƒgƒ‹‰‰ŽZ‚ľ‚Ä—V‚ń‚ž‚Č

701ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/04(“y) 09:23:47.83
Ruby‚Í‚ť‚ą‚ť‚ąƒƒ“ƒ‰ƒCƒi[‚ŕ‘‚Ż‚銴‚ś‚Ş‚ˇ‚éAawk‚âPerl‚Ů‚Ç‚ś‚á‚Č‚˘‚Ż‚Ç‚Ë
Python‚Í—ŹÎ‚ɃR[ƒh‹N‚ą‚ł‚Č‚˘‚Ɛh‚˘‚ą‚Ć‚Ş‘˝‚˘‚Ş

702ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/04(“y) 10:27:49.07
awk‚Ĺmatlab‚Ý‚˝‚˘‚ČƒxƒNƒgƒ‹‰‰ŽZ‚Ĺ‚Ť‚é‚悤‚É‚ľ‚Ä‚Ů‚ľ‚˘

703ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/04(“y) 16:48:36.10
awk‚ĹƒNƒ‰ƒX‚đŽg‚Ś‚é‚悤‚É‚ľ‚Ä‚Ů‚ľ‚˘

704ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/04(“y) 17:06:19.06
awk‚Ĺ‘S‚Ä‚Ě–‚–@­—‚đ‹~‚Á‚Ä‚Ů‚ľ‚˘

705ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/04(“y) 17:08:30.07
awk‚ł‚ń‚Í–‚—

706–{“c2012/08/05(“ú) 07:21:28.03
Awk++
http://awk.info/?doc/dsl/awkplusplus.html
OO in AWK++
The awk++ language provides object oriented programming for AWK that includes:
classes
class properties (persistent object variables)
methods
inheritance, including multiple inheritance

http://lawker.googlecode.com/svn/fridge/lib/bash/awk++/version21/awkpp21.zip

707ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/05(“ú) 09:56:26.63
ƒfƒoƒbƒO‘ĺ•Ď‰ß‚Ź‚ÄŽ€‚Ę‚é
$ cat witch.awkpp
class Witch {
var spell
method new() { spell = "mahalic mahalita" }
method perform() { print spell }
}
class Samantha : Witch {
method perform() { print "twitch" }
}
BEGIN {
# wife = Witch.new() ƒGƒ‰[—vˆös
wife = Samantha.new()
wife.perform()
}
$ gawk -f awkpp -r witch.awkpp
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ syntax error
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ •\Œť‚Ě char '?' ‚Í•sł‚Ĺ‚ˇB

708ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/22(…) 00:09:49.86
size: 656 byte, supports -o -v option. Array A and B can be the same (NEW)
function xagrep( o, re, A, B, this, a, i,k ){
k=0;B[0]=A[0];if(o~"-v"){for(i=1;i<=A[0];i++){if(!match(A[i],re)) B[k+=1]=A[i];}B[0]=k;return k};
if(o~"-o"){B[B[0]+1]=0;for(i=1;i<=A[0];i++){a=A[i];if(i==k){i=i-B[B[0]+1]+1;B[B[0]+1]=k;k=B[0]+2;
while(i<=B[B[0]+1]){B[i++]=B[k];delete B[k++];}i=B[B[0]+1];k=i;B[B[0]+1]=0;}while(match(a,re)){
if(i>k){B[k+=1]=substr(a,RSTART,RLENGTH);}else{B[B[0]+1+(B[B[0]+1]+=1)]=substr(a,RSTART,RLENGTH);
k++}a=substr(a,RSTART+RLENGTH)}}if(i<k){i=k-i;k=B[0]+1;B[0]=i+B[B[0]+1];while(i<B[0])B[i+=1]=B[k+=1];
while(i<k)delete B[i+=1];}return B[0]}for(i=1;i<=A[0];i++){if(match(A[i],re))B[k+=1]=A[i];}B[0]=k;return k;
}
‚ą‚ęˆČăí‚ę‚é‚Ć‚ą‚ë–ł‚˘‚Š‚ȁH@
‚‘Ź‰ť{ƒTƒCƒY—Dć‚ŁA•Ď”‚Í‚Ĺ‚Ť‚é‚ž‚ŻŽg‚¤”‚đ­‚Č‚­‚Ć‚ĚđŒ‚Ĺ

709ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/08/22(…) 09:51:11.01
>>708
‚ť‚Ě3‚Â‚ĚđŒ‚Ě—Dć“x‚Ş‚í‚Š‚ç‚ń‚ȁB

Œ‹\“Ż‚ś•”•ŞŽŽ‚Ş‚ ‚é‚̂ŕϐ”‚É“ü‚ę‚˝•ű‚Ş•Ď”‚Í‘‚Ś‚é‚Ż‚Ç’Z‚­‚Č‚é‚ľ
ę‡‚É‚ć‚Á‚Ä‚Í‘Ź“x‚ŕ‘Ź‚˘‚Ć‚Š‚ ‚č‚ť‚¤‚ž‚Ż‚Ç‚Ç‚¤‚Č‚ń?

—á‚Ś‚ÎB[0]‚Í“Á•Ę‚Č—p“r‚Á‚Ű‚˘‚Ż‚Çx‚Ć‚Š1•śŽš•Ď”‚É‚ľ‚Äreturn‚Ě’ź‘O‚É
‘‚Ť–ß‚ľ‚˝•ű‚Ş•śŽš”‚͉҂°‚éB

‚ ‚Ć×‚Š‚˘‚Şhoge+=1‚ć‚č++hoge‚Ě•ű‚Ş1•śŽš’Z‚˘‚Ć‚ŠA‚˘‚ç‚Č‚˘u;v‚Ş
Žc‚Á‚Ä‚é‚Ć‚Š‹l‚ß‚ŞŠĂ‚˘‚Ć‚ą‚ë‚Ş‚Ü‚ž‚ ‚é‚ˁB

710ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/09/30(“ú) 22:45:00.64
ˆČ‰ş‚̂悤‚Čƒf[ƒ^‚̏ˆ—‚ɂ‚˘‚ÄŽż–₢‚˘‚Ĺ‚ľ‚傤‚ŠB
$1‚ÉŒo‰ßŽžŠÔiŽžjA$2‚Ɂu‘Ź“xv‚Ş‚ ‚ę‚Î$3‚̐”’l‚Í‘Ź“x‚đA$2$3‚É
uup avudown av‚Č‚Ç‚Ć‚ ‚ę‚΂ť‚ĚŽž‚Ĺ‚Ěs“Ž‚đŽŚ‚ľ‚Ü‚ˇB

‚ą‚Ěƒf[ƒ^‚Š‚çupAdown‚̏ꏩ‚đ‹‚ß‚˝‚˘‚ĆŽv‚˘‚Ü‚ˇB
‚‚܂čA‰ş‚Ě—á‚ĹˆÚ“ŽŠJŽn‚Š‚ç‚Ě‹——Ł3‚Ĺup aA‹——Ł3.5‚Ĺup bA‚Ć‚˘‚¤‹ď‡‚Ĺ‚ˇB
Œo‰ßŽžŠÔ‚Ć‘Ź“x‚Š‚çęŠ‚đŒvŽZ‚ˇ‚é‚ž‚Ż‚Ĺ‚ˇ‚ށB‘Ź“x‚đ•ĎX‚ˇ‚éƒ^ƒCƒ~ƒ“ƒOE
‰ń”‚Í•s’čA‘Ź“xƒf[ƒ^‚ƍs“Žƒf[ƒ^‚Í‚Ć‚ŕ‚ÉŒo‰ßŽžŠÔ‡‚É‹L˜^‚ł‚ę‚Ä‚˘‚Ü‚ˇB
‘Ź“x•ĎX‚đ‚Ç‚¤ˆľ‚Ś‚΂˘‚˘‚Ě‚ŠA‚ż‚ĺ‚Á‚Ć“Ş‚Ş‰ń‚č‚Ü‚š‚ńB

---Œłƒf[ƒ^—á---
0 ‘Ź“x 10
50 ‘Ź“x 20
200 ‘Ź“x 25
30 up a
35 up b
40 down a
40 down b
50 up a
70 down a
200 up c
250 down c

---ˆ—Œă---
3 up a
3.5 up b
4 down a
4 down b
5 up a
6 down a
12.5 up c
14.5 down c

711ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/10/01(ŒŽ) 11:28:30.42
‹^–â‚đ’ńŽŚB
$1‚ޏí‚ÉŽž‚Ĺ$2‚Ş‘Ź“x‚Ě‚Ć‚Ť‚Ě$3‚Ş‘Ź“x‚Č‚çA
30 up a‚Ě‚Ć‚Ť‚É30 * 10‚Ĺ300 up a‚É‚Č‚é‚ń‚ś‚á‚Č‚˘‚ž‚낤‚ŠB
“Ż‚ś‚悤‚ɁA70 down a‚Ě‚Ć‚Ť‚É50 * 10 + (70 - 50) * 20‚Ĺ900 down a‚É‚Č‚é‚ń‚ś‚á‚Č‚˘‚ž‚낤‚ŠB

$3‚Ş‘Ź“x(’PˆĘŽžŠÔ“–‚˝‚č‚ĚˆÚ“Ž—Ę)‚Ĺ‚Í‚Č‚­’PˆĘˆÚ“Ž—Ę“–‚˝‚č‚̏Š—vŽžŠÔ‚Č‚Ě‚Ĺ‚ ‚ę‚΁A
30 up a‚Ĺ30 / 10 = 3A70 down a‚Ĺ50 / 10 + (70 - 50) / 20 = 6‚É‚Č‚é‚ń‚ž‚Ż‚ǂˁB

712ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/10/01(ŒŽ) 13:21:34.21
ŽŔ‘•‚ľ‚Ä‚Ý‚˝B‘Ź“x‚Ş“r’†‚ɏo‚Ä‚Ť‚Ä‚ŕ‚˘‚˘‚悤‚Épos‚đ–ˆ‰ńŒvŽZ‚ˇ‚é‚Š‚çŒř—ŚˆŤ‚˘‚Ż‚ǁB
--
BEGIN {
sCount = 0;
}
$2 == "speed" {
sTime[sCount] = $1;
sSpeed[sCount] = $3;
++sCount;
next;
}
{
pos = 0;
for (ic = 1; ic < sCount; ++ic) {
if (sTime[ic] > $1) break;
pos += (sTime[ic] - sTime[ic - 1]) / sSpeed[ic - 1];
}
pos += ($1 - sTime[ic - 1]) / sSpeed[ic - 1];
print pos, $2, $3;
}

713ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/10/01(ŒŽ) 20:30:33.48
>>711
‚ˇ‚Ý‚Ü‚š‚ńA‘OŽŇ‚Ĺ‚ˇ‚ˁB‚Č‚ń‚ž‚낤A’p‚¸‚Š‚ľ‚˘B

>>712
‚Ȃ̂ŁAƒAƒNƒVƒ‡ƒ“•”‚Ě / ‚đ * ‚É•Ď‚Ś‚ę‚΂悳‚ť‚¤‚Ĺ‚ˇB

‚¨“ń•űA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

714ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/12/13(–Ř) 11:40:43.98
awk‚É‚Š‚í‚é“Ż“™‚Ě‚ŕ‚Ě‚ ‚č‚Ü‚ˇH

715ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/12/13(–Ř) 13:08:08.26
python

716ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/12/13(–Ř) 13:13:55.85
>>715
awk‚Ý‚˝‚˘‚ÉŽg‚˘ŸŽč‚˘‚˘‚Ě‚Š‚ȁH

717ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/12/13(–Ř) 13:18:24.65
—Ç‚˘‚Ĺ‚ˇ‚ć

718ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/12/13(–Ř) 13:24:31.23
>>717
‚ ‚č‚Ş‚Ć‚ˇB•×‹­‚ľ‚Ä‚Ý‚Ü‚ˇ

719ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2012/12/13(–Ř) 14:45:25.45
‚Í‚˘

720ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/06(…) 03:49:18.86
g”CˆÓ‚Ě‹L†h‚đŠÜ‚ń‚žƒVƒFƒ‹•Ď”‚đawk‚É“n‚ˇ‚ą‚Ƃ͉”\‚Ĺ‚ˇ‚ŠH‚˝‚Ć‚Ś‚Î

[user@localhost ~]$ var='hoge'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge
hoge

‚ą‚ą‚ŁAvar‚É$‚đŠÜ‚Ü‚š‚é‚Ć

[user@localhost ~]$ var='hoge$fuga'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge$fuga

‚Ć‚¤‚Ü‚­ƒ}ƒbƒ`‚ľ‚Ü‚š‚ń‚Ĺ‚ľ‚˝BvarŽŠ‘Ě‚Í“n‚ł‚ę‚Ä‚˘‚é‚Í‚¸‚Ĺ‚ˇ‚ށA‰˝‚ŞŒ´ˆö‚Ĺ‚ľ‚傤‚ŠH

721ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/06(…) 11:23:41.42
>>720
‚˘‚ż‚Ź‚傤‚ß‚Ě‚Đ‚ž‚č‚Ş‚í‚Ě var ‚́A‚Ђ傤‚Š‚Ě‚ł‚˘‚É
‚š‚˘‚Ť‚Ђ傤‚°‚ń‚Ö‚Ě‚Š‚˝‚Ö‚ń‚Š‚ń‚Ş‚¨‚ą‚Č‚í‚ę‚éB

$0 ~ /hoge$fuga/ {print "hoge$fuga"}
END {print "hoge$fuga"}

‚ß‚˝‚ŕ‚ś‚Ć‚Č‚Á‚Ä‚ľ‚Ü‚¤‚ŕ‚̂́A‚ś‚ş‚ń‚ ‚邢‚Í‚ą[‚Ç‚Ě‚Č‚Š‚Ĺ
‚Ś‚ˇ‚Ż[‚Ő‚ˇ‚é‚Ђ‚悤‚Ş‚ ‚éB

722ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/06(…) 11:29:22.31
~(ƒ`ƒ‹ƒ_)‚̉E•Ó‚͐ł‹K•\Œť‚Ć‚ľ‚ĉđŽß‚ł‚ę‚é‚Š‚çA"hoge" ~ /hoge$fuga/ ‚Ĺƒ}ƒbƒ`‚ˇ‚é‚í‚Ż‚Ş‚Č‚˘B
‹t‚É”J‚ëA"hoge$fuga" ~ /hoge/ ‚Č‚çƒ}ƒbƒ`‚ˇ‚éB

723ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/06(…) 11:33:09.61
>>720
>721‚ŕ>722‚ŕ‚Ç‚ż‚ç‚ŕŒ´ˆöB‚â‚č‚˝‚˘‚ą‚Ć‚đ‚ć‚­Ž—‚ľ‚悤B

7247202013/02/06(…) 15:09:21.72
‚ˇ‚˘‚Ü‚š‚ńAecho "hoge"‚Ĺ‚Í‚Č‚­echo "$var"‚Ĺ‚ľ‚˝B
‚˝‚žAŒ‹‰Ę‚Í>>720‚Ć“Ż‚ś‚Ĺ‚ˇB

—v‚Í“ü—̓tƒ@ƒCƒ‹“ŕ‚́uƒƒ^•śŽšž‚Ý‚Ě”CˆÓ‚Ě•śŽš—ńv‚đA•Ę‚́uƒƒ^•śŽš‚Ɖüsž‚Ý‚Ě”CˆÓ‚Ě•śŽš—ńv‚Ĺ’uŠˇ‚ˇ‚éA
‚Ć‚˘‚¤‚Ě‚đƒƒ^•śŽš‚ĚƒGƒXƒP[ƒv“™‚Ě–Ę“|‚ȏˆ—‚đ‚š‚¸‚ɃTƒNƒb‚Ć‚â‚č‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚Ĺ‚Ť‚Ü‚ˇ‚ŠH

725ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/07(–Ř) 05:01:43.19
ŃŘ

—\‚߁uƒƒ^•śŽš‚ĆŒž‚Á‚Ä‚ŕ $ ‚ľ‚Šo‚Ä‚ą‚Č‚˘v‚Ć‚Š”ť‚Á‚Ä‚é‚Č‚ç‘ĺ‚ľ‚˝‚ą‚Ć–ł‚˘‚Ż‚Ç
ˆę”ʉť‚ˇ‚ę‚΂ˇ‚é‚Ů‚Ç–Ę“|‚É‚Č‚é

7267202013/02/07(–Ř) 22:14:56.21
>>725
‚â‚Í‚č‚ť‚¤‚Ĺ‚ˇ‚ŠB
Ą‚Ü‚Ĺ‚ą‚¤‚˘‚Á‚˝ˆ—‚Ísed‚Ĺ‚ľ‚ą‚ľ‚ąƒGƒXƒP[ƒv‚ľ‚Ä‚â‚Á‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށA‚˘‚˘‰ÁŒ¸–Ę“|‚É‚Č‚Á‚˝‚̂ŁA
‚˝‚Ć‚Ś‚Îfgrep‚Ý‚˝‚˘‚ɐł‹K•\Œť‚đƒIƒt‚É‚ľ‚ďˆ—‚ˇ‚é•ű–@‚Í‚Č‚˘‚Š‚Ć’T‚ľ‚Ä‚˘‚é‚ń‚Ĺ‚ˇ‚ށA
awk‚Ĺ‚Í–ł—‚Ĺ‚ˇ‚ŠEEEB

727ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/08(‹ŕ) 11:20:14.98
>>726
’P‚Ɉę’v‚Ȃ琳‹K•\Œť‚Č‚ń‚ŠŽg‚킸‚É”äŠr‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
fgrep‚ĹŽ–‚Ş‘Ť‚č‚é‚Ě‚Č‚çawk‚Š‚çfgrep‚đ‹N“Ž‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB

728ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/08(‹ŕ) 19:27:47.04
>>726
fgrep‚Č‚ç index()ŠÖ”‚ś‚á‚Č‚˘‚Ě?

7297202013/02/09(“y) 15:32:27.55
>>727
„’P‚Ɉę’v‚Ȃ琳‹K•\Œť‚Č‚ń‚ŠŽg‚킸‚É”äŠr‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
ˆÓ–Ą‚Ş•Ş‚Š‚ç‚Č‚˘‚ń‚Ĺ‚ˇ‚ށAawkă‚Ě˜b‚Ĺ‚ˇ‚ć‚ˁH

>>728
index()‚Ěˆř”‚Í•śŽš—ń‚ž‚Š‚çA‚ą‚ę‚đ‚¤‚Ü‚­Žg‚Ś‚ΖړI‚̏ˆ—‚Ş‚Ĺ‚Ť‚éEEE‚Ě‚Š‚ȁH

‚Ĺ‚ŕ‚Č‚ń‚Šawk‚Ĺ‚˛‚ż‚傲‚ż‚ĺ‚â‚é‚ć‚čAƒƒ^•śŽš‚đƒGƒXƒP[ƒv‚ˇ‚é‘Oˆ—‚đ‚Š‚Ü‚ˇ‚Č‚č
‰˝‚Č‚č‚ľ‚˝‚Ů‚¤‚Ş‘f’ź‚Č‹C‚Ş‚ľ‚Ä‚Ť‚˝EEEB‚˝‚Ć‚Ś‚΂ą‚ń‚ČŠ´‚ś‚Ĺ

$ var='hoge$fuga'
$ var2=$( echo "$var" | sed 's/\$/\\\\$/g' )@ŠƒGƒXƒP[ƒvˆ—
$ echo "$var" | awk -v var="$var2" '
$0 ~ var {print var}
END {print var}
'
hoge\$fuga
hoge\$fuga

730ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/09(“y) 17:49:52.25
/bin/sh‚Ĺ‚˛‚ż‚傲‚ż‚ĺ‚â‚é‚Ě‚ŞD‚Ý‚Č‚çAawk‚ŕfgrep‚ŕŽg‚킸Acase•ś‚Ĺ‚â‚č‚Ⴂ‚˘‚ń‚ś‚á‚Č‚˘‚́B

731ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/09(“y) 21:34:09.39
>>729
•śŽš—ń‚Ě”äŠr‚Í“™†‚Ĺ‚Ĺ‚Ť‚é‚Á‚Ä”FŽŻ‚Í‚Č‚˘‚Ě?

732ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/10(“ú) 14:31:49.57
>729
‚˘‚âA‚ť‚Ě•ű–@‚Ĺ‚ŕŒ‹‹Ç ' ‚̓GƒXƒP[ƒv‚Ş•K—v‚Ĺ‚ľ‚ĺB
ƒ_ƒCƒŒƒNƒg‚ɃVƒFƒ‹•Ď”‚É“ü‚ę‚é•ű–@‚ŠA
ƒtƒ@ƒCƒ‹‚Č‚Ç‚É“f‚Ťo‚ľ‚Ä‚¨‚­•ű–@‚Ě•ű‚ވŔ’čB
‚Ü‚Ÿ‚ť‚ę‚Ĺ‚ŕ‰üs‚Ć‚Š§Œä•śŽš“ü‚ę‚ç‚ę‚é‚Ć‚ŕ‚É‚ĺ‚éę‡‚Ş‚ ‚é‚Ż‚ǂȁB

733ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/11(ŒŽ) 20:15:01.17
‚ť‚ą‚Ü‚Ĺ‚ß‚ń‚Ç‚­‚ł‚­‚Č‚Á‚˝‚çperl‚Ć‚Šruby‚Ć‚ŠŽg‚Á‚˝•ű‚ŞŠy‚ž‚źw

734ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/11(ŒŽ) 22:46:25.57
‰˝‚Ĺ gawk -f ‚Ć‚ŠŽg‚킸ƒƒ“ƒ‰ƒCƒi[‚ɍS‚é‚Ě‚Š‚Ë‚Ľ

735ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/02/12(‰Î) 22:00:38.07
>>732
’†ŠŘƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚ÍîŽă‚ĚŽdŽ–iƒhƒ„Šç
>>734
ƒƒ“ƒ‰ƒCƒi[ƒfƒBƒX‚Á‚Ä‚ń‚́H

736ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/03/11(ŒŽ) 10:05:12.56
#
# text converter ( Mac to MS-DOS on Windos/MS-DOS machine)
# convert CR to CR+LF
#
BEGIN{ RS = "\r" }
{ print }

737ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/03/15(‹ŕ) 08:05:25.28
#
# Line(s”)‚𐔂Ś‚é
#

END { FNR }

738ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/03/20(…) 19:07:17.00
# text to html converter
# usage: awk -f txt2htm.awk infile1.txt > outfile2.html

BEGIN{
print("<html>"); print("<head>")
print("<titile> My favorite URLs </titile>")
print("</head>"); print("<h1> </h1>"); print("<body>");
}

/^[:space:]*http/ { print "<A HREF=\""$1"\">"$1"</A><BR>"}

END{
print("</body>")
print("</html>")
}

739UNIX(LF) to DOS(CR+LF) conversion2013/03/21(–Ř) 21:15:00.86
awk 1 infile1 > outfile2.txt

740ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/03/21(–Ř) 22:10:08.07
# awk -f add.awk
BEGIN {
  s1 = "323524855"
  s2 = "4972560"

  reverse(a2, s2)
  size = reverse(a1, s1) # s1 > s2
  carry = 0

  for(k = 1; k <= size; k++) { # s1 > s2
    d = a1[k] + a2[k] + carry
    if(d >= 10) {
      e[k] = d - 10
      carry = 1
    } else {
      e[k] = d
      carry = 0
    }
  }

  if(carry == 1) {
    e[k] = 1
    size = k
  }

  g = produce_string(e, size)
  printf("%s + %s = %s\n", s1, s2, g)
  printf("%f\n", s1 + s2)
  exit
}

741ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/03/21(–Ř) 22:11:11.39
# >>740‚̂‚ÂŤ
function reverse(a, s, k, i) {
  k = 1;
  size = length(s)
  for(i = size; i >= 1; i--) {
    a[k++] = substr(s, i, 1)
  }

  return size
}
function produce_string(a, size, i) {
  g = ""
  for(i = size; i >= 1; i--) {
    g = g a[i]
  }

  return g
}

742ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/03/21(–Ř) 22:12:57.08
function produce_string(a, size, g, i) {

743grep‚đawk‚Ĺ2013/03/22(‹ŕ) 13:32:02.74
# usage: awk -f grep.awk char1 file1 file2

BEGIN{
pattern = ARGV[1]
ARGV[1] = ""
}
$0 ~ pattern {print($0" File name=" FILENAME)}

744ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/11/30(“y) 12:16:25.95
$ echo 10 20 30 | awk '{for(i=0;i<4;)print _$++i}'
10
20
30

_$++i‚Ĺ‚ŕ$++i‚Ĺ‚ŕ‚Ç‚ż‚ç‚Ĺ‚ŕ‚˘‚Ż‚é‚Ě‚Ĺ‚ˇ‚ށAƒAƒ“ƒ_[ƒXƒRƒA‚Ş•t‚˘‚ĉ˝ŒĚ‘ĺä•v‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH

745ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/11/30(“y) 16:04:55.55
‚ˇ‚˘‚Ü‚š‚ńA‚í‚Š‚č‚Ü‚ľ‚˝
‹ó‚̕ϐ”_‚Ć$++i‚ĚŒ‹‰Ę‚Şˆę‚É‚Č‚Á‚Ä‚˝‚ž‚Ż‚Č‚ń‚Ĺ‚ˇ‚Ë

746ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2013/11/30(“y) 20:37:58.81
’P‚ÉŽŽ‚đ•Ŕ‚ׂé‚Ć•śŽš—ń˜AŒ‹‚É‚Č‚éA‚Ě㩂Š

747ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/02(…) 00:10:13.15ID:T3/5Epfc
•ŰŽç

‚Ä‚Š”ź”N‹ß‚­‘‚Ťž‚Ý‚Ş–ł‚Š‚Á‚˝‚Š

748ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/14(ŒŽ) 22:41:42.89ID:5r697USd
4.1.1‚Á‚Ä‚ŕ‚¤ƒŠƒŠ[ƒX‚ł‚ę‚˝‚́H

749ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/19(“y) 13:45:38.45ID:Db2IzPol
‚Ć‚ ‚égawkƒXƒNƒŠƒvƒg‚̐擪‚Ĺ
{last_hoge=hoge; hoge=$ 3}
‚Á‚Ä‚â‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁA
hoge=$ 3‚Íhoge=$3‚ĚŠÔˆá‚˘? ‚ť‚ę‚Ć‚ŕ‚ą‚¤‚˘‚¤‹L–@‚Ş‚ ‚é?

750ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/19(“y) 14:56:08.53ID:A73fEYrr
>>749
$ ‚͉‰ŽZŽq‚ž‚Š‚çAa=b+1‚đa = b + 1‚Ə‘‚­‚悤‚Č‚ŕ‚Ě‚Š‚ȁB

751ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/19(“y) 21:10:32.64ID:Db2IzPol
‚Ś‚Ś[ ‰‰ŽZŽq‚ž‚Á‚˝‚Ě‚Š‚ BŐŒ‚‚ĚŽ–ŽŔ

752ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/20(“ú) 12:36:45.70ID:SQaIR8ej
‰‰ŽZŽq‚ž‚Š‚çA•Ď”‚Ĺ‚ŕ‚˘‚˘‚ćB

753ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/20(“ú) 14:34:12.09ID:YSeiuWKu
ŽŽ‚ޏ‘‚Ż‚é‚ˁB
$ ‚͈ę”Ô—Dć‡ˆĘ‚ލ‚‚˘‚Š‚çA‚Š‚Á‚ą‚ĹŠ‡‚ç‚ɂႢ‚Š‚ń‚ށB

754ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/04/20(“ú) 15:12:13.25ID:k3tDznaJ
Ą‚Í‚ś‚ß‚Ä’m‚Á‚˝Bhaskell‚Ě$‚͉‰ŽZŽq‚ž‚Á‚Ä’m‚Á‚Ä‚˝‚Ż‚ǁAawk‚Ĺ‚ŕ‰‰ŽZŽq‚ž‚Á‚˝‚ń‚ž‚ˁB

755ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/10/14(‰Î) 13:37:28.35ID:cBz5RbAX
‚ť‚ľ‚Ä”ź”N‹ß‚­‘‚Ťž‚Ý‚Ş–ł‚Š‚Á‚˝

756ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/10/15(…) 03:28:03.90ID:SS4U/DMU
‚˘‚âawkƒXƒŒ‚Č‚ń‚Ä•’i‚Í‚ť‚ń‚Č‚É˜b‘č‚Č‚˘‚ž‚ë

757ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/10/21(‰Î) 15:46:10.36ID:TQsAGJgk
Žż–â‚ł‚š‚Ä‚­‚ž‚ł‚˘

ĄƒfƒBƒŒƒNƒgƒŠ“ŕ‚Ěƒtƒ@ƒCƒ‹‚Ě–źĚ‚ĆƒTƒCƒY‚ĚƒŠƒXƒg‚đě‚č‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇ
ƒRƒ}ƒ“ƒh‚Ć‚ľ‚Ä‚Íls -l‚đŽŔs‚ľ‚Ä‚˘‚Ü‚ˇ‚Ş‚ą‚ę‚đ‚ł‚ç‚Éawk‚ɃpƒCƒv‚ľ‚Ä‚˘‚Ü‚ˇ
‚˝‚ž‚ľƒtƒ@ƒCƒ‹–ź‚ɃXƒy[ƒX‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚˝‚ßˆČ‰ş‚̂悤‚Č‹ę“÷‚̍ô‚đ‚Ć‚Á‚Ä‚¨‚č‚Ü‚ˇ‚Ş

ls -l | awk '{print $5 "\t" $9$10$11$12$13$14$15$16$17$18$19}'

10ŒÂˆČă‚Ĺ‹ćŘ‚ç‚ę‚Ä‚é‰Â”\Ť‚ŕ‚ ‚é‚˝‚ߍޖ{“I‚ȑΉž‚đ‚ľ‚˝‚˘‚ƍl‚Ś‚Ä‚˘‚Ü‚ˇ‚Ş
‚悢ˆÄ‚Í‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š

758ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/10/21(‰Î) 17:25:55.68ID:EsuQiv22
# ƒtƒ@ƒCƒ‹–ź‚Ɂu"v‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚˝‚ç’m‚ç‚ˁB
ls -Ql |awk '{split($0, foo, "\x22"); print $5 "\t" foo[2]}'

759ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/10/21(‰Î) 23:41:50.65ID:stXOK2Vv
QƒIƒvƒVƒ‡ƒ“‚͕׋­‚É‚Č‚Á‚˝
ls -l|awk '{s=$5;for(i=1;i<9;i++)$i="";print s"\t"$0}'

760–ź–ł‚ľ‚ł‚ń—‚ť‚¤‚ž‘I‹“‚ɍs‚ą‚¤2014/12/13(“y) 17:07:55.12ID:8LbgKkKk
034@@‚́@h@i”źŠpj
035@@‚́@”@i”źŠpj@@@@@@@‚Ĺ‚¨‚‹‚Ĺ‚ˇ‚ŠH

761–ź–ł‚ľ‚ł‚ń—‚ť‚¤‚ž‘I‹“‚ɍs‚ą‚¤2014/12/13(“y) 18:17:16.35ID:FQOeA8KF
>>760
‚˘‚˘‚Śˆá‚˘‚Ü‚ˇB

762ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2014/12/14(“ú) 00:00:31.34ID:7YfznIJB
‚Ç‚ż‚ç‚ŕ”ń‰Â“Ç•śŽš‚Ĺ‚ˇ‚ˁB‚ť‚ľ‚Ä‚ť‚¤‚Č‚é‚ĆƒXƒŒˆá‚˘B
awk‚Ć—‚Ţ‚Ě‚Č‚ç‹ď‘Ě“I‚É‚Ç‚¤‚źB

763ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/02/03(‰Î) 10:36:52.13ID:Dvc0nyMp
Terastation‚Ěƒtƒ@ƒCƒ‹Eƒzƒ‹ƒ_–ź‚ÉŽg‚¤‚Ćƒtƒ@ƒCƒ‹ƒŒƒvƒŠƒP[ƒVƒ‡ƒ“‚ĹƒGƒ‰[‚Ş‹N‚ą‚é•śŽš‚Ş‚ ‚Á‚āA‚ť‚ę‚đ•ĎŠˇ‚ˇ‚éƒoƒbƒ`‚𐜐Ź‚ˇ‚鎞‚É‚ą‚Ěƒ}ƒCƒi[ŒžŒę‚Ş‘ĺŠˆ–ô‚ľ‚˝B
–ń80–œŒ‚Ěƒtƒ@ƒCƒ‹ƒzƒ‹ƒ_–ź‚Š‚ç’Šo‚ˇ‚é‚Ě‚É10•Ş’ö“x‚ž‚Á‚˝B

764ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/05/26(‰Î) 00:18:03.33ID:Y5HiR/XE
Gawk4.1.2‚ޏo‚˝‚Č‚ A‚ĆŽv‚Á‚Ä‚˝‚炡‚Ž4.1.3‚ޏo‚˝B
‘fl‚É‚Íˆá‚˘‚Ş‚ ‚Ü‚č•Ş‚Š‚ç‚ń‚Ě‚ž‚ށB

765ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/05/31(“ú) 09:20:55.82ID:PB6Yeih1
http://www.amazon.co.jp/AWKŽŔ‘H“ü–ĺ-Software-Design-plus-’†“‡/dp/477417369X

V‚ľ‚˘–{Ao‚˝‚ń‚ž‚Č
”p‚ę‚Č‚˘‚Ě‚ŞŚ‚˘

766ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/06/03(…) 20:45:34.22ID:vBAc8MUN
>>765
”ƒ‚Á‚Ä‚Ť‚˝B‚Ü‚žĹ‰‚Ě•ű‚ĆĹŒă‚Ě•ű‚đ’­‚ß‚˝‚ž‚Ż‚ž‚Ż‚ǁB

ƒy[ƒWiviu‚Í‚ś‚߂Ɂvj‚Ĺawk‚Ě•\‹L‚ɂ‚˘‚āu–{‘“ŕ‚ł́A‚˘‚¸‚ę‚Ě
ę‡‚ŕ‚ˇ‚ׂśŽš‚Ěawk‚Ć‚˘‚¤•\Œť‚É“ˆę‚ľ‚Ä‚¨‚č‚Ü‚ˇv‚Ć
‚ ‚é‚̂ɁA‘–ź‚ŞAWKB

ŠŞ––‚ĚƒŠƒtƒ@ƒŒƒ“ƒX‚Ĺ‹C‚É‚Č‚Á‚˝‚Ć‚ą‚ëB
‰‰ŽZŽq‚Ě—Dć‡ˆĘ‚ɐG‚ę‚Ä‚˘‚Č‚˘AƒtƒB[ƒ‹ƒh‰‰ŽZŽq‚Ş
u“Á•Ę‚ČˆÓ–Ą‚đŽ‚Â‚Č•Ď”v‚Ě’†‚É“ü‚ę‚ç‚ę‚Ä‚˘‚éB

ŽQl‘‚â•śŒŁ‚Ş‚Č‚˘‚Ż‚ǁAĄŽž‚́uƒlƒbƒg‚ĹƒOƒO‚ęv‚Š‚ȁB

767ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/07/06(ŒŽ) 22:02:56.12ID:Wnwr3Nh9
Mono: Playback -9707 [5%] [-97.07dB] [on]
ă‚̍s‚Š‚çƒp[ƒZƒ“ƒg‚đœ‚˘‚˝”Žšiă‚Ě—á‚ž‚Ć5j‚đŽć“ž‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚Ě‚ć‚¤‚É‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
ƒp[ƒZƒ“ƒg‚Ě’l‚Í0‚Š‚ç100‚̐Ž”‚ž‚ĆŽv‚˘‚Ü‚ˇ

768ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/07/07(‰Î) 15:47:02.78ID:NFKuqu84
# $0 ‚É“ü‚Á‚Ä‚˘‚é‚Ć‚ľ‚Ä
sub(/%.*/, "");
sub(/.*[^0-9]/, "");

769ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/07/08(…) 11:55:27.32ID:rptAPQZX
awk -F"[%[]" '{print $2}'
‚Ĺ‚Í‚Ü‚¸‚˘?

770ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/07/08(…) 18:52:19.39ID:GgkVcZ7j
>>768,769
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝
‚Ç‚ż‚ç‚Ĺ‚ŕŠó–]‚ĚŒ‹‰Ę‚đ‹‚ß‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚ľ‚˝

771ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/07/10(‹ŕ) 10:45:11.15ID:VcZTZ3UB
ƒeƒ“ƒvƒŒ‚Ĺ‚ ‚锤‚Ě1‚Ş“Ç‚ß‚Č‚˘‚ń‚ž‚ށA‚ą‚ĚƒXƒŒ“I‚É‚ÍPOSIX‚ŏ‘‚­‚Ě‚Ş
ł“H•’i‚ÍGawk‚ľ‚ŠŽg‚í‚Č‚˘‚Ě‚Ĺˆę‰žŠm”FB

772ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2015/10/10(“y) 22:36:33.12ID:1AEUTcmG
awk ‚Ě a ‚́Aaho ‚Ě a

‚˝‚ž‚ľAƒGƒCƒz‚Ć“Ç‚Ţ‚ç‚ľ‚˘
‚Ö‚Ľ[[[[[

773ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/12(‹ŕ) 17:12:05.45ID:VH2jVHwT
awkŽg‚Á‚Ä‚éƒVƒFƒ‹ƒXƒNƒŠƒvƒgŒŠ‚é‚Ć“Ś‚°‚Ä‚é‚Č‚ ‚ĆŽv‚¤

774ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/18(–Ř) 00:13:16.92ID:E3KgV2Kz
•’Ę‚Í x[3]=5 ‚Ə‘‚­‚ށA=‚Č‚ľ‚Ě
x[3]
‚ž‚Ż‚Ĺ‚ŕƒGƒ‰[‚ƂȂ炸Ax ‚đ”z—ń‚Ć‚ľ‚ÄŠm•Ű‚ľAlength(x)=1 ‚É‚Č‚é‚Ě‚đ”­ŒŠ
‚Ü‚ A‚ ‚Ü‚č•K—v‚Č‚˘‚Ż‚Ç

775ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/18(–Ř) 23:58:18.64ID:kHIvdCfG
‚Ü‚ Agawk‚Ěƒ}ƒjƒ…ƒAƒ‹‚Ĺ‚ŕ‘ă“ü‚Ě‘O‚ÉŽQĆ‚ޏo‚Ä‚­‚é‚ľ

776ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/20(“y) 00:57:58.12ID:OTE8dQpJ
‚ť‚¤‚Ĺ‚ľ‚˝‚ŠAV”­ŒŠ‚Ĺ‚Č‚Š‚Á‚˝

777ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/20(“y) 15:01:09.40ID:91Q+YYwH
‘ă“ü‘O‚É‚¤‚Á‚Š‚čŽQĆ‚ľ‚Ä‚ľ‚Ü‚¤‚Ě‚Í‹H‚É—Ç‚­‚ ‚éB

778ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/28(“ú) 01:02:06.47ID:Atbyv4Wk
IGNORECASE=1
‚đBEGIN ‚Ě‘O‚É’u‚˘‚Ä‚ŕƒGƒ‰[‚ɂȂ炸A•s‰Â‰đ“Žě
ƒZƒLƒ…ƒŠƒeƒB“I‚É‚â‚΂­‚Č‚˘‚Ě

779ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/02/28(“ú) 02:01:41.85ID:2mMmSiU+
>>778
BEGIN ƒZƒNƒVƒ‡ƒ“‚đć“ނɏ‘‚Ż‚Ƃ͉˝ˆ‚É‚ŕ‘‚˘‚Ä‚Č‚˘B

BEGIN ‚đĹŒă‚ɏ‘‚˘‚Ä‚ŕ END ‚đĹ‰‚ɏ‘‚˘‚Ä‚ŕ–â‘č‚Í–ł‚˘B
‰˝ˆ‚ɏ‘‚˘‚Ä‚ŕAŽŔŰ‚ɂ͐擪s“ǂݍž‚Ý‘OAŠes“ǂݍž‚ÝŽžAĹIs“ǂݍž‚ÝŒă‚É‚ť‚ę‚ź‚ę
ƒpƒ^[ƒ“ƒ}ƒbƒ`‚ލs‚í‚ę‚Ä‚˘‚éB
‚˝‚žƒ}ƒbƒ`‚ˇ‚éđŒ‚Ş“ÁŽę‚ž‚Š‚çAć“Ş‚ŠĹŒă‚Ĺ‚ľ‚Š’†‚Ě•ś‚ŞŽŔs‚ł‚ę‚Č‚˘‚ž‚ŻB

780ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/03/29(‰Î) 09:03:58.15ID:/c8bAcK4
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’ö‚Ő‚ ‚˝‚ńi‚ľ‚ă‚Á‚ż‚傤‚Ü‚˘‚­‚ë‹łˆç’ˇŒđ‘ăjt•śŽˇs40‘㔄ăˇŠzƒVƒ…ƒK[ƒ`ƒ‡ƒR
https://www.youtube.com/watch?v=NDq1QoJY0nY‰Fƒhƒiƒ‹ƒhƒAƒiƒŠƒXƒgƒpƒ[ƒXƒg[ƒ“ƒR[ƒ`ƒ“ƒO‚Ć‚ľ‚Ü‚Ś‚ń
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’öŒĂ–{‰Ž‚ć‚ľ‚˝‚Ż‚ľ‚ă‚Á‚ż‚傤‚ż‚ĺ‚ą‚ľ‚ă‚Ş[
ƒfƒB[ƒ‰[Ĺ–ą“VËŠJ”­ŽŇŽ€–S‹l‚݃ˆƒ~ƒhƒNƒ^[ƒ}ƒCƒNƒƒT[ƒrƒX•s‘Ť
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’ö‚Ő‚ ‚˝‚ńƒVƒtƒgŒő‹ŕ‚ł‚Š‚˘‹­§ƒoƒCƒglŒ NŠQ–â‘č
t•ŞŽ‘ŒšŽˇsƒjƒ…[ƒˆ[ƒN’ጴ‰ż‚Ú‚Á‚˝ƒXƒe[ƒLƒ\ƒ‹ƒgƒŒƒCƒN•Ÿ‰Ş‰Ą•lV‹´“z—ę‰Ű‹ŕƒpƒ`ƒVƒtƒg‹­§ƒoƒCƒg–â‘čVŠƒ•ÄƒZƒ“ƒ^[śŽc
ƒRƒXƒ‚Q‚Sƒ`ƒƒƒŠƒeƒB[‰B‚ę40‘㐜Šˆ•ŰŒěƒvƒŒƒCƒ{[ƒCƒoƒCƒgƒŒ[ƒh‚˘‚˝‚č‚ ‚ńÚ‘Ň–â‘č
ƒ}ƒXƒRƒ~KARDƒ[ƒ“ƒP[ƒI[ƒT[ƒrƒX•s‘ŤĽŠˆƒp[ƒeƒB[Šń•t‹ŕŽˇsŒ´”­ƒrƒWƒlƒX
FBIƒ`ƒƒƒCƒj[ƒYƒ^ƒCƒzƒeƒ‹”„ăŽ––ąŠƒKƒ`ƒƒŒˆŽZƒKƒ`ƒƒƒLƒƒƒ“ƒy[ƒ“i”Ě”„•ń“šw‰ßŒƒ”h‘gDŒüŒg‘эŐVî•ń’ń‹ŸI—š
Z’ˇ”­Œž×S’ˆÓƒm[ƒgƒ“ŽY”pƒGƒ‰[(’˜ěŒ ƒNƒŒ[ƒ€’†‘”˝‰ž—ZŽ‘‚Šz‹łˆç”ď)(’†‘•ßŒ~’c‘Ě40‘ăŽĐˆőƒTƒbƒJ[ƒRƒƒ“ƒg
‚Šz“üŠw‹ŕƒ„ƒtƒEV‹´‘ĺŠwƒ„ƒtƒEV‹´—Ž–’ˇFXŒo”ď ‚¨‚ś‚â50‘㎑ŽYƒKƒŠƒoƒYƒtƒB[ƒh40‘ăƒGƒŠ[ƒg

781awk–˝2016/05/10(‰Î) 10:11:56.15ID:qP72K9YB
mawk32.exe‚Łumultibyte charv‚ĚƒƒbƒZ[ƒW‚Ş‚Ĺ‚Ä˘‚Á‚Ä‚Ü‚ˇA‰˝‚ŞŒ´ˆö‚Ĺ‚ľ‚傤?
—}Ž~‚ˇ‚é•ű–@‚Í‚ ‚č‚Ü‚ˇ‚Š?
multibyteŽw’č‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒIƒvƒVƒ‡ƒ“‚Í–ł‚˘‚悤‚Č‚Ě‚Ĺ‚ˇ‚Ş?

782ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/10(‰Î) 13:22:33.71ID:pT7b4QGj
UTF-8 ‚ŞŽg‚Ś‚Č‚˘‚Ě‚Š‚ŕ

umawk multibyte charv‚ĹŒŸőI

783awk–˝2016/05/11(…) 00:10:08.64ID:EkexSAUH
„‚V‚W‚Q

ƒf[ƒ^‚ŕƒvƒƒOƒ‰ƒ€‚ŕ‚r‚i‚h‚r‚Ĺ‚ˇB
‰˝‚É”˝‰ž‚ľ‚Ä multibyte char‚ޏo‘ą‚Ż‚é‚Ě‚Š•s–ž‚Ĺ‚ˇB
‚‡‚‚—‚‹‚‘Ź‚Č‚Ě‚Ĺ–ž‘Ť‚Č‚Ě‚Ĺ‚ˇ‚ށA‚r‚s‚c‚d‚q‚q‚É multibyte char‚Ş‚Ĺ‘ą‚Ż‚é‚Ě‚Ĺ‚¤‚´‚˘‚ľA‚ą‚̏o—Í‚Ô‚ń‚ž‚Ż‘Ź“x‚ŕ’ቺH

784ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/11(…) 00:13:30.76ID:Qn6YFszJ
“ü—Í‚ÉSJIS‚Ĺ‚Č‚˘•śŽš‚ލŹÝ‚ľ‚Ä‚˘‚é‚ą‚Ć‚Č‚˘H
nkf -s “ü—̓tƒ@ƒCƒ‹ | awk
‚Ĺ•ĎŠˇ‚ľ‚˝‚ç

785ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/11(…) 03:47:08.47ID:6KznZIvs
ƒR[ƒh‚đ‹ł‚Ś‚ĉş‚ł‚˘B
ƒ`ƒƒƒŒƒ“ƒW‚ľ‚Ü‚ľ‚˝‚ށA‚ą‚ę‚Ĺ‚Íƒ_ƒ‚Ĺ‚ˇBB
(for i=1, i<=NF, i++){
if $i<0{$i=0}
}
print $0


‚ľ‚˝‚˘‚ą‚Ƃ́A‰ş‹L‚̂悤‚ȍs—ń‚̐”Žš‚Ş‚ ‚Á‚āA•‰‚Ě’l‚đƒ[ƒ‚É’uŠˇ‚ľ‚˝‚˘‚Ĺ‚ˇB

ĽŒł‚̍s—ń
3 15 6 1
-5 4 0 2
8 9 -7 11

Ľ‚â‚č‚˝‚˘•ĎŠˇŒă‚̍s—ńƒCƒ[ƒW
3 15 6 1
0 4 0 2
8 9 0 11

786ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/11(…) 04:14:37.49ID:gi9ycYMA
\•ś‚Ş‚ş‚ń‚ş‚ń‘ʖځB
{for(i=1;i<=NF;i++)if($i<0){$i=0};print $0;}

u‚ľ‚˝‚˘‚ą‚Ƃ́A`‚ľ‚˝‚˘‚Ĺ‚ˇBv‚̍\•ś‚ŕ‘ʖځB“TŒ^“I‚Č‚Ë‚ś‚ę•śB

787ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/11(…) 07:39:07.59ID:E3fj3Ww+
Ruby, Python ‚Č‚Ç‚đŽg‚Ś‚΁H

788ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/11(…) 12:31:52.37ID:ZhRn3EDd
>>787
Ruby, Python ƒXƒNƒŠƒvƒg‚đ’ńŽŚ‚ľ‚Ä‚Ý‚ë‚ćB

789ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/11(…) 22:58:11.78ID:Lckmn9CP
>>786
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇIo—ˆ‚Ü‚ľ‚˝I

(ˆęsƒvƒƒOƒ‰ƒ~ƒ“ƒOIawk•Ö—˜‚Ĺ‚ˇ‚Ë)

790ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/05/13(‹ŕ) 01:56:22.83ID:VtzDMLxe
awk ‚ś‚á‚Č‚­‚Ä‚ŕ‚˘‚˘‚ń‚Č‚ç

$ sed 's/-[0-9][0-9]*/0/g' ...

GNU sed ‚Č‚ç

$ sed -r 's/-[0-9]+/0/g' ...

‚Ĺ‚Ś‚Ś‚ń‚ż‚ႤH

791ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/06/22(…) 00:21:13.08ID:X+fwM1CQ
‚Š‚܂Ձ@uwƒVƒFƒ‹Œ|x‚ÉŒř‚­ AWKˆ•űⳁv

ƒGƒCƒzćśuAWK‚Á‚ÄŽg‚˘ŽĚ‚Ä‚ĚŒžŒęi’†—ށjƒvƒ‰ƒXƒAƒ‹ƒtƒ@‚̏ˆ—‚Ş‚â‚č‚˝‚˘‚ć‚ˁB
‚˝‚ž‚ť‚̏ˆ—‚Í‚Ć‚Ä‚ŕŠČ’P‚ȏˆ—‚Ĺ‚˘‚˘B‚ť‚ą‚ɑ΂ľ‚ĐV‚ľ‚˘ƒvƒƒOƒ‰ƒ€ŒžŒę‚đě‚Á‚Ä‚˘‚Ť‚˝‚˘v

AWKƒu[ƒ€‘ć1˘‘ă‚́uƒAƒCƒhƒ‹ŽŤ‘v‚ĹŠw‚ń‚ž\\“ú–{GNU AWKƒ†[ƒU[‰ď Ä“Ą‚ł‚ń (1/5)FCodeZineiƒR[ƒhƒWƒ“j
http://codezine.jp/article/detail/9478
2016/06/15 14:00

792ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/06/22(…) 23:46:54.12ID:P+7nG182
‚â‚˝‚ç‚Ć‘ą‚Ť‚Í“o˜^‚ľ‚Ä“Ç‚ß‚ĆŒž‚í‚ę‚Ä‚ŕ‚Č‚ B
‚ą‚ĚƒXƒŒ‚Ş—§‚Á‚˝ ‚Š‚çJGAUC‚ĚHP‚ލXV‚ł‚ę‚Ä‚˘‚Č‚˘‚Á‚Ä‚Ě‚ŕŚ‚˘B

793ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/08/27(“y) 09:20:46.26ID:2q8s4uQl
Windows”Ĺ‚Ěgawk‚Ĺ—V‚ń‚Ĺ‚˝‚ç
for (i=0; i<n; i++) ‚ć‚č
for (i=0; i<n; i+=1) ‚Ě‚Ů‚¤‚Ş
ŽŔsŽžŠÔ‚Ş’Z‚­‚Č‚é‚ą‚Ć‚É‹C‚Ă‚˘‚˝
‚Č‚ń‚ž‚ą‚č‚á

794ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/13(‰Î) 23:56:36.77ID:mfLTwPLq
for(i=1;i<=1000000;i++){a[i]=1}
‚Ć
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
Œ‹‰Ę‚Í“Ż‚ś‚Í‚¸‚Ȃ̂ɁAŒăŽŇ‚ÍˆŮí‚Ƀƒ‚ƒŠ‚đH‚¤I‚Ó‚ľ‚ŹI

795ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/14(…) 00:22:19.58ID:YCeX8Gov
“Ż‚ś‚ś‚á‚Č‚˘‚źB”’l‚Ć•śŽš—ń‚žB
‚Ć‚ą‚ë‚ŁAŒN‚ŞŽg‚Á‚Ä‚é awk ‚Í‚Ç‚ę?

apropos awk

‚Á‚Ä‚â‚Á‚Ä‚Ý‚˝‚çA‚ą‚ń‚Č‚ńo‚Ä‚Ť‚˝B

gawk (1) - ƒpƒ^[ƒ“ŒŸőEˆ—ŒžŒę
igawk (1) - ƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚đŽg‚¤ gawk
a2p (1) - Awk to Perl translator
awk (1) - pattern scanning and text processing language
English (3perl) - use nice English (or awk) names for ugly punctuation v...
mawk (1) - pattern scanning and text processing language
nawk (1) - pattern scanning and text processing language

796ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/14(…) 22:01:59.31ID:DqYC5LBT
>>795
—á‚ŞˆŤ‚­‚ăXƒ}ƒ\ACygwină‚Ĺgawk4.1.4Žg‚Á‚Ä
for(i=1;i<=1000000;i++){a[i]="1"}
‚Ć
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
‚Ĺƒ‹[ƒv’Eo’źŒă‚Ěƒƒ‚ƒŠŽg—p—Ę‚đ”äŠr‚ˇ‚é‚Ć
ă‚Ş60MBytesA‰ş‚Ş600MBytes‚Ć‚Š‚É‚Č‚Á‚˝

cmd‚Ĺ“Ž‚­gawk‚Ě3.1.7‚Ĺ‚ŕ“Ż‚ś‚悤‚ȍˇ‚Ş‚Ĺ‚˝
Linux‚ÍŽŽ‚ľ‚Ä‚˘‚Č‚˘‚Ż‚ǁA‚ŕ‚ľ‘ĺä•v‚Č‚çWindows”Ĺ‚Ě–â‘č‚Š‚ŕ

797ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/14(…) 22:50:10.30ID:PWB0Awgu
>>796
OSX El Capitan
gawk 4.1.4

‚ť‚ę‚ź‚ęBEGIN{}‚É“ü‚ę‚˝ƒXƒNƒŠƒvƒg‚đ“ǂݍž‚Ü‚š‚ÄŽŔsB
‚Ĺ‘OŽŇ”\MBAŒăŽŇ3GB’´‚Ü‚Ĺƒƒ‚ƒŠŽg‚Á‚˝iƒAƒNƒeƒBƒrƒeƒBƒ‚ƒjƒ^jB

7987952016/09/14(…) 23:40:38.22ID:YCeX8Gov
‚â‚Á‚Ä‚Ý‚˝‚ćBŠÂ‹Ť‚Í Debian jessieB
ƒeƒXƒgƒvƒƒOƒ‰ƒ€

#!/usr/bin/perl -w
use strict;
{
my $do_ps = 'system("ps p $PPID o pid,sz,args")';
foreach ( 1,'sprintf("1")'){
system('gawk',"BEGIN { for(i=1;i<=1000000;i++){a[i]=$_} $do_ps;}");
}
}

ŽŔsŒ‹‰Ę

PID SZ COMMAND
7389 7693 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=1} system("ps p $PPID o pid,sz,args");}
PID SZ COMMAND
7392 158116 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=sprintf("1")} system("ps p $PPID o pid,sz,args");}

KB ’PˆĘ‚ç‚ľ‚˘‚Š‚ç 8MB ‚Ć 160MB B‚˝‚ž‚˛‚Ć‚ś‚á‚Č‚˘ˇ‚ž‚ˁB
1 ‚đ "1" ‚É•ĎX‚ľ‚Ä‚ŕ‚ą‚ń‚ČŠ´‚ś‚ž‚Š‚琔’l‚Ć•śŽš—ń‚̍ˇ‚Ć‚˘‚¤‚í‚Ż‚Ĺ‚Í‚Č‚ł‚ť‚¤B

799ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/14(…) 23:49:14.48ID:YCeX8Gov
‚˛‚ß‚ńA‘‚Ť–Y‚ę‚˝B

GNU Awk 4.1.1, API: 1.1 (GNU MPFR 3.1.2-p3, GNU MP 6.0.0)
Copyright (C) 1989, 1991-2014 Free Software Foundation.

800ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/17(“y) 08:30:37.61ID:didBD5ba
‚ć‚­l‚Ś‚˝‚çAƒƒ‚ƒŠ‚ĚŽg—p—ĘŽŠ‘Ě‚ś‚á‚Č‚­‚āA‚ť‚ę‚Ş‚Ç‚ę‚ž‚Ż‘‚Ś‚˝‚Š‚ޏd—v‚ž‚ˁB
‚ť‚ľ‚āA˜A‘z”z—ń‚̍\‘˘‘Ě‚ĆƒL[‚É•K—v‚Č—Ę‚Í‚Ç‚ĚƒP[ƒX‚Ĺ‚ŕ“Ż‚ś‚ƍl‚Ś‚ç‚ę‚éB
‚‚܂čA˜A‘z”z—ń‚Ě—v‘f‚Ě‚˝‚ß‚Ě—Ę‚Ş‚Ç‚ę‚ž‚Żˆá‚¤‚Š‚𒟐ڒm‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚é‚Í‚¸B
‚Ć‚˘‚¤‚í‚Ż‚ŁA‚ŕ‚¤ˆę‰ńƒeƒXƒgB

https://ideone.com/mRuFj7

801ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/17(“y) 08:32:42.20ID:didBD5ba
ŽŔsŒ‹‰Ę

element before after diff
1 5685 7691 2006
i 5685 29226 23541
sprintf("%d",i) 5685 158124 152439
sprintf("%d",i) + 0 5685 29221 23536
sprintf("%d",i) "" 5685 37026 31341

1000000 —v‘f‚Ě”z—ń‚Ĺ 2MB ‚Á‚āA‚˘‚Á‚˝‚˘‚Ç‚¤‚â‚Á‚Ä‚é‚ń‚ž‚낤B­‚Č‚ˇ‚Ź‚éB
sprintf("%d",i) ‚ޓˏo‚ľ‚Ä‘˝‚˘‚Ě‚Í sprintf ‚Ĺ‘˝‚ß‚ÉŠm•Ű‚ľ‚Ä
Ř‚č‹l‚ß‚˝‚č‚š‚¸‚É‚ť‚Ě‚Ü‚ÜŽg‚Á‚Ä‚é‚Ě‚ž‚낤‚ŠB
‚ł‚ Agawk ‚Ěƒ\[ƒXƒR[ƒh‚đƒnƒbƒN‚ľ‚Ä‚Ý‚é‚Š!

802ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/17(“y) 14:11:27.89ID:IIH0ZjSk
„‘Ş‚ž‚Ż‚ǁAstream, yield, callbackA’x‰„ˆ—‚Š‚ŕ

ƒf[ƒ^‚đƒoƒbƒtƒ@ƒTƒCƒY•Ş‚ž‚Ż“ǂݍž‚ń‚ŏˆ—‚ľ‚āA
ŽŸ‚ĚƒRƒ}ƒ“ƒh‚Ö‘—‚Á‚˝‚çA‚ť‚ę‚đŽĚ‚ĂāAŽŸ‚Ěƒf[ƒ^‚đ“ǂݍž‚Ţ‚Ě‚Š‚ŕ

‚ą‚Ě•űŽŽ‚ž‚Ćƒƒ‚ƒŠ‚́Aƒoƒbƒtƒ@ƒTƒCƒY•Ş‚ž‚Ż‚ľ‚ŠŽg‚í‚Č‚˘

803ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 10:41:36.96ID:6jI6cHER
ƒxƒNƒ^[‚ÉŒöŠJ‚ł‚ę‚Ä‚égawk3.1.5i‚Ć”ńŒöŠJ‚Ě3.1.7jAƒwƒ“ƒeƒR‚ȏˆ—‚ŞŒŠ‚‚Š‚Á‚˝‚Ě‚Ĺƒƒ‚
‚ą‚Ěgawk‚ĚsystemŠÖ”‚đŽŔs‚ˇ‚é‚ƁAŠÂ‹Ť•Ď”TMP‚ŞŽw‚ľ‚Ä‚éƒtƒHƒ‹ƒ_‚É
@echo off
systemŠÖ”‚Ěˆř”
‚Ć‚˘‚¤2s‚ޏ‘‚Š‚ę‚˝ƒoƒbƒ`ƒtƒ@ƒCƒ‹pip?.bati?‚ÍsystemŽŔs‰ń”+1j‚Ć‚˘‚¤‚Ě‚ŞěŹ‚ł‚ę

804ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 10:44:42.56ID:6jI6cHER
EEE‚˘‚Á‚Ř‚ń‚ɏ‘‚ą‚¤‚Ć‚ľ‚˝‚çƒnƒl‚ç‚ę‚éorz

8058032016/09/18(“ú) 10:46:32.08ID:6jI6cHER
(‘ą‚Ť)
‚ť‚ę‚đ/c pip?.bat‚Ĺ‹N“ŽAŠŽ—šŒă‚Épip?.bat‚đ
íœ‚Ć‚˘‚¤—Ź‚ę‚ĹƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚é

8068032016/09/18(“ú) 10:47:07.98ID:6jI6cHER
(‘ą‚Ť)
systemŠÖ”‚đŽg‚Á‚˝ƒXƒNƒŠƒvƒg‚đ“ŻŽž‚É1‚‚ľ‚ŠŽŔs‚ľ‚Č‚˘‚Č‚ç—Ç‚˘‚Ż‚Ç
2‚ÂˆČăŽŔs‚ľ‚˝‚Ć‚Ť‚̓^ƒCƒ~ƒ“ƒOŽŸ‘ć‚Ĺpip?.bat‚̐”Žš‚ނԂ‚Š‚čAć‚ÉŽŔs‚ľ‚˝‘¤‚Ş
E ƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚Č‚˘
E ƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚é‚Ż‚ǁAŠŽ—šŒă‚Ɂuƒoƒbƒ`ƒtƒ@ƒCƒ‹‚ŞŒŠ‚‚Š‚č‚Ü‚š‚ńv‚Ş“f‚Š‚ę‚é
‚Ć‚˘‚¤Œ‹‰Ę‚É‚Č‚é

—\‚ßcmd‚Ě‘‹‚˛‚Ć‚ÉTMP‚đ•Ď‚Ś‚Ä‚¨‚Ż‚Ζâ‘č‚Č‚˘‚Ż‚Ç–Ę“|‚­‚ł‚˘
ƒRƒ}ƒ“ƒh | getline‚Ĺ‹N“Ž‚ľ‚˝‚Ů‚¤‚ŞŽč‚ÁŽć‚葁‚˘‚ĆŽv‚¤
i‚˝‚ž‚ľo—Í‚Ş2KBytes—­‚Ü‚é‚ĆŽ~‚Ü‚é‚Š‚ç“K‹XƒŠƒ_ƒCƒŒƒNƒg‚ˇ‚éj

‚Ĺ‚ŕ‰˝‚Ĺ‚ą‚ń‚Č•ű–@‚ĹsystemŠÖ”‚đŽŔ‘•‚ľ‚˝‚ń‚ž‚낤‚Ë(LEƒÖEM)

807ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 13:53:41.51ID:EIh/dcA1
tmpfile ‚đŽg‚Ś‚΁A‘ź‚Əd•Ą‚ľ‚Č‚˘Aƒ‰ƒ“ƒ_ƒ€‚Č–ź‘O‚Ěƒtƒ@ƒCƒ‹‚đě‚ę‚é‚̂ɁA

‚Ç‚¤‚ľ‚ÄŽg‚í‚Č‚˘‚Ě‚ž‚낤H

808ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 14:54:02.97ID:KtcAr9oX
MS-DOS ‚ł͂ˁAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚Ě’ˇ‚ł‚̐§ŒŔ‚ŞŒľ‚ľ‚Š‚Á‚˝‚ń‚ž‚ćB‹Á‚­‚Č‚Š‚ęA‚˝‚Á‚˝ 128 ƒoƒCƒg‚žB
‚ť‚ń‚Ȋ‹Ť‚ł́Aƒoƒbƒ`ƒtƒ@ƒCƒ‹‚É‚ˇ‚ę‚ÎŽŔs‚Ĺ‚Ť‚é‚Ż‚Ç

command /c "prog arg1 arg2 ..."

‚Ĺ‚Í command /c ‚Ě‚š‚˘‚Ő§ŒŔ‚đ‰z‚Ś‚é‚Ć‚˘‚¤‚ą‚Ć‚ŕ‚ ‚é‚ž‚낤B‚‚܂čA‚ť‚¤‚˘‚¤‚ą‚Ć‚žB
cccç’k‚žBŠm‚Š‚É‚ť‚¤‚˘‚¤§ŒŔ‚Í‚ ‚Á‚˝‚Ż‚ǁB
ŒťÝ‚Í‚ŕ‚¤ system ŠÖ”‚Ĺ‚Í‚ť‚¤‚˘‚¤‚ą‚Ć‚đ‚ľ‚Ä‚˘‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć‚Ş ChangeLog ‚ɏ‘‚Š‚ę‚Ä‚é‚ćB

2014-01-15 Eli Zaretskii <eliz@gnu.org>
* popen.c (os_system): Use spawnl, and quote the command line, to be consistent with what gawk_popen does.
(os_popen) [__MINGW32__]: Don't scriptify the command, to be consistent with gawk_popen.
(os_pclose) [__MINGW32__]: Update to match os_open: no need to unlink the script file.

809ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 15:07:54.47ID:KtcAr9oX
‚Ĺ‚ŕƒ\[ƒXƒR[ƒh‚đŒŠ‚é‚Š‚Ź‚čAƒpƒCƒv‚Ĺ‚Í‚ť‚¤‚˘‚¤‚ą‚Ć‚đ‚ľ‚Ä‚é‚Ý‚˝‚˘‚Č‚ń‚ž‚Ż‚ǁcc
‚ż‚ĺ‚Á‚ĆŽŽ‚ľ‚Ä‚Ý‚Ä‚­‚ę‚Č‚˘‚Š‚ȁB

system("dir") | getline

‚Ý‚˝‚˘‚ČŠ´‚ś? ‚ć‚­’m‚ç‚Č‚˘‚Ż‚ǁB

8108032016/09/18(“ú) 16:19:12.82ID:6jI6cHER
ƒRƒ}ƒ“ƒh | getline ‚Ĺ‹N“Ž‚ˇ‚éę‡‚Ípip?.bat‚͍ě‚ç‚ę‚Ü‚š‚ń‚Ĺ‚ľ‚˝
systemŠÖ”‚ž‚Żpip?.batŒo—R‚Ě–Í—l
klabaster”Ĺ‚Ěwindows—pgawk4.1.3‚ž‚ĆsystemŠÖ”‚Şpip?.bat‚đ
ě‚ç‚Č‚Š‚Á‚˝‚Š‚çAƒxƒNƒ^[”ĹŒĹ—L‚Ě“Ž‚Ť‚Š‚Č‚ ‚ĆŽv‚˘‚Ü‚ˇ

811ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 17:46:00.36ID:KtcAr9oX
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
gawk-4.1.1 ‚Ě pc/popen.c ‚đŒŠ‚˝ŒŔ‚č‚Ĺ‚Í gawk ‚Ě system ŠÖ”‚Ĺƒoƒbƒ`ƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í MINGW ŒŔ’č‚ŁA
ChangeLog ‚É‚Í–â‘č‚Ş‰đÁ‚ł‚ę‚˝‚Š‚ç’źÚ spawnl ‚ĹŽŔs‚ˇ‚é‚悤‚É‚ľ‚˝‚Ə‘‚Š‚ę‚Ä‚˘‚é‚í‚Ż‚Ĺ‚ˇ‚Ş
gawk ‚ĚƒpƒCƒvˆ—‚đŽŔs‚ľ‚Ä‚˘‚é(‚ĆŽv‚í‚ę‚é) os_popen ŠÖ”‚Ĺ‚Íƒoƒbƒ`ƒtƒ@ƒCƒ‹‚đě‚é‚Ć‚Ť‚Ć“Ż—l‚É
tempnam ŠÖ”‚Ĺƒtƒ@ƒCƒ‹–ź‚đě‚Á‚˝ă‚ŁA‚ť‚Ěƒtƒ@ƒCƒ‹‚đŒo—R‚ľ‚ÄŽó‚Ż“n‚ľ‚đ‚ľ‚Ä‚˘‚é‚悤‚ÉŒŠ‚Ś‚Ü‚ˇB
‚ą‚ę‚Í MS-DOS ‚ĚŽž‘ă‚Š‚çŽg‚í‚ę‚Ä‚é‚â‚č•ű‚ŁAƒpƒCƒv‚̂悤‚ÉŒŠ‚Ś‚Ä‚ŕƒpƒCƒv‚Ĺ‚Í‚ ‚č‚Ü‚š‚ńB
‚ą‚Ě‚â‚č•ű‚ž‚Ć gawk ‚Ĺ

while (( command | getline) > 0)

‚Ə‘‚˘‚Ä‚ŕŽŔŽż“I‚É‚Í

system("command > filename"); while (( getline < "filename") > 0)

‚Ć“Ż‚ś‚ą‚Ć‚É‚Č‚č‚Ü‚ˇB
‚ ‚­‚Ü‚Ĺ‚ŕ 4.1.1 ‚Ě pc/popen.c ‚Ě os_popen ŠÖ”‚Ş‚ť‚¤ŒŠ‚Ś‚é‚Ć‚˘‚¤‚ž‚Ż‚ŁAŽŔŰ‚ɂ͈Ⴄ‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ş
ŽŠ•Ş‚ĹŽŽ‚ˇ‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚š‚ńB‚ť‚ŕ‚ť‚ŕ 3.1.5 ‚Ěƒ\[ƒXƒR[ƒh‚Á‚Ä‚Ç‚ą‚É‚ ‚é‚Ě?
‚ŕ‚ľŠ¨ˆá‚˘‚ś‚á‚Č‚˘‚Č‚ç >>806 ‚Ć“Ż‚ś–â‘č‚Ş‹N‚ą‚č‚ť‚¤‚Č‹C‚ށcc
Linux ‚đŽg‚Á‚Ă鎊•Ş‚É‚ÍŠÖŒW‚Č‚˘‚Ć‚˘‚Á‚Ä‚ľ‚Ü‚Ś‚΂ť‚ę‚Ü‚Ĺ‚Ĺ‚ˇ‚ށB

812ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 19:56:17.75ID:zTPoEkjL
>>811
vector‚Ě”z•zƒtƒ@ƒCƒ‹“ŕ‚Ěreadme‚ɂ̓\[ƒXƒR[ƒh‚Ě
ŒöŠJęŠ‚đ’T‚ľ‚Ä‚é‚Ć‚ŠA’źÚ˜A—‚ˇ‚ę‚Γn‚ˇ‚Ć‚Š‘‚˘‚Ä‚ ‚éB

Windows”ŁANT‚ ‚˝‚č‚Š‚çˆęŽžƒtƒ@ƒCƒ‹ě‚炸‚ɃpƒCƒv“Žě‚ˇ‚é‚悤‚É
‚Č‚Á‚˝‚Ć‚ŠA‚Ç‚ą‚Š‚Ĺ“Ç‚ń‚ž‹C‚Ş‚ˇ‚é‚Ż‚ǁB

813ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/18(“ú) 22:03:20.37ID:KtcAr9oX
“ä‚Í‰đ‚Ż‚˝B
ƒtƒ@ƒCƒ‹‚đŽg‚Á‚ăf[ƒ^‚đ“n‚ˇ‚Ě‚Íƒ}ƒNƒ __DJGPP__ ‚Ćƒ}ƒNƒ __MINGW32__ ‚Ş
‚˘‚¸‚ę‚ŕ’č‹`‚ł‚ę‚Ä‚˘‚Č‚˘ę‡‚ç‚ľ‚˘‚Ĺ‚ˇB
Vector ‚Ě‚Í MINGW ‚Č‚Ě‚ĹŠY“–‚ľ‚Ü‚š‚ńB‚¨‘›‚Ş‚š‚ľ‚Ü‚ľ‚˝B

814ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/19(ŒŽ) 11:56:06.00ID:iIvzjj/t
ƒtƒ@ƒCƒ‹‚đŒo—R‚ľ‚Ä‚˘‚Ä‚ŕAƒXƒgƒŒ[ƒW‚ɏ‘‚Ťž‚Ţ‚Ć‚ÍŒŔ‚ç‚Č‚˘

ƒƒ‚ƒŠă‚ž‚Ż‚É‘śÝ‚ˇ‚éAƒtƒ@ƒCƒ‹‚ŕ‚ ‚č“ž‚éB
Linux‚ĚRAMƒfƒBƒXƒNAtmpfs ‚Ć‚Š

8158032016/09/19(ŒŽ) 14:26:19.66ID:fDWhtT6v
>>811
î•ń‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB>>803‚ŏ‘‚˘‚˝uƒwƒ“ƒeƒR‚ȏˆ—v‚đpc\popen.c“ŕ‚ÉŠm”F‚Ĺ‚Ť‚Ü‚ľ‚˝B
scriptifyŠÖ”‚ĚtempnamŒÄ‚ń‚Ĺ‚é‚Ć‚ą‚ë‚ĹƒvƒƒZƒXID‚ŕ‚‚Ż‚é‚Č‚čA×H‚ľ‚˝‚˘‚Č‚ EEE

816ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/20(‰Î) 17:00:26.41ID:RIxgZ1yj
ć“úƒAƒNƒZƒX‚Ĺ‚Ť‚Č‚Š‚Á‚˝ GNU ‚ĚƒTƒCƒg‚Ş•œŠˆ‚ľ‚Ä‚˝‚Ě‚Ĺ 3.1.5 ‚Ěƒ\[ƒXƒR[ƒh‚đ“üŽč‚Ĺ‚Ť‚Ü‚ľ‚˝B
‚â‚Á‚Ď‚č os_popen ‚Š‚ç‚ŕ scriptify ‚đŒÄ‚ń‚Ĺ‚˝‚Ý‚˝‚˘‚Ĺ‚ˇ‚ˁB4.1.1 ‚Ěƒ\[ƒXƒR[ƒh‚ś‚ᔝ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
ˆę‰ž chdir ‚̓Aƒgƒ~ƒbƒN‚ȏˆ—‚Ě‚Í‚¸‚Č‚Ě‚ĹƒŠƒXƒN‰ń”đ‚ɖ𗧂‚Ǝv‚˘‚Ü‚ˇ‚ćB‚ť‚ęˆČŠO‚É•ű–@‚Ş‚Č‚Ż‚ę‚΁B
chdir ‚ľ‚˝‚ç rmdir ‚ŕ–Y‚ꂸ‚ɁB

817ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/20(‰Î) 17:06:03.57ID:RIxgZ1yj
ŠÔˆá‚Ś‚˝Bchdir ‚ś‚á‚Č‚­‚Ä mkdir ‚Ĺ‚ˇB

818ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/22(–Ř) 12:11:24.09ID:nnsRF/zz
>>794
‚Ç‚¤‚â‚ç >>801 ‚Ĺ‘z‘œ‚ľ‚˝’Ę‚č sprintf ‚ĚŽd—l‚ç‚ľ‚˘B
–{‘Ě‚Í builtin.c ‚Ě format_tree ŠÖ”‚ç‚ľ‚˘B
Ĺ‰‚É 512 ƒoƒCƒgŠm•Ű‚ľ‚˝ƒoƒbƒtƒ@‚Í‘ĺ‚Ť‚­‚Í‚Č‚Á‚Ä‚ŕŹ‚ł‚­‚Í‚Č‚ç‚Č‚˘B
ŽŔŰ‚Ě•śŽš—ń‚ɍ‡‚í‚š‚ÄŠm•Ű‚ľ‚Č‚¨‚ľ‚˝‚ç‚Ç‚¤‚Č‚é‚Š >>800 ‚ĚƒeƒXƒg‚đ‚ľ‚Ä‚Ý‚˝‚ćB

‰ü‘˘‘O
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@151283@148530
sprintf("%d",i) + 0@@@@@ 2753@ 22376@ 19623
sprintf("%d",i) ""@@@@@@2753@ 30174@ 27421

‰ü‘˘Œă
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@ 30174@ 27421
sprintf("%d",i) + 0@@@@@ 2753@ 22373@ 19620
sprintf("%d",i) ""@@@@@@2753@ 30230@ 27477

‚ ‚ęH jessie ‚Ě gawk ‚Ć”ä‚ׂăƒ‚ƒŠ‚ĚŽg—p—Ę‚Ş­‚Č‚˘B
-DDEBUG •t‚Ť‚ĹƒRƒ“ƒpƒCƒ‹‚ľ‚˝‚Š‚瑝‚Ś‚é‚Š‚ĆŽv‚Á‚˝‚̂ɁB
‚Ü‚ A‚ť‚ęˆČŠO‚Íˆę‰ž—\‘z’Ę‚č‚Ĺ‚Í‚ ‚éB

819ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/22(–Ř) 23:15:31.17ID:SYBS8P/o
>>793‚Ć‚Š
•śŽš—ń‚Ě˜AŒ‹‚Í "A" "B" ‚ć‚č‚ŕsprintf("%s%s", "A", "B") ‚Ě•ű‚Ş‘Ź‚˘‚Ć‚Š
gawk‚Á‚ÄŒ‹\ƒNƒZ‚ ‚č‚Ü‚ˇ‚Ë

820ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/23(‹ŕ) 02:39:22.63ID:o4qLonoN
>>819
> •śŽš—ń‚Ě˜AŒ‹‚Í "A" "B" ‚ć‚č‚ŕsprintf("%s%s", "A", "B") ‚Ě•ű‚Ş‘Ź‚˘
ƒ}ƒW‚ŠB‹t‚ž‚Ć•ˇ‚˘‚Ä‚˘‚˝‚ށB

821ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/23(‹ŕ) 16:06:39.19ID:Y+5MXC/e
‚ť‚ń‚ČƒoƒJ‚ȁcc‚ĆŽv‚Á‚Ä‚â‚Á‚Ä‚Ý‚˝B

https://ideone.com/jIYn2p

jessie —p‚ĚƒpƒbƒP[ƒW‚É‚ć‚éŽŔsŒ‹‰ĘB

i++@@@@@@@@@6.15614
i = i + 1@@@@@@6.02501
cat " and " dog@@@13.0163
sprintf@@@@@@@19.1612

ƒCƒ“ƒNƒŠƒƒ“ƒg‚Ć‘Ť‚ľŽZ‚̍ˇ‚Í—LˆÓ‚Ć‚ÍŽv‚Ś‚Č‚˘B
˜AŒ‹‚Ć sprintf ‚̍ˇ‚Í‘˝•ŞA”{‚­‚炢B
sprintf ‚Ě’†‚Ě•ĄŽG‚ł‚đl‚Ś‚ę‚ΈӊO‚ƍˇ‚͏Ź‚ł‚˘‚Ć‚˘‚Ś‚éB
ƒtƒH[ƒ}ƒbƒg•śŽš—ń‚Ş’č”‚Ȃ琳‹K•\Œť‚Ý‚˝‚˘‚ɃRƒ“ƒpƒCƒ‹‚ˇ‚ę‚Î
‚‘Ź‰ť‚Ĺ‚Ť‚écc‚Ě‚Š‚Č‚ ? ŽŠ•Ş‚Ĺ‚â‚Á‚Ă݂悤‚Ć‚Í(Ą‚Í‚Ü‚ž)Žv‚í‚Č‚˘B

822ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/24(“y) 23:15:47.76ID:+IiHRmp0
Windows‚ĹŽg‚Ś‚éawk‚ĹUnicode‚𐳂ľ‚­ˆ—‚Ĺ‚Ť‚éilength("‚ ‚˘‚¤")‚Ĺ3‚Ş•Ô‚Á‚Ä‚­‚éj‚ŕ‚Ě‚Í
Cygwin”Ĺ‚ĆVector”ĹˆČŠO‚É–ł‚˘‚Ĺ‚ľ‚傤‚ŠH

823ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/25(“ú) 10:08:34.07ID:BH82R274
‰˝‚Ş‚ ‚Á‚˝‚ń‚Ĺ‚ˇ‚Š?

http://tanimoto.to/nlp/jgawk/jgawk.html

‚ɏ‘‚Š‚ę‚Ä‚˘‚é‚悤‚Č‚ą‚Ć‚Ĺ‚ˇ‚Š? •Ę‚Ě‘I‘đŽˆ‚ŕˆę‰ž‚ ‚é‚Ý‚˝‚˘‚Ĺ‚ˇ‚ށB
ƒgƒ‰ƒ“ƒXƒŒ[ƒ^‚Ĺ‚ŕ‚˘‚˘‚Č‚ç Perl ‚É a2p ‚Ş“ŻŤ‚ł‚ę‚Ä‚Ü‚ˇB

8248222016/09/25(“ú) 14:28:36.60ID:MNlfsMjx
“Á‚ɍ˘‚育‚Ć‚Í–ł‚˘‚Ě‚Ĺ‚ˇ‚ށAĹV‚ĚVer4.1.4‚â‚ť‚Ě‹ß•Ó‚Ěƒo[ƒWƒ‡ƒ“‚Ĺ
Unicode‚ސł‚ľ‚­ˆ—‚Ĺ‚Ť‚é‚ŕ‚Ě‚Ş‚ ‚ę‚΁AĄŽg‚Á‚Ä‚˘‚éBruce”Ĺ3.1.7‚Š‚ç
ć‚芡‚Ś‚˝‚˘‚Č‚ ‚ĆŽv‚˘‚Ü‚ľ‚āB

Ť‚Ě5”N‘O‚ɏ‘‚Š‚ę‚˝‹LŽ–‚̍ ‚ć‚č‘I‘đŽˆ‚Ş‘‚Ś‚˝‚č‚ľ‚Ä‚˝‚çŠđ‚ľ‚˘‚ȂƁEEEB
http://blog.livedoor.jp/corbie/archives/3924154.html

8258232016/09/26(ŒŽ) 09:17:05.22ID:bhAuZr+w
—‰đ‚ľ‚Ü‚ľ‚˝B‘S–Ĺ‚ž‚Á‚˝‚ń‚Ĺ‚ˇ‚ˁB
Windows ‚Ĺ‚ĚŽ–î‚Í‘ś‚ś‚Ü‚š‚ń‚ށA‚ą‚ż‚ç‚Ĺ‚ŕŽć‚č‹}‚Ź gawk 3.1.5 ‚đ make ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
‚Ć‚ą‚ë‚ŁA‚ť‚Ěƒy[ƒW‚ĚƒeƒXƒg3‚Í•s\•Ş‚Ĺ‚ˇB
UTF-8 ‚Ĺ‚Ěƒpƒ^[ƒ“ƒ}ƒbƒ`‚Í’Ęí•śŽš‚ĚŒëƒ}ƒbƒ`‚ÍŒ´—“I‚É‹N‚ą‚č‚Ü‚š‚ńB‹N‚ą‚Á‚˝‚çƒoƒO‚Ĺ‚ˇB
‚ž‚Š‚çAUTF-8 ‚ɑΉž‚ľ‚Ä‚˘‚é‚Š‚Ç‚¤‚Š‚đƒeƒXƒg‚ˇ‚é‚˝‚ß‚É
sub(/.‚¤/, "U")
‚Ć‚˘‚¤‚悤‚Č‚ŕ‚Ě‚đ“ü‚ę‚ÄŽŽ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
Ąƒrƒ‹ƒh‚ľ‚˝‚΂Š‚č‚Ě gawk 3.1.5 ‚Ć jessie ‚ĚƒpƒbƒP[ƒW‚Ě gawk 4.1.1 ‚Ş‚ą‚ĚƒeƒXƒg‚ɍ‡Ši‚ľ‚Ü‚ľ‚˝B
mawk 1.3.3 ‚ŕƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚Ä‚Ü‚ľ‚˝‚ށA‚ą‚ż‚ç‚̓}ƒ‹ƒ`ƒoƒCƒg•śŽš‚ɑΉž‚ľ‚Ä‚˘‚Č‚˘‚悤‚Ĺ‚ˇB

‚ł‚āAŒ‹˜_‚Ĺ‚ˇB
ƒVƒtƒgJIS ‚ɑΉž‚ľ‚Ä‚˘‚é‚Ć‚ł‚ę‚é‚ŕ‚Ě‚Í”đ‚Ż‚˝•ű‚Ş‚˘‚˘‚ĆŽv‚˘‚Ü‚ˇB
—]Œv‚ȉü‘˘‚Í‚ľ‚Č‚˘•ű‚ސM—ŠŤ‚͍‚‚˘‚Ĺ‚ľ‚傤B
length ‚ރoƒCƒg”‚Ȃ̂́A’P‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•śŽš”ń‘Ήž‚ĹƒRƒ“ƒpƒCƒ‹‚ł‚ę‚Ä‚é‚Š‚ç‚ž‚ĆŽv‚˘‚Ü‚ˇB
ƒ}ƒ‹ƒ`ƒoƒCƒg•śŽš‘Ήž”Ĺ‚đ’N‚Š‚ރŠƒŠ[ƒX‚ľ‚Ä‚­‚ę‚é‚Ě‚đ‘҂‚ŠAŽŠ•Ş‚ĹƒRƒ“ƒpƒCƒ‹‚ˇ‚é‚Š‚Ĺ‚ˇ‚ˁB

826ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/27(‰Î) 17:33:47.16ID:Icjzq3KF
Linux ‚ł͊‹Ť•Ď” LANG ‚É UTF-8 ‚Ş“ü‚Á‚Ä‚Č‚˘‚ĆŠú‘Ň’Ę‚č‚É“Ž‚˘‚Ä‚­‚ę‚Ü‚š‚ńB
łŠm‚É‚Í LANG ‚Ć‚˘‚¤‚ć‚č LC_CTYPE ‚Ĺ‚ˇ‚ށA‚ť‚ę‚Í‚¨‚˘‚Ć‚˘‚āB
‚ŕ‚ľ‚Š‚ľ‚˝‚ç‚ĆŽv‚Á‚āAŽŠ•Ş‚É‚Í–ł—p‚ž‚ĆŽv‚Á‚Ä‚˝ Wine ‚Ĺ klabaster gawk 4.1.3 ‚đ“Ž‚Š‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
‚Ć‚ą‚ë‚ŞAł‹K•\Œť‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•śŽš‚ŞŒť‚ę‚˝Žž“_‚Ĺ“{‚ç‚ę‚Ü‚ˇB
‚Ç‚¤‚â‚ç LANG ‚Ş–ł‚˘‚ŠALANG=C ‚ś‚á‚Č‚Ż‚ę‚΃}ƒ‹ƒ`ƒoƒCƒg•śŽš‚đŽg‚Ś‚Č‚˘‚悤‚Ĺ‚ˇB
‚ť‚ľ‚ÄŒ‹‹ÇAł‹K•\Œť‚Ě . ‚â length ‚đ UTF-8 ƒ‚[ƒh‚É‚ˇ‚é•ű–@‚ÍŒŠ‚‚Ż‚ç‚ę‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
‹LŽ–‚ĚƒRƒƒ“ƒg‚É‚Í LC_ALL=ja_JP.UTF-8 ‚Ĺ“Ž‚­‚Á‚ď‘‚˘‚Ä‚ ‚é‚̂ɁB
‚Đ‚ĺ‚Á‚Ć‚ľ‚āAWindows ‚Ĺ‚ÍŒ´—“I‚É‚Ĺ‚Ť‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć?
‚ą‚ę‚Í‚˘‚悢‚ć a2p ‚ŞŒťŽŔ“I‚Č‘I‘đŽˆ‚Š?
cc‚ĆŽv‚Á‚˝‚çAo—Í‚ˇ‚é Perl ƒR[ƒh‚ŞŠÔˆá‚Á‚Ä‚Ü‚ˇB

‚ŕ‚¤~ŽQ‚Ĺ‚ˇBUTF-8 ‘Ήž‚Ě gawk ‚đ‚¨–]‚Ý‚Ě•ű‚É‚Í Linux ‚Ö‚Ěˆř‰z‚ľ‚đ‹­‚­‚¨§‚ß‚ľ‚Ü‚ˇB

827ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/27(‰Î) 18:24:36.25ID:JiNhKH2a
cygwin‚âmsys2‚Ěgawk‚đŽg‚¤‚Ě‚Í‚ž‚߂Ȃ́H

828ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/27(‰Î) 18:34:39.64ID:BPXrtVfk
Windows Subsystem for Linux (WSL)‚ł́AUbuntu64‚ĚŽŔsƒtƒ@ƒCƒ‹‚Ş“Ž‚­B
Linux API ‚đAWindows API ‚Ö•ĎŠˇ‚ľ‚ÄŒÄ‚Ńo‚ˇ

Ubuntu‚ĚƒpƒbƒP[ƒW‚ŕAapt-get‚ĹƒCƒ“ƒXƒg[ƒ‹‚Ĺ‚Ť‚é

829ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/27(‰Î) 19:26:43.05ID:Icjzq3KF
‚ž‚ß‚Ć‚˘‚¤‚ŠAŒŠ‚‚Ż‚ç‚ę‚Č‚Š‚Á‚˝B
‚˝‚ž‚Ĺ‚ł‚Ś Windows ‚Ě‚ą‚Ć‚Č‚ń‚Š’m‚ç‚Č‚˘‚ń‚ž‚Š‚ç‚ą‚ęˆČă–ł—B
‚˘‚˘•ű–@‚đ’m‚Á‚Ä‚˝‚ç‹ł‚Ś‚Ä‚ ‚°‚āB

830ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/27(‰Î) 19:51:11.26ID:Icjzq3KF
Cygwin ‚ÍŽŽ‚ľ‚Ä‚Ý‚˝‚Ż‚ǃCƒ“ƒXƒg[ƒ‰‚É’šd‚É‚¨’f‚č‚ł‚ę‚˝‚ćB

8318222016/09/27(‰Î) 23:10:22.59ID:eGFFwbsN
‚˝‚­‚ł‚ń‚̏î•ń‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇBŒťó‚ĹWindows‚ɍS‚é‚Č‚çABruce”Ĺ3.1.7‚đŒp‘ą‚ľ‚Ä
Žg—p‚ˇ‚é‚ŠACygwin”Ĺ‚Éć‚芡‚Ś‚é‚ŠAWindows Subsystem for Linux‚Ĺ“Žě‚ł‚š‚é‚Š‚Ě
‚˘‚¸‚ę‚Š‚É‚Č‚č‚ť‚¤‚Ĺ‚ˇ‚ˁB

Cygwin‚âWindows7‚Ĺ‚ĚWindows Subsystem for Linux‚́A‚Ç‚ż‚ç‚ŕ•Ę“rƒCƒ“ƒXƒg[ƒ‹‚Ş•K—v
‚Ć‚Ě‚ą‚ƂȂ̂ŁAEę‚ĚŽŠPC‚Í‚Ć‚ŕ‚Š‚­ƒXƒNƒŠƒvƒg”z•zć‚ɁiƒXƒNƒŠƒvƒg‚đ“Ž‚Š‚ˇ‚˝‚ß‚ž‚Ż‚Ɂj
“ą“ü‚ľ‚Ä‚ŕ‚ç‚í‚Č‚˘‚Ć‚˘‚Ż‚Č‚˘‚Ě‚Í‚ż‚ĺ‚Á‚Ć“ď‚ľ‚ť‚¤‚Ĺ‚ˇB
Cygwin‚Ě“ą“üó‹ľ‚ĆWindows10‚ւ̐؂č‘Ö‚ŚŽžŠú‚Ě—lŽq‚đŒŠ‚Â‚ÂA‚ľ‚΂炭Bruce”Ĺ3.1.7‚đ
Žg‚¤‚ą‚Ć‚É‚ľ‚Ü‚ˇB

832ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/09/28(…) 07:26:06.87ID:6NcLFLen
ŽŔ‚Í•ű–@‚Ş–ł‚˘‚í‚Ż‚Ĺ‚Í‚Č‚˘BƒVƒ“ƒOƒ‹ƒoƒCƒgƒ‚[ƒh‚Č‚ç‚Ĺ‚Ť‚éB‚Ĺ‚ŕ–{“–‚É‚â‚č‚˝‚˘?
–{“–‚ɐ^Œ•‚É•K—v‚Ć‚ľ‚Ä‚˘‚é‚Č‚çA‚ą‚ĚƒXƒNƒŠƒvƒg‚ĹƒeƒXƒg3‚đ‚â‚Á‚Ä‚Ý‚Ä‚Ů‚ľ‚˘B

{
@@c = "[\\000-\\177]|[\\340-\\357][\\200-\\277][\\200-\\277]"
#@ print( length($0));
@@str = $0; print( gsub( c,"0",str));
@@print;
@@sub(/<tag>/, "");
@@sub(/<\/tag>/, "");
@@sub(/hello/, "ABC");
#@ sub(/.‚¤/, "U");
@@sub( sprintf("(%s)‚¤",c),"U")
@@print;
}

833ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/10/01(“y) 22:37:26.49ID:apxhHWta
‚â‚Á‚Ď‚č klabaster gawk ‚Í‚ć‚­‰đ‚ç‚Č‚˘B

$cat u2.awk
{
@@print( length($0))
@@sub(/‚¤/, "U")
@@print;
}
$LANG=C wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.EUC-JP wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.UTF-8 wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
gawk64: u2.awk:3: sub(//, "U")
gawk64: u2.awk:3: ^ unterminated regexp
gawk64: u2.awk:4: sub(//, "U")
gawk64: u2.awk:4: ^ unexpected newline or end of string
$

UTF-8 ‚Łu‚¤v‚Í 3 ƒoƒCƒg‚ž‚Š‚çAƒVƒtƒgJIS‚ʼnđŽß‚ľ‚˝Œ‹‰Ę
‚ť‚ĚŒă‚ë‚Ě / ‚ŕƒ}ƒ‹ƒ`ƒoƒCƒg•śŽš‚Ěˆę•”‚É‚Č‚é‚Ě‚ž‚낤‚ŠB
‚˘‚âAUTF-8 ‚ʼnđŽß‚ľ‚Ä‚­‚ę‚Č‚˘‚ą‚Ć‚É•ś‹ĺ‚đŒž‚˘‚˝‚˘‚ń‚ś‚á‚Č‚˘‚ń‚žB
UTF-8 ‚ŏ‘‚˘‚Ä‚ ‚é‚Ě‚É‚Č‚ş LANG=ja_JP.UTF-8 ‚ĚŽž‚ž‚ŻƒGƒ‰[‚É‚Č‚é‚Ě‚ž‚낤B

834ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/10/02(“ú) 00:14:27.80ID:lSw/Qfuv
‚ą‚Ě‹LŽ–‚đŒŠ‚é‚Š‚Ź‚č‚Ĺ‚ÍklabasterˆČŠO‚ĚWindows”Ĺgawk‚Ĺ‚ŕƒ_ƒ‚Á‚Ű‚˘‚Ĺ‚ˇ
https://groups.google.com/forum/#!topic/comp.lang.awk/coXxXOpeoXU

835ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/10/08(“y) 21:51:54.06ID:66+5bUgM
>>749‚Š‚ç‚ĚƒŒƒX‚ŁA$‚މ‰ŽZŽq‚ž‚Á‚˝‚́H@‚Ć‚˘‚¤‚悤‚Č‚Ć‚ą‚ë‚Ş‹C‚É‚Č‚Á‚Ä
­‚ľ’˛‚ׂĂ݂˝i’˛‚ׂ˝‚Ć‚˘‚¤‚Ů‚Ç‚Ěě‹Ć‚Í‚ľ‚Ä‚Č‚˘‚ŠjB

‚Ü‚¸‘ĐBŽčŽ‚ż‚̐”ű‚ĹŠm”FB
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKxiƒgƒbƒpƒ“@‰”Ĺ‘ć7üj
‚ł‚˘‚˛‚̂܂Ƃ߂ʼn‰ŽZŽqˆę——‚É‹LÚB–{•ś’†(p8)‚ł́u—“‚͏í‚É$1,$2‚̂悤‚É
ŽQĆ‚ľ‚Č‚­‚Ä‚Í‚˘‚Ż‚Č‚˘‚ĆŽv‚í‚ę‚Ä‚˘‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚ށAŽŔ‚Í$‚Ě‚ ‚Ć‚É‚Í,—“‚Ě
”ԍ†‚đŽw‚ľŽŚ‚ˇ‚˝‚ß‚Ě”CˆÓ‚ĚŽŽ‚đ‘‚˘‚Ä‚ŕ‚悢v‚Ə‘‚Š‚ę‚Ä‚˘‚éB‚Ü‚˝Ap46‚É‚Í
u—“•Ď”v‚̍€‚Ɂu“ü—͍s‚Ě—“ifieldj‚Í,$1,$2‚Š‚çŽn‚Ü‚Á‚Ä,$NF‚Ć‚˘‚¤–ź‚ĹŒÄ‚Î‚ę‚év
‚Ć‚Ě‹Lq‚Ş‚ ‚éB

wsed & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOxiƒAƒXƒL[o”ŋǁ@‰”Łj
‹Œ”ŁB–{•ś’†ip212j‚ŁuƒtƒB[ƒ‹ƒh‚đŽQĆ‚ľ‚˝‚˘‚Ć‚Ť‚ɂ́AƒtƒB[ƒ‹ƒh‰‰ŽZŽq$‚đŽg‚Ś‚΂悢v
‚Ü‚˝ip217j‚ŁuƒtƒB[ƒ‹ƒh‚đŽQĆ‚ˇ‚é‚ɂ̓hƒ‹‹L†($)‰‰ŽZŽq‚đŽg‚¤vAAppendixip471j‚Ĺ
u‚ť‚ę‚ź‚ę‚ĚƒtƒB[ƒ‹ƒh‚́A$1‚Č‚ç‚΍ŏ‰‚ĚƒtƒB[ƒ‹ƒh‚Ě’l‚đŽQĆ‚ľAv‚Ć•\Œť‚ł‚ę‚Ä‚˘‚éB
Appendix‚̉‰ŽZŽqˆę——‚É‹LÚB

wAWK‚đ256”{Žg‚¤‚˝‚ß‚Ě–{xiƒAƒXƒL[o”ŋǁ@‰”Łj
Appendix‚ʼn‰ŽZŽqˆę——‚É‹LÚ‚ł‚ę‚Ä‚˘‚é‚ŞA–{•śip65j‚Łu•Ş‰đ‚ł‚ę‚˝ŠeƒtƒB[ƒ‹ƒh‚́A
$n‚Ć‚˘‚¤•Ď”in‚́AŽn‚ß‚ĚƒtƒB[ƒ‹ƒh‚Š‚珇‚É1,2,3...‚Ć‚Č‚éB‚ŕ‚ż‚ë‚ń‘Ś’l‚Ě‘ă‚í‚č‚ɕϐ”‚đ
Žw’股‚é‚ą‚Ć‚ŕ‰Â”\‚žj‚ĹƒAƒNƒZƒX‚ˇ‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚év‚Ć‚ ‚éB‘ź‚Ě‰ÓŠ‚Ĺ‚ŕ$n•Ď”‚Ə‘‚˘‚Ä‚ ‚é
‚Ć‚ą‚ë‚Ş‚ ‚éBp66‚ŁuŠeƒtƒB[ƒ‹ƒh‚đ•\‚ˇ$n‚Ĺ‚ ‚é‚ŞA‚Č‚ş‚ą‚ń‚Č–ź‘O‚É‚Č‚Á‚Ä‚˘‚é‚Š‚˛‘ś‚ś‚ž‚낤‚ŠH
ŽŔ‚Í‚ą‚ę‚ŕUNIX•ś‰ť‚Š‚ç‚Ť‚Ä‚˘‚é‚Ě‚žBUNIX‚Ě‘ă•\“I‚ČƒVƒFƒ‹‚Ĺ‚ ‚ésh‚âcshiĹ‹ß‚Ĺ‚Íksh‚â
tcsh‚Š‚ȁHj‚ĚƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ě‚Č‚Š‚ĹƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒpƒ‰ƒ[ƒ^‚đ•\‚ˇ•Ď”‚Ć‚ľ‚Ä$n‚ŞŽg—p‚ł‚ę‚Ä
‚¨‚či’†—ށj‚ą‚ę‚É‚ ‚í‚š‚Äawk‚Ĺ$n‚ŞŽg—p‚ł‚ę‚Ä‚˘‚é‚悤‚Č‚Ě‚Ĺ‚ ‚év‚Ə‘‚˘‚Ä‚ ‚éB

wAWKŽŔ‘H“ü–ĺxi‹Zp•]˜_ŽĐ@‰”Łj
>>766‚É‚ ‚é‚悤‚É“Á•Ę‚ȕϐ”‚Ć‚ľ‚Ĉľ‚í‚ę‚Ä‚¨‚čAƒŠƒtƒ@ƒŒƒ“ƒX‚É‚ŕ$‚މ‰ŽZŽq‚Ĺ
‚ ‚é‚ą‚Ć‚Ě‹LÚ‚Ş‚Č‚˘B
i‘ą‚­j

8368352016/10/08(“y) 22:00:44.45ID:66+5bUgM
i‘ą‚Ťj
ƒlƒbƒg‚̏î•ńB2016.10.8ŒťÝB
Gnu Awk ƒ†[ƒU[ƒYƒKƒCƒh/The GAWK Manual/Effective AWK Programming
gawk‚̉đŕ‘Bƒo[ƒWƒ‡ƒ“ˆá‚˘‚Ş‚ ‚é‚悤‚ž‚ށA–|–ó”Ĺ‚Ĺ–Ú‚É—Ż‚Ü‚Á‚˝‚ŕ‚́B
u’萔‚Ĺ‚Č‚˘ƒtƒB[ƒ‹ƒh”ԍ†v‚̍€‚Łu‚ ‚éƒtƒB[ƒ‹ƒh‚đŽQĆ‚ˇ‚é‚˝‚߂ɁAawkŒžŒę‚Ĺ‚Ě”CˆÓ‚ĚŽŽ‚đ
`$'‚ĚŒă‚ĹŽg‚¤‚ą‚Ć‚Ş‚Ĺ‚Ť‚év‚Ć‹Lq‚ł‚ę‚Ä‚˘‚éBu‰‰ŽZŽq‚Ě—Dć‡ˆĘv‚̍€‚ł͉‰ŽZŽq‚Ć‚ľ‚Ä
•Ŕ‚ׂç‚ę‚Ä‚˘‚éB

man gawk
–|–ó”ŁAƒŠƒiƒbƒNƒXƒRƒ}ƒ“ƒh‚Ć‚˘‚¤ƒTƒCƒgiwww.linux-cmd.comj‚Š‚çB
u“ü—̓ŒƒR[ƒh’†‚ĚŠeƒtƒB[ƒ‹ƒh‚Ě’l‚́Aś‚Š‚ç $1, $2 “™‚Ć‚˘‚¤–ź‘O‚ĹŽQĆ‚Ĺ‚Ť‚Ü‚ˇB
$0 ‚̓ŒƒR[ƒh‘S‘Ě‚Ĺ‚ˇBƒtƒB[ƒ‹ƒh‚É’l‚đ‘ă“ü‚ˇ‚é‚ą‚Ć‚ŕ‚Ĺ‚Ť‚Ü‚ˇBƒtƒB[ƒ‹ƒh‚͒萔‚ž‚Ż‚Ĺ‚Č‚­A
•Ď”‚É‚ć‚Á‚ÄŽQĆ‚ˇ‚é‚ą‚Ć‚ŕ‚Ĺ‚Ť‚Ü‚ˇBv‚Ć‚Č‚Á‚Ä‚˘‚éB‰‰ŽZŽq‚Ě‚Ć‚ą‚ë‚É‹LÚ‚ ‚čB

AWK Users JP
ƒTƒCƒg’†uawk Šî‘b•ś–@Ĺ‘Źƒ}ƒXƒ^[v‚Ěƒy[ƒW‚Łu“ÁŽę•Ď”v‚̍€‚É$0,$1`$NF‚Ěŕ–žB
ƒtƒB[ƒ‹ƒhŽQĆ‚ĚŒę‚Í‚Č‚˘B‚Ü‚˝AƒŠƒtƒ@ƒŒƒ“ƒX“I‚ȉ‰ŽZŽq‚Ě‚Ü‚Ć‚ß‚Í‚Č‚˘iHjB
ƒy[ƒWă•”‚Ɂu‚ą‚Ě•ś‘‚͏‘‚Ť‚Š‚Ż‚Ĺ‚ˇv‚Ć‚ ‚é‚̂ŁA–˘Ž”ő‚Ć‚˘‚¤‚ą‚Ć‚ž‚낤‚ŠB

IBM Knowledge Center
awkƒRƒ}ƒ“ƒh‚Ěƒy[ƒWiwww.ibm.com/support/knowledgecenter/ja/ssw_aix_71/
com.ibm.aix.cmds1/awk.htmj‚ł́uƒŒƒR[ƒh‚ĆƒtƒB[ƒ‹ƒh‚É‚ć‚éƒtƒ@ƒCƒ‹ˆ—v‚̍€‚Ĺ
uŠeƒtƒB[ƒ‹ƒh‚̓tƒB[ƒ‹ƒh•Ď”‚É‚ć‚Á‚ÄŽQĆ‚ł‚ę‚Ü‚ˇBƒŒƒR[ƒh‚̍ŏ‰‚ĚƒtƒB[ƒ‹ƒh‚É‚Í $1 •Ď”A
2 ”Ô–Ú‚ĚƒtƒB[ƒ‹ƒh‚É‚Í $2 •Ď”‚Ć‚˘‚¤‚悤‚ɁA•Ď”‚ŞŠ„‚č“–‚Ä‚ç‚ę‚Ü‚ˇBv‚Ć‚Ě‹LqB­‚ľ‚¤‚ľ‚ë‚Ě
•űAuƒtƒB[ƒ‹ƒh•Ď”v‚̍€‚Ĺ‚ŕuƒtƒB[ƒ‹ƒh•Ď”‚́A$ (ƒhƒ‹‹L†) ‚Ć‚ť‚ę‚É‘ą‚­”’l‚Ü‚˝‚͐”’lŽŽ‚Ĺ
Žw’č‚ľ‚Ü‚ˇBv‚Ć‚ ‚éB$‚މ‰ŽZŽq‚Ĺ‚ ‚é‚ą‚Ć‚Ě‹LÚ‚Í‚Č‚˘B

‚Ä‚ČŠ´‚ś‚ŁAwƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKx‚Ĺ‚ŕu—“•Ď”v‚Ć‚˘‚¤•\Œť‚Ş‚ ‚čAŒë‰đ‚ľ‚ť‚¤‚ČŠ´‚ś‚Í‚ˇ‚éB
‚Ü‚˝A256”{–{‚ɏ‘‚˘‚Ä‚ ‚é‚悤‚ɃVƒFƒ‹ƒXƒNƒŠƒvƒg’†‚Ěƒpƒ‰ƒ[ƒ^‚Ć‚ľ‚Ä$n‚Ş‚ ‚é‚ą‚Ć‚Š‚çA$n‚Ş
i“Á•Ę‚ȁj•Ď”‚Ć‚ľ‚Ä”FŽŻ‚ł‚ę‚Ä‚ľ‚Ü‚Á‚Ä‚˘‚é‚Ě‚Ĺ‚Í‚Č‚˘‚ŠA‚Ć‚ŕ‘z‘œ‚ˇ‚éBŒÂlƒTƒCƒg‚Ěawk‚̉đŕ
ƒy[ƒW‚ł́A$n‚Ć‚˘‚¤•Ď”‚ɃtƒB[ƒ‹ƒh‚Ş‘ă“ü‚ł‚ę‚é‚Ćŕ–ž‚ľ‚Ä‚˘‚é‚Ć‚ą‚ë‚ŕ‚ ‚Á‚˝B‚ť‚̂悤‚É—‰đ‚ľ‚Ä
ƒXƒNƒŠƒvƒg‚đ‘‚˘‚Ä‚ŕ‚ł‚ľ‚Ä•s“s‡‚Í‚Č‚˘‚ž‚낤‚ȁA‚Ć‚ÍŽv‚¤‚ށB

837ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/10/08(“y) 23:11:50.50ID:ZMh6U7O9
L”Í‚Č’˛¸‰łBGawk‚Ěrefcard‚Ĺ‚ŕ‚ż‚á‚ń‚Ćoperator‚ÉŠÜ‚Ü‚ę‚Ä‚˘‚é‚Č‚ B
‰‰ŽZŽq‚Ć–žŠm‚É”FŽŻ‚ľ‚Ä‚˘‚Č‚­‚Ä‚ŕA$‚ĚŒă‚ÉŽŽOK‚ĆŽv‚Á‚Ä‚˘‚ę‚΍ˇ‚ľŽx‚Ś‚Č‚ł‚ť‚¤B

838ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/10/18(‰Î) 23:10:18.54ID:TQpGgbw6
gawk4‚Ŋ֐”ƒ|ƒCƒ“ƒ^‚Ý‚˝‚˘‚Č‚ŕ‚ń‚ޒljÁ‚ł‚ę‚Ü‚ľ‚˝‚Ż‚ǁA‚ą‚ęlength‚Ć‚Šsubstr‚Ě
‘gž‚݊֐”‚â@load‚ľ‚˝ŽŠědll‚̊֐”‚Ć‚Š‚É‚ŕŽg‚Ś‚é‚ń‚Ĺ‚ˇ‚Ë
ˆÄŠO•Ö—˜‚Š‚ŕ

@load "hage.dll"
@BEGIN{
@kumi = "length"
@func = "hagefunc"
@ng[1] = "substr"
@print @kumi("ABC")
@print @func("œc Ü ƒ~ ")
@print @ng[1]("XYZ", 1, 1) # ”z—ń‰z‚ľ‚ɌĂڂ¤‚Ć‚ľ‚˝‚çsyntax errorEEEŽc”O
}

839ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/10/21(‹ŕ) 17:10:59.85ID:MQQBNMPM
>>756
‚ą‚¤‚˘‚¤‰ß‘aƒXƒŒ‚Ĺ–ł‘Ę‚É“Ë‚Á‚Š‚Š‚Á‚Ä‚­‚é‚â‚‚ނŠ‚‚­‚ń‚ž‚ŞŽ€‚Ë

840ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/11/23(…) 00:01:26.03ID:bt3mTQnz
>>839
ƒu[ƒƒ‰ƒ“‚Š‚ć‚—‚—‚—

841ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/11/23(…) 01:18:15.98ID:noM2Pdp3
_‚¨‚Í‚°‚ž[I^

842ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2016/11/30(…) 02:56:38.28ID:PeC/aWZc

843‚b‰SŽŇ2017/02/28(‰Î) 13:18:15.09ID:Mb8mQo1M
‚‚—‚‹ƒXƒNƒŠƒvƒg‚đ‚bƒ\[ƒX‚É•ĎŠˇ‚ľ‚ăRƒ“ƒpƒCƒ‹‚ˇ‚é‚˝‚߂́u‚‚—‚‹‚v‚Ć‚˘‚¤ƒc[ƒ‹‚Ĺ‚Ĺ‚Ť‚é‚ž‚ŻŠČ’P‚É‚t‚s‚e|‚WƒTƒ|[ƒg‚ł‚š‚é•ű–@‚đ’m‚č‚˝‚˘‚Ĺ‚ˇB
ƒlƒbƒg‚ĹŽUX’˛‚ׂ܂ľ‚˝‚Ş‚Č‚˘‚悤‚Ĺ‚ˇH

844ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/02(–Ř) 00:28:53.73ID:CDxvUfiY
‚ą‚ĚƒXƒŒ‚ŕ‚P‚OŽü”N‚Š

845ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/05(“ú) 09:28:55.73ID:EQCsqksH
>>843
‚ť‚ę‚Ş‚ ‚Č‚˝‚ĚŒťÝ‚ĚŽŔ—Í‚ž‚Á‚˝‚Ć‚˘‚¤‚ą‚Ć‚Ĺ‚ˇ
‚¨”ć‚ę—l‚Ĺ‚ľ‚˝

846ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/05(“ú) 14:45:26.28ID:KmKKYedf
gawk‚ɑΉž‚ľ‚Ä‚é‚Č‚ç‘ĺä•v‚Á‚Ä‚ą‚Ć‚Š‚ȁH
ascii‚ľ‚Šl‚Ś‚Ä‚˘‚Č‚˘‚Č‚çAƒ\[ƒX‘Sƒ`ƒFƒbƒNcB
—v‚ˇ‚é‚ɁA“ú–{Œę‰ť‚ˇ‚é‚ń‚ž‚낤‚Ż‚ǁB

‘S‘R•Ę‚ĚŒžŒę•ĎŠˇ‚É‚ż‚ĺ‚Á‚Ć™ů‚ń‚ž‚ą‚Ć‚Ş‚ ‚é‚ń‚ž‚Ż‚ǁA
ť•i‰ť‚ľ‚ż‚á‚Á‚Ä‚Š‚çƒ_ƒuƒ‹ƒoƒCƒgl—ś‚ľ‚Ä‚Č‚˘‚ą‚Ć‚Ş‚í‚Š‚Á‚āA‚Š‚Č‚č–Ę“|‚ž‚Á‚˝B

‚Ć‚č‚ ‚Ś‚¸•ĎŠˇ‚ľ‚Ä‚Š‚çAƒ\[ƒXŒŠ‚Ä’ź‚ˇ‚Ů‚¤‚Ş‘‚Š‚Á‚˝‚čiÎ

‚Ş‚ń‚΂Á‚ĂˁB

847ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 11:39:31.22ID:FdaYmB9f
awk‚Ł@$1,$2...$6 ‚ą‚ń‚ȏo—Í‚đŤ‰ş‚É‚ľ‚˝‚˘‚ń‚ž‚Ż‚ǁ@‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ˇ‚Š‚ˁH
470230
470290
Ť
002347
002479

848ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 12:33:46.83ID:FW5jfGh1
GNU awk ‚Ě asort() ‚đŽg‚¤‚Ć‚ŠB

printf '470230\n470290\n' |
gawk -vFS= -vOFS= '{
for(i=1;i<=NF;i++){
arr[i]=$i
};
asort(arr);
for(i=1;i<=NF;i++){
$i=arr[i]
};
print
}'

849ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 15:19:43.83ID:FdaYmB9f
‚ ‚č‚Ş‚Ć‚¤
gawk ‚˘‚ę‚Č‚˘‚Ĺ‚Č‚ń‚Ć‚Š‚Č‚ç‚Č‚˘‚Š‚Č

850ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 17:28:40.15ID:FW5jfGh1
‚¤`‚ńA‚ť‚¤‚Č‚é‚Ć awk ‚đŽg‚í‚Č‚­‚Ä‚ŕ‚˘‚˘‚Š‚Č

printf '470230\n470290\n' |
while read -r n
do
echo "$n" | grep -o . | sort -n | tr -d '\n'; echo
done

851ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 19:23:27.89ID:08XsJPyW
>>840
‚ž‚Š‚çƒu[ƒƒ‰ƒ“‚Ć‚Š‚ť‚¤‚˘‚¤‚ĚŠÖŒW‚Č‚˘‚Š‚玀‚Ë‚Á‚ÄŒž‚Á‚Ä‚ń‚ž‚ëƒJƒX
Ž€‚Ë

852ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 19:24:30.15ID:08XsJPyW
>>844
”S’…‚Ş10”NˆĘ‰„–˝‚ľ‚Ä‚ŕ‰˝‚ŕ‚ˇ‚˛‚­‚Ë‚Ś‚ć
“Ë‚Á‚Š‚Š‚Á‚Ä‚Ť‚˝‚Ô‚ż‚ą‚낡‚źŽG‹›Ž€‚Ë>>840

853ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/06(ŒŽ) 19:26:33.18ID:08XsJPyW
>>840
ƒu[ƒƒ‰ƒ“‚Ć‚Š‚ś‚á‚Č‚­‚ÄŽ€‚Ë‚Á‚ÄŒž‚Á‚Ä‚ń‚ž‚Š‚玀‚˃{ƒP

854ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/07(‰Î) 08:17:48.93ID:6Hf5Xh2e
‚¨”ć‚ę—l‚Ĺ‚ľ‚˝

855ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/09(–Ř) 21:48:39.65ID:0T9qj2kA
˜A‘z”z—ń‚Ĺ
echo '470230' | awk 'BEGIN{FS=""}{for(i=1;i<=NF;i++){a[$i]++}for(i=0;i<=9;i++){for(j=1;j<=a[i];j++){printf("%s", i)}}printf("\n")}'
002347

856ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/10(‹ŕ) 00:18:57.87ID:+B1nKlhG
Šů‚ɔے肳‚ę‚Ä‚˘‚é‚Şgawk4‚Ş‚ŕ‚ľŽg‚Ś‚˝‚ç
awk '{ORS="";PROCINFO["sorted_in"]="@val_num_asc";x=split($0,a,"");for (i in a)print a[i];print "\n"}'

857ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/03/10(‹ŕ) 04:05:38.25ID:wGo6zQ56
Ĺ‹ß‚Ě gawk ‚Č‚çƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚Ş—pˆÓ‚ł‚ę‚Ä‚Ä join ‚Ć‚ŠŽg‚Ś‚˝‚č

gawk -vFS= -vOFS= -i join.awk '{split($0,a,"");asort(a);print join(a,1,length(a),SUBSEP)}'

858ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń2017/04/04(‰Î) 22:35:43.00ID:9/WMFGSO
# gawk4‚Ě“Çž‚݃^ƒCƒ€ƒAƒEƒg‹@”\A‚Ż‚Á‚ą‚¤•Ö—˜‚ť‚¤EEE‚ž‚Ż‚ÇWindows‚ÍCygwin”Ĺ‚ś‚á‚Č‚˘‚ĆŽg‚Ś‚Č‚˘BŽc”O–ł”OB
BEGIN{
@ PROCINFO["/dev/stdin", "READ_TIMEOUT"] = 180000
@ print "3•ŞŠÔ‘Ň‚Á‚Ä‚â‚é"
@ getline t < "/dev/stdin"
@ if (t=="ƒoƒ‹ƒX") {
@ @ print "‚ ‚ c‚ ‚ c–Ú‚Ş‚ ‚Ÿ‚Ÿ‚Ÿ‚Ÿ‚Ÿ`I"
@ }
@ else {
@ @ print "ŽžŠÔ‚žI“š‚Ś‚đu‚ą‚¤I"
@ }
}

V’…ƒŒƒX‚Ě•\ŽŚ
ƒŒƒX‚đ“Še‚ˇ‚é