‚Q‚ż‚á‚ń‚Ë‚é šƒXƒ}ƒz”Łš ĄŒfŽŚ”‚ɖ߂遥 ‘S•” 1- ĹV50  

awk‚ɂ‚˘‚ÄŒę‚éƒXƒŒ $2

1 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/23(‹ŕ) 23:55:42
•…‚Á‚Ä‚ŕ‘âH éuűű‚ŕ˜V‚˘‚Ä‚Íém”n‚É—ň‚éH
ŽOl‚̐׊w‚ސś‚ݏo‚ľ‚˝ƒXƒNƒŠƒvƒgŒžŒęAWK‚ɂ‚˘‚ÄŒę‚éƒXƒŒ

Ÿ ‘OƒXƒŒ
awk‚ɂ‚˘‚ÄŒę‚éƒXƒŒ
http://pc10.2ch.net/test/read.cgi/tech/1023556171/

Ÿ ŠÖŒWƒXƒŒ
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘Š’kŽş
http://pc10.2ch.net/test/read.cgi/tech/1112553783/
AWK‚ĹCGI
http://pc10.2ch.net/test/read.cgi/php/1171804314/
ysedzƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘‡@LINUX Part2yawkz
http://pc10.2ch.net/test/read.cgi/linux/1154578200/

Ÿ ŽQl
The AWK Programming Language (Brian Kernighan)F
ttp://cm.bell-labs.com/cm/cs/awkbook/index.html

GAWK (GNU Projedt):
ttp://www.gnu.org/software/gawk/

2 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/24(“y) 00:04:13
awking shoes

3 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/24(“y) 00:24:49
ƒI[ƒN
ƒI[ƒN
ƒI[ƒN

@‰œ‚ł‚ń

4 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/24(“y) 01:35:13
‘˝‚­‚ÍŒę‚é‚Ü‚˘B

Mawk - Mike' AWK
http://gnuwin32.sourceforge.net/packages/mawk.htm

5 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/24(“y) 23:32:05
‚˘‚â‘˝‚­‚đŒę‚Á‚Ä‚­‚ę

6 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/25(“ú) 06:34:37
ƒ[ƒJƒ‹•Ď”AB

7 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/27(‰Î) 21:39:18
ƒNƒ[ƒWƒƒ‚đŽ‚Á‚˝awkŽŔ‘•‚Ć‚Š‚Č‚˘‚Š‚Ë

8 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/27(‰Î) 23:45:59
ƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ĺ‚ż‚ĺ‚ż‚ĺ‚Á‚ĆŽg‚¤‚ą‚Ć‚Í•p”É‚É‚ ‚é‚Ż‚Ç
‹C‡‚˘“ü‚ę‚ăvƒƒOƒ‰ƒ~ƒ“ƒO‚ˇ‚é‚Á‚Ä‚Ě‚ÍĹ‹ß–ł‚­‚Č‚Á‚˝B

9 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/02/28(…) 00:13:16
>>7
‘OƒXƒŒ‚ÉObjective awk‚ŞŽŔÝ‚ˇ‚é‚Š‚̂悤‚Č˜b‚Ş‚ ‚é‚Şƒlƒ^‚ž‚낤B
ŽŔ—pŤ‚𖳎‹‚ˇ‚ę‚ÎawkŽŠg‚ŏ‘‚­‚ą‚Ć‚ŕ•s‰Â”\‚Ĺ‚Í‚Č‚˘‚Š‚ŕ‚ľ‚ę‚Č‚˘B
‚¨–]‚݂Ɉę”Ô‹ß‚˘ŽŔ‘•‚́AŽŔ‚ÍJavaScript‚Ĺ‚Í‚Č‚˘‚Š‚ƁB
http://developer.mozilla.org/ja/docs/New_in_JavaScript_1.7

10 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/01(–Ř) 00:43:46
ƒgƒbƒpƒ“‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK‚ރuƒbƒNƒIƒt‚Ĺ105‰~‚Ĺ’@‚Ť”„‚ç‚ę‚Ä‚é‚Ě‚đŒŠ‚Ä
‚Č‚ń‚Š”ß‚ľ‚˘‹C•Ş‚É‚Č‚Á‚˝

11 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/01(–Ř) 16:01:47
>>10
‰´‚ŕƒIƒ‰ƒCƒŠ[‚́used & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOv–{‚ށA}‘ŠŮ‚́u–ł—ż‚ĹŽ‚Á‚Ä‚Ż[’Iv
‚É‚ ‚Á‚˝‚̂ŁA‘Ś GET ‚ľ‚˝B‚Ü‚ A‚Š‚Č‚čŒĂ‚˘–{i1991 ”Nj‚ž‚Ż‚ǁA“ŕ—e‚Í‚˘‚˘–{‚žB
’艿 \3800 ‰~‚ĚƒoƒJ‚–{‚ŁA ‚˝‚Ô‚ńAV‘‚Ĺ‚Í”ƒ‚í‚Č‚Š‚Á‚˝‚ž‚낤B

ƒgƒbƒpƒ“‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK‚Á‚āA‚˘‚‚˛‚ë‚Ě–{‚ž‚Á‚˝‚ŻB‚Ć‚č‚ ‚Ś‚¸A105‰~‚Č‚ç
—~‚ľ‚˘‚Á‚ˇB

12 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/01(–Ř) 21:49:42
>>11
Ô‚˘•\Ž†‚Ě‘ć‚P”Ĺ‚ž‚Ë‚Ť‚Á‚ƁB
—΂̕\Ž†‚Ě‘ć‚Q”Ĺ‚ŞŽčŒł‚É‚ ‚é‚Ż‚ǁAgawk‚ĹŠg’Ł‚ł‚ę‚Ä‚˘‚é
ł‹K•\Œť‚Ěŕ–ž‚Ć‚Š‘‚Ś‚Ä‚Ä‘ć‚Q”Ĺ‚Ě‚Ů‚¤‚Ş‚¨ŠŠ‚߁B
‚ż‚Ȃ݂ɒ艿‚S‚P‚O‚O‰~‚Č‚čB

13 F11F2007/03/01(–Ř) 23:52:54
>>12
> Ô‚˘•\Ž†‚Ě‘ć‚P”Ĺ‚ž‚Ë‚Ť‚Á‚ƁB
‚ť‚¤A‚ť‚ę‚ť‚ęB ‚Ů‚ń‚ŁA
gensub ‚Ş‚Č‚˘B‚ŕ‚ż‚ë‚ńA
/inet/..... |& ....@‚ŕ‚Č‚˘B

Ĺ‹ßA/inet/..... |& ....@‚Ş‚ ‚éigawk3.1 ‚Š‚çj‚ą‚Ć‚đ’m‚Á‚āAgawk ‚đŒŠ’ź‚ľ‚Ä‚˘‚éB
Žg‚˘ŽĚ‚Ä‚ĚƒvƒƒOƒ‰ƒ€‚Í gawk ‚ɏ`!!B


14 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/02(‹ŕ) 02:09:03
>>11
ƒgƒbƒpƒ“‚̍ŏ‰‚Ě–{‚Č‚çŠm‚Š1990”N‚̏t ‚ž‚Á‚˝‚ĆŽv‚¤B
ˆę‰žnawkƒŒƒxƒ‹‚Ě‹Lq‚Ě‚Í‚¸‚Č‚ń‚ŁAgawk‚Č‚ń‚Š‚ĚŒĹ—L‚Ě
Šg’Ł‚đœ‚Ż‚Ώ\•ŞŽg‚Ś‚é‚Ĺ‚ľ‚ĺB

105‰~‚́c‚ż‚Ɣ߂ľ‚˘‚Ż‚Ç‚˘‚˘l‚ɏE‚í‚ę‚Ä—~‚ľ‚˘‚Ë‚ŚB


15 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/02(‹ŕ) 02:27:22
>>13
gawk‚Ě /inet Šg’Ł‚Á‚ăCƒ}ƒCƒ`Žg‚˘‚Ă‚ç‚­‚Ë?

”Ä—p“I‚Č‚Ě‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁA‚¨ŽčŒy‚ÉhttpŒo—R‚Ĺwebƒy[ƒW‚Ě
“ŕ—eŽć‚ę‚ę‚΂˘‚˘‚Á‚Ä‚Ć‚Ť‚É‹Lq‚Ş–Ę“|B


16 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/04(“ú) 00:06:22
>>15
’Pƒ‚É

gawk '{print $0}' http://foo.org/index.html

‚Ć‚Š‚ĹƒV[ƒ€ƒŒƒX‚ɃAƒNƒZƒX‚Ĺ‚Ť‚é‚Ć‚˘‚¤‚Ů‚¤‚Ş•Ö—˜‚Č‚Ě‚Š‚Č?

17 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/04(“ú) 00:24:42
http://www.gnu.org/software/gawk/manual/gawkinet/gawkinet.html#Web-page
‚Š‚çAŠČ’P‚Č—áB

BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/www.yahoo.com/80"
print "GET http://www.yahoo.com" |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}


18 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/04(“ú) 00:38:54
awk‚ĹSQL‚Ěleftjoin‚Ý‚˝‚˘‚Č‚ą‚Ć‚Ĺ‚Ť‚éH

19 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/04(“ú) 01:55:43
>>17
‚Č‚ń‚ś‚á‚ą‚č‚áB
wget -O - http://www.yahoo.com/ ‚̏o—Í‚đ“Ç‚Ţ‚Ě‚Ć‘S‘R•Ď‚í‚ç‚ń‚ȁB

20 F15F2007/03/04(“ú) 03:46:24
>>16
‚Ü‚  wget‚Ć‚ŠcurlŽg‚Á‚Ä•W€“ü—Í‚Š‚çŽć‚ę‚ć‚Ć‚˘‚¤˜b‚ŕ‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁA
http://‚Ů‚°‚Ů‚° ‚Í“Á•Ęˆľ‚˘‚ľ‚Ä‚­‚ę‚é‚Ć‚¤‚ę‚ľ‚˘‚Č‚ ‚ĆŽv‚Á‚Ä‚éB

‚Ü‚ HTML“Ç‚ń‚Ĺ‚ť‚ę‚đ‰đÍ‚ˇ‚éŽčŠÔ‚ŞŽŸ‚É‘Ň‚Á‚Ä‚é‚Ż‚Ç‚łw


21 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/04(“ú) 03:55:11
ƒGƒ“ƒR[ƒfƒBƒ“ƒO‘Ήž‚Ć‚ŠFXl‚Ś‚é‚ƁAawk‚ĹHTML‚đˆ—‚ľ‚悤‚Ć‚ˇ‚é‚Ů‚¤‚Ş
–ł—‚Ş‚ ‚銴‚śB
‘f’ź‚ÉP‚Ĺ‚Í‚ś‚܂錞Œę‚Ć‚ŠŽg‚Á‚Ć‚Ż‚΁H‚Ý‚˝‚˘‚ȁB

22 F19F2007/03/04(“ú) 04:55:31
>>21
P‚Ć‚ŠRŽg‚Ś‚Á‚Ä‚Ě‚Í‚Ü‚ ‚ť‚¤‚Č‚ń‚ž‚Ż‚ǁAHTML‚Ě‘Ă“–Ť‚Ć‚ŠƒGƒ“ƒR[ƒfƒBƒ“ƒO‚đ‹C‚É‚ľ‚Č‚˘‚Ĺ
‚˘‚˘Žg‚˘“š‚ōl‚Ś‚Ä‚˝(ŒÂl“I‚É‚ť‚¤‚˘‚¤Žů—v‚Ş‚ ‚é)‚̂łˁB
HTML‚ÉŠÖ‚ľ‚Ä‚Í‚Ť‚ż‚ń‚Ć‚ľ‚˝ƒhƒLƒ…ƒƒ“ƒg‚Č‚çxgawk‚Ĺ‚Ç‚¤‚É‚Š‚Č‚é?




23 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/14(…) 16:26:36
ĚAFortranAC‚Ž‚炢‚ľ‚Š’m‚ç‚Č‚Š‚Á‚˝ŽžA
u‚Ś‚ÁA‚ą‚ń‚Ȑ”s‚ĹŒvŽZo—ˆ‚é‚́Hv
uƒvƒƒOƒ‰ƒ€“ŕ‚Ƀtƒ@ƒCƒ‹–ź‘‚Š‚Č‚­‚Ä—Ç‚˘‚́Hv
u‚ą‚̐”s‚ŁA‚ˇ‚×‚Ä‚Ěƒf[ƒ^‚ĚŒvŽZ‚ľ‚Ä‚­‚ę‚é‚́Hv
‚Á‚āA‹Á‚Ť‚Č‚Ş‚ç—Fl‚É‹ł‚Ś‚Ä‚ŕ‚炢‚Ü‚ľ‚˝B
Ą‚Č‚çAExcel‚Ĺ‚ˇ‚é‚悤‚ČŒvŽZ‚Í‚ˇ‚ׂÄawk‚Ĺ‚ľ‚Ä‚Ü‚ľ‚˝B
ƒAƒXƒL[‚Š‚ç256”{ƒVƒŠ[ƒY‚ޏo‚˝‚Ž‚炢‚ž‚Š‚ç
’–Ú‚ĚŒžŒę‚ž‚Á‚˝‚ń‚ž‚ć‚ˁB



24 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/03/14(…) 16:40:22
Visicalc‚Ć1-2-3‚Íawkƒu[ƒ€‚ć‚čĚ‚Š‚ç‚ ‚Á‚˝‚ń‚ž‚Ż‚ǂˁB
UNIX‚Á‚ĈӊO‚ĆŒĂ‚­‚Č‚˘‚ń‚ž‚ć‚ˁB

25 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/04/14(“y) 08:00:42
>10
”­sŠ‚ސV‹IŒłŽĐ‚́uƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKv‚đ2005”N‚ɒ艿3465‰~iĹžj‚Ĺ”ƒ‚˘‚Ü‚ľ‚˝B
‰œ•t‚Ɂu–{‘‚Í1989”N11ŒŽ‚ÉŠ”ŽŽ‰ďŽĐƒgƒbƒpƒ“‚ć‚č”­s‚ł‚ę‚Ü‚ľ‚˝B‚ą‚Ě“xAŠ”ŽŽ‰ďŽĐV‹IŒłŽĐ‚ć‚čAŒ´o”ŎЁA–óŽŇ‚Ě‹–‰Â‚đ“ž‚ÄÄ”­s‚˘‚˝‚ľ‚Ü‚ľ‚˝Bv‚Ə‘‚Š‚ę‚Ä‚˘‚Ü‚ˇB

26 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/04/14(“y) 09:43:47
V‹IŒłŽĐ‚Á‚ÄRPG‚Ě–{‚ľ‚Šo‚ľ‚Ä‚Č‚˘‚ĆŽv‚Á‚Ä‚˝‚Š‚çˆÓŠO‚žB


27 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/04/14(“y) 13:42:47
‘ĺĚ‚É’Ę‚Á‚Ä‚˝‚ę‚Ě“y–؍HŠw‰Č‚É‚Íawk‚ĚŽö‹Ć‚Ş‚ ‚Á‚˝
ŽŔŒą‚Ěƒf[ƒ^ˆ—‚É‚Ĺ‚ŕŽg‚Á‚Ä‚Ů‚ľ‚Š‚Á‚˝‚ń‚ž‚낤

28 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/04/16(ŒŽ) 17:34:08
>24
awkƒu[ƒ€‚́Aź—ď‚ž‚Ɖ˝”N ‚Ĺ‚ľ‚傤‚Š?

29 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/04/17(‰Î) 00:31:15
>>28
DOS––ŠúB256”{–{‚ޏo‚˝93”N ‚ރs[ƒN‚ł́B
Œă‚ĚPerl‚Ć‚Í”äŠr‚É‚Č‚ç‚Č‚˘ƒvƒ`ƒu[ƒ€‚ž‚Ż‚ǁB

30 F28F2007/04/17(‰Î) 08:45:33
>29
Œä‰ń“š‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

31 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/05/04(‹ŕ) 21:28:49
Ĺ‹ß‚̏î•ń‚́A‚ą‚ż‚çI
ttp://gauc.no-ip.org/

32 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/07/14(“y) 08:27:58
‹SŽÔawk‚đ’N‚Šě‚Á‚Ä‚­‚ę‚Č‚˘‚Š‚ȁ[


33 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/07/15(“ú) 03:17:40
>>32
‚˘‚˘‚ą‚ĆŒž‚¤‚Ë‚ĽB
Ž^Ź!

34 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/03(ŒŽ) 08:59:45
‚ ‚Ćƒ[ƒJƒ‹•Ď”‚Ş—~‚ľ‚˘‚Č

35 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/03(ŒŽ) 10:30:14
function‚Ě’†‚̓[ƒJƒ‹•Ď”‚É‚Č‚é‚ćB

36 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/04(‰Î) 00:12:17
‚˘‚‚Š‚çH–˘‚ž‚Ɉř”‚É•Ŕ‚ׂé‚ŕ‚ń‚ž‚ƁB

37 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/04(‰Î) 09:33:02
‚ [A‚˛‚ß‚ńAˆř”•Ŕ‚ׂ˝‚â‚‚ރ[ƒJƒ‹•Ď”‚É‚Č‚éB‚ž‚Á‚˝B
ć‚ɐ錞‚ˇ‚ę‚΂˘‚˘‚ń‚ž‚Š‚ç•Ę‚É‚ć‚­‚ˁH

38 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/09(“ú) 04:42:02
ƒLƒ‚‚˘‚â‚ńB‚ť‚Ě‚â‚č•űB

39 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/14(‹ŕ) 04:37:24
‚ą‚ę‚Š‚çawk‚đ•×‹­‚ľ‚Ü‚ˇB

40 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/14(‹ŕ) 09:05:13
awk‚đŠw‚Ô‚ą‚Ć‚É‚Č‚é‚Ĺ‚ľ‚傤B

41 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/15(“y) 01:03:04
‚Ý‚Č‚ł‚ńawk‚ÍŒę‚ç‚Č‚˘‚Ě‚Ĺ‚ˇ‚ˁB

42 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/15(“y) 10:28:44
‘D“Şawk‚ľ‚Ä‘DŽR‚É“o‚éB

43 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/16(“ú) 03:03:51
l‚ÉŒž‚Ś‚é‚Ů‚Çawk’m‚Á‚Ä‚é–ó‚Ĺ‚ŕ–ł‚˘‚ľ

44 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/16(“ú) 10:27:22
‚ž‚Ż‚ǐl‚Ě˜b‚Í•ˇ‚Ť‚˝‚˘‚ľ

45 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/17(ŒŽ) 18:12:15
awk‚Ú—˜’Ę

46 Fcat.awkF2007/09/19(…) 08:55:44
1

47 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 16:41:49
awk‚đ•×‹­‚ľ‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚ށAPerl‚ÉŠľ‚ę‚Ä‚˘‚é‚Š‚ç‚Š
awk‚Ĺ‚Ĺ‚Ť‚é‚ą‚Ć‚ÍPerl‚Ĺƒƒ“ƒ‰ƒCƒi[‚Ĺ‚â‚Á‚˝‚Ů‚¤‚Ş(­‚Č‚­‚Ć‚ŕŽŠ•Ş‚É‚Ć‚Á‚Ä‚Í)‘Ź‚˘‹C‚Ş‚ľ‚Ä‚Č‚č‚Ü‚š‚ńB
‚ą‚ę‚ɂ‚˘‚Äawkn—űŽŇ‚Ĺ‚ ‚éŠF—l‚Í‚˘‚Š‚Ş‚¨l‚Ś‚É‚Č‚č‚Ü‚ˇ‚ŠH
‚ą‚¤‚˘‚¤Žž‚Íawk‚Ě‚Ů‚¤‚Ş•Ö—˜I‚Ć‚˘‚¤—á‚É‚Í‚Ç‚ń‚Č‚ŕ‚Ě‚Ş‚ ‚č‚Ü‚ˇ‚ŠH

48 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 16:43:11
Ş‚ ‚Á‘Ź‚˘‚Ć‚˘‚¤‚̂́AƒR[ƒh‚đ‘‚­‚Ě‚Ş‘Ź‚˘‚Ć‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB

49 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 16:48:06
>>47
perl ‚Í‚Č‚­‚Ä‚ŕ awk ‚Č‚ç“ü‚Á‚Ä‚˘‚鎖‚Ş‚ ‚é

50 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 16:53:58
uƒR[ƒh‚đ‘‚­‚Ě‚Ş‘Ź‚˘v‚Ć‚˘‚¤Šî€‚ŁA
u‚ą‚¤‚˘‚¤Žž‚Íawk‚Ě‚Ů‚¤‚Ş•Ö—˜v‚Ć‚˘‚¤—á‚𑟐l‚É‹“‚°‚ł‚š‚Ä‚ŕA
‚ť‚ę‚Í‚ť‚̐lŠÔ‚É‚Ć‚Á‚Ä‚Ě‘Ź‚˘‹C‚Ş‚ˇ‚é•Ö—˜‚ł‚Ĺ‚ ‚Á‚āA
ˆÓ–Ą‚Ě‚ ‚éˆę”Ę“I‚Č‹c˜_‚É‚Č‚ç‚Č‚˘‚Ě‚Ĺ‚Í‚Č‚˘‚ŠH

51 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 16:57:51
Perl‚ŕRuby‚ŕPython‚ŕŽg‚¤‚Ż‚ǁA“Á’č‚ĚƒJƒ‰ƒ€‚ž‚Ż‚É‹ť–Ą‚Ş‚ ‚éƒP[ƒX‚Í
–łˆÓŽŻ‚Éawk‚đŽg‚¤‚ą‚Ć‚ŕ‚ ‚éB

perl -a ‚Ć‚Š cut‚ľ‚Äpaste‚Ć‚Š‚ŕ‚ ‚é‚Ż‚ǁB


52 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 18:19:27
>>49 ŠÂ‹Ť‚É‚ć‚炸“ü‚Á‚Ä‚˘‚é‚Ć‚˘‚¤‚ą‚Ć‚Ĺ‚ˇ‚ˁB

>>50@‚ť‚¤‚Ĺ‚ˇ‚ˁB
‚Č‚şawk‚Č‚Ě‚ŠA
ˆę”Ę“I‚É‚Í‚Ç‚¤‚˘‚¤Žž‚Éawk‚ŞŽg‚í‚ę‚é‚Ě‚ŠA
‚Ć‚˘‚¤‚Ě‚ŞƒCƒ}ƒCƒ`ŽŠ•Ş‚Ě‚Č‚Š‚Ĺ•Ş‚Š‚Á‚Ä‚˘‚Č‚˘‚Ě‚Ĺ‚ˇB

>>51 ­‚ľ•×‹­‚ľ‚˝ŒŔ‚č‚ł́AŠm‚Š‚ɃJƒ‰ƒ€‚ĚŽć‚čo‚ľ‚Íawk‚Ş•Ö—˜‚Č‚Ě‚Š‚ŕ‚ĆŽv‚˘‚Ü‚ľ‚˝B



53 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 19:55:33
>>52
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ě’†‚ŁA•nŽă‚ČƒVƒFƒ‹‚ĚŒvŽZ”\—Í‚đ
•â‚¤‚˝‚߂ɁAƒc[ƒ‹ƒ{ƒbƒNƒX‚Ěˆę‚‚Ƃľ‚ÄŽg‚í‚ę‚é‚ą‚Ć‚Ş‘˝‚˘B

‚̂ŁAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚đ‘‚­‹@‰ď‚Ş‘˝‚˘‚Ě‚Č‚çA‚â‚Á‚Ä‚¨‚˘‚Ä
‘š‚Í–ł‚˘‚ĆŽv‚¤‚ށAƒtƒbƒgƒvƒŠƒ“ƒg‚Ş‘˝­ƒfƒJƒC‚ą‚Ć‚Ć‚â‚âˆÚAŤ‚É
Œ‡‚Ż‚é‚ą‚Ć‚đ‹C‚É‚ľ‚Č‚Ż‚ę‚΁A•Ę‚ÉPerlŽg‚Á‚˝‚Á‚Ä‚˘‚˘‚í‚Ż‚ž
i‚Ç‚¤‚šĄ‚Č‚ç‘ĺ’ď‚ÍŽg‚Ś‚é‚ž‚낤‚ľAawk‚É‚ľ‚Ä‚ŕˆę‰žPosix•W€‚ž‚Ş
FX•ĎŽí‚Ş‚ ‚éjB

‚܁A’P‚É•Ö—˜‚ČƒXƒNƒŠƒvƒgŒžŒę‚Ş—~‚ľ‚˘‚ž‚Ż‚Č‚çAĄXawk‚đ‚â‚éˆÓ–Ą‚Í
‚Ů‚Ć‚ń‚Ç‚Č‚˘‚ž‚낤B
ƒtƒB[ƒ‹ƒh•ŞŠ„‚ž‚Ż‚Č‚çperl -a‚Ĺawk‚̐^Ž—‚Ş‚Ĺ‚Ť‚é‚ľ‚ȁB

54 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 20:06:52
>>53 ’š”J‚Č‚¨•ÔŽ–‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
ƒVƒFƒ‹‚ĚŒvŽZ‚Ě•â•‚Ĺ‚ˇ‚ŠB
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚đ‘‚­‹@‰ď‚Í‘˝­‚Í‚ ‚é‚̂ŁA‘˝­‚ÍŠo‚Ś‚Ä‚¨‚ą‚¤‚ĆŽv‚˘‚Ü‚ˇB

55 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 21:00:04
awk‚Ćper‚ŒAˆ—‘Ź“x‚Í‚Ç‚Á‚ż‚Ş‘Ź‚˘‚ń‚ž‚ëH
‚Á‚ăIƒ}ƒG‚ŞŽŽ‚š‚Á‚ÄŒž‚í‚ę‚ť‚¤‚ž‚Ż‚Ç‚Ó‚ĆŽv‚Á‚˝‚ń‚ŏ‘‚˘‚Ä‚Ý‚˝B

56 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 22:17:45
awk‚͏ˆ—Œn‘˝‚˘‚Š‚ç‚Č‚Ÿ
‰˝‚̏ˆ—‚Š‚É‚ŕ‚ć‚é‚ž‚낤‚ľ

57 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 23:45:00
‚Ç‚ż‚ç‚ŕ“žˆÓ‚Ć‚ˇ‚é’Pƒ‚ČƒeƒLƒXƒg‚ĚƒtƒBƒ‹ƒ^ƒŠƒ“ƒOˆ—‚Č‚çA
I/O‘Ź“x‚Ő§ŒŔ‚ł‚ę‚é‚Ě‚Ĺ‚Ç‚ż‚ç‚Ĺ‚ŕ(ˆ˝‚˘‚Ísed‚đŽ‚żo‚ľ‚Ä‚ŕ)‘ĺ‚ľ‚Ä•Ď‚í‚ç‚Č‚˘‚ĆŽv‚¤B

awk‚̐^œ’¸‚͈ęs–ě˜Y‚É‚ ‚é‚ĆŽv‚¤Ž„‚́A‚ą‚ń‚Č‚Ě‚đ‚ć‚­‘‚ŤŽĚ‚Ä‚éB
--
awk 'BEGIN {print 1+2*3-4;}'
ls -l /tmp|awk '$5>0'
ls -l |awk '{sum+=$5;} END{print sum;}'

58 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/19(…) 23:51:16
Perl‚É‚˝‚˘‚ˇ‚éAwk‚ĚŒťŽŔ“IƒƒŠƒbƒg‚̓ƒ‚ƒŠÁ”ď‚Ş­‚Č‚˘‚ą‚Ć‚­‚炢‚Ĺ
‚ą‚ę‚͍Ą‚ĚŒvŽZ‹@‚Ĺ‚Í”÷X‚˝‚é–â‘č‚žB
ESR‚ĚArt of UNIX Programming‚𗧂ż“Ç‚Ý‚ľ‚˝‚ç
Awk‚ރƒ‚ƒŠß–ń‚Ě‚˝‚ß‚ÉŽd—l‚đ§ŒŔ‚ľ‚˝‚ą‚Ć‚Ş
‘Šú‚É‹Ł‘ˆ—Í‚đ‚Č‚­‚ľ‚˝——R‚Ć˜_‚ś‚Ä‚˘‚˝B
ƒoƒbƒh‚ČŒžŒęÝŒv‚ĚŒŠ–{‚Á‚ÄŠ´‚ś‚ŁA‚ż‚Ć•s–ů‰ő‚ž‚Á‚˝

59 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/22(“y) 02:28:36
>>57
‰´‚ாX‚â‚éB
‚ť‚ĚŽž‚Í•Ö—˜I‚ĆŽv‚Á‚Ä.cshrc‚Ć‚Š‚Éalias“o˜^‚ˇ‚é‚Ż‚Ç‚ˇ‚Ž‚É–Y‚ę‚Ä“Ż‚ś“ŕ—e‚đŽč‘Ĺ‚ż‚ľ‚Ä‚˝‚股‚é
‚ť‚Ě‹“‹ĺ‚É‚ą‚ę‚Í•Ö—˜I‚ĆŽv‚Á‚Ä.cshrcŠJ‚­‚ĆŠů‚É“o˜^‚ľ‚Ä‚ ‚é‚Ć‚˘‚¤c

60 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/22(“y) 09:21:37
>>59
‘S‰´‚Ş‹¤Š´‚ľ‚˝B

61 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/24(ŒŽ) 12:01:33
i.cshrc‚đ.bashrc‚É’u‚ŤŠˇ‚Ś‚āj@‰´‚ŕ“Ż‚śŒoŒą‚Ş‚ ‚éB

62 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/28(‹ŕ) 00:37:50
uˆęs–ě˜Yv‚Í–ź–ó

63 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/28(‹ŕ) 01:20:24
‚Ţ‚Š‚ľAu“Ǐ‘‚ˇ‚éƒvƒƒOƒ‰ƒ}v‚đ‚ć‚ń‚ŁAawk‚ʼnďŒv‚đ‚ˇ‚é‚Ě‚Ş‚Š‚Á‚ą—Ç‚˘‚Ć
‚¨‚ŕ‚Á‚Ä‚Ü‚ľ‚˝B
‚Ĺ‚ŕŠm’č\‚đ‚ˇ‚ég‚É‚Č‚Á‚˝‚çEXCEL‚đŽg‚Á‚Ä‚˘‚éB

uƒGƒ“ƒWƒjƒA‚Ě‚˝‚ß‚ĚŽ––ąě‹Ć sed awk grep ‚ť‚ľ‚ÄTexv‚Č‚ń‚ď‘Đ‚Ş‚ ‚ę‚ΐH‚˘‚‚­‚Ě‚É...


64 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/28(‹ŕ) 02:53:12
awk‚ʼnďŒv—pƒXƒNƒŠƒvƒg‚đ‘‚­‚ć‚čA‰ďŒv‚Ě‚ľ‚­‚Ý‚đ—‰đ‚ˇ‚é‚ą‚Ć‚Ě•ű‚Ş
‰´‚É‚Í—y‚Š‚É“ď‚ľ‚˘

65 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/09/28(‹ŕ) 14:47:04
Perl‚ž‚Ż‚ǁA‚ą‚ę‚́H
http://www.moge.org/okabe/temp/balance/


66 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/02(‰Î) 02:19:46
Perl ‚̓R[ƒhˆę–ÚŒŠ‚ĉ´‚Şcore“f‚Ť‚ť‚¤‚É‚Č‚é

67 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/02(‰Î) 07:50:30
”CˆÓ‚É core ‚Ş“f‚Ż‚˝‚ç•Ö—˜‚ž‚ć‚ȁB“ú‹L‘ă‚í‚č‚É‚Č‚éB

68 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/02(‰Î) 08:00:10
>>67
‘ĚŒ^ˆŰŽ‚Ě‚˝‚ß‚É—]‹V‚Č‚­‚ł‚ę‚Ä‚˘‚él‚ŕ‚˘‚˝‚悤‚Ĺ‚ˇB
Žw‚đA‚É“ü‚ę‚é‚悤‚É‚ˇ‚é‚̂ŁA‘­‚ÉŒž‚¤‚°‚ë‚ž‚ą‚ŞŽw‚É‚Ĺ‚Ť‚Ü‚ˇB

69 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/03(…) 23:18:59
awk‚Á‚Ä‚Č‚ń‚ĹPerl•—‚ɐł‹K•\Œť’uŠˇ‚Ĺ‚Ť‚é‚悤‚É‚Č‚ç‚ń‚́B“ĆŽŠŠg’Ł‚Ĺ‚ŕ‚˘‚˘‚ń‚ž‚Ż‚ǂȁB


70 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/04(–Ř) 02:48:29
>>69
‚ńA‚­‚í‚ľ‚­B

Perl‚Ěƒƒ^•śŽš‚đŽg‚˘‚˝‚˘‚Ć‚˘‚¤‚Ě‚Ć‚Íˆá‚¤‚Ě?
#Žg‚Ś‚ń‚í‚Ż‚ž‚Ş


71 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/04(–Ř) 21:53:48
awk‚ÍDFA‚Ĺperl‚ÍNFA‚ž‚Á‚Ż‚Š?


72 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/10/05(‹ŕ) 02:45:00
>>71
ƒIƒŠƒWƒiƒ‹‚ł͂ˁB
’†‚É‚ÍNFA‚đŽg‚Á‚Ä‚˘‚éawk‚ŕ‚ ‚éBmawk‚Ć‚ŠB


73 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/11/22(–Ř) 06:36:33
xgawk‚Ĺ‘˝”{’ˇŽ”‚đŽg‚˘‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA
printf( "%ld\n", num );
‚Ĺ‚ÍŒ…”‚Í‘‚Ś‚Ä‚ŕ¸“x‚Íă‚Ş‚Á‚Ä‚Č‚˘‚悤‚Ĺ‚ˇB
Œ^éŒž‚ˇ‚é‚É‚Í‚Ç‚¤‚ˇ‚é‚Ě‚Ĺ‚ľ‚傤‚Š

74 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/11/22(–Ř) 07:17:23
>>73
‘˝”{’ˇŽ”‚đŽŔ‘•‚ˇ‚é‚Ě‚ÉŒÂ•Ę‚Ě¸“x‚đă‚°‚Ä‚Ç‚¤‚ˇ‚éB

75 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/11/22(–Ř) 07:34:48
xgawk‚Í‘˝”{’ˇŽ”‚ ‚é‚ń‚Ĺ‚ˇ‚ć‚ˁH
‚ŁAruby‚̂悤‚É–łéŒž‚ĹŽg‚Ś‚é‚Š‚ĆŽv‚Á‚˝‚ç‚ť‚¤‚Ĺ‚Í‚Č‚˘‚ç‚ľ‚˘‚̂ŁA
‚Ç‚¤‚ˇ‚é‚Ě‚Š‚ƁB

http://home.vrweb.de/~juergen.kahrs/gawk/XML/xmlgawk.html
‚˘‚Ü‚ą‚Ě‚Ö‚ńŒŠ‚Ä‚é‚ń‚Ĺ‚ˇ‚Ş

76 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/11/22(–Ř) 08:47:49
MPFR,‘˝”{’ˇŽ”‚Ĺ‚Í‚Č‚­ŽŔ”‚Š‚ȁB
ƒOƒO‚Á‚ÄŒŠ‚‚Ż‚Ü‚ľ‚˝B
http://www.kt.rim.or.jp/~kbk/zakkicho/zakkicho7.html#D060126

http://golf.shinh.org/p.rb?Factorial
ŽŔ‚Í‚ą‚ę‚â‚Á‚Ä‚é‚ń‚Ĺ‚ˇ‚ށB
‚ ‚Ć‚Ídll‚ĚƒpƒX‚Ş•Ş‚Š‚ę‚΁EEE

77 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/11/26(ŒŽ) 21:13:28
>>76
u‚ ‚Č‚˛‚év‚Ě xgawk ‚Í MPFR Ď‚ń‚Ĺ‚Č‚˘‚ĆŽv‚¤‚ށEEEB


78 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2007/11/29(–Ř) 08:00:03
‚ť‚¤‚Ĺ‚ˇ‚Š
‚Ç‚ż‚ç‚É‚ľ‚Ä‚ŕŽŔ”‚Á‚ÄŽ–‚Í‚â‚Á‚Ď–ł—‚Č‹C‚Ş‚ľ‚Ü‚ľ‚˝

79 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/04(‹ŕ) 07:28:20
sed‚Ý‚˝‚˘‚ɁAƒpƒ^[ƒ“•”•Ş‚đs”ԍ†‚ĹŽw’čo—ˆ‚Ü‚š‚ń‚ŠH

80 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/04(‹ŕ) 09:32:19
>>79
awk 'NR == 79 {print;}'
‚Á‚Ä‚ą‚Ć? ‚ť‚ę‚Ć‚ŕA
awk 'FNR == 79 {print;}'
‚Á‚Ä‚ą‚Ć?

81 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/04(‹ŕ) 14:24:54
>80
‚Í‚ś‚ßsed‚Ý‚˝‚˘‚É 10,35{ ‚Ý‚˝‚˘‚ČŠ´‚ś‚ɏ‘‚˘‚ă_ƒ‚ž‚Á‚˝‚Ě‚Ĺ; }
•’Ę‚É”äŠrŽŽ‘‚­‚ń‚Ĺ‚ˇ‚ˁB10<=NR&&NR<=35{ ‚ŏo—ˆ‚Ü‚ľ‚˝; }
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

82 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/05(“y) 00:50:26
>>81
‚ŕ‚¤­‚ľ sed ‚ç‚ľ‚­‚ľ‚˝‚˘‚Č‚çA
10==NR, NR==35 { print }
‚Č‚ń‚Ä‚Ě‚ŕ‚ ‚č

83 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/14(ŒŽ) 09:02:50
awk ‚̓IƒvƒVƒ‡ƒ“‚Č‚ľ‚ž‚Ćƒƒ“ƒ‰ƒCƒi[‚ĚƒR[ƒh‚đ‘‚­‚ą‚Ć‚É‚Č‚é‚ĆŽv‚˘‚Ü‚ˇ‚Ş
ŽŔŰ awk ‚Ěƒƒ“ƒ‰ƒCƒi[‚Á‚Ä‚Ç‚ń‚ČŽž‚ÉŽg‚˘‚Ü‚ˇ‚ŠH
‚ ‚Ü‚čŒŠ‚˝‚ą‚Ć‚Ş‚Č‚­‚āc

84 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/14(ŒŽ) 09:45:08
>>83
UNIX‚Ĺ‚Í‘˝‚­‚Ěƒtƒ@ƒCƒ‹‚âo—Í‚Ş—“‹ćŘ‚čƒeƒLƒXƒg‚ĚŒ`ŽŽ‚É‚Č‚Á‚Ä‚˘‚é‚Š‚ç
‚ť‚̏ęŽg‚˘ŽĚ‚ăƒ“ƒ‰ƒCƒi[‚Ş–{—ˆ‚ĚŽg‚˘•ű‚Č‚ń‚ž‚Ż‚ǁA
‘ź‚ĚOS‚ž‚Ć BEGIN ‚đ main ‘ă‚í‚č‚ÉŽg‚¤‚悤‚Ȃ̂΂Á‚Š‚É‚Č‚é‚Š‚ŕ‚ˁB

85 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/14(ŒŽ) 09:46:06
>>83‚Şsed‚đ‚Ç‚¤Žg‚Á‚Ä‚˘‚é‚Ě‚Š‹C‚É‚Č‚éB
sedƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚Ć‚Šě‚Á‚āAƒXƒNƒŠƒvƒg‚Ěˆř”‚ɏˆ—‘ÎŰ‚Ěƒtƒ@ƒCƒ‹‚đ“n‚ľ‚Ä‚˝‚股‚é‚Ě‚Š‚ȁB

86 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/14(ŒŽ) 10:18:29
‚ć‚­‘‚­ˆęs–ě˜YB
--
du -sk /tmp/* | awk '{sum += $1;} END {print sum / NR;}'
# ‚Ü‚ŸAdu‚Á‚Ä‚Ě‚ÍĄŽv‚˘‚‚˘‚˝‚ž‚Ż‚ŁAŽŔŰ‚Édu‚̏o—Í‚Ě•˝‹Ď‚đŽć‚é‚ą‚Ć‚Í‚Č‚˘‚Ż‚ǂˁB
--
paste foo bar | awk '($1 - $2) > 1e-3 || ($1 - $2) < -1e-3 {print NR, $0;}'
# ˆę’v‚đŒŠ‚é‚ž‚Ż‚Č‚çdiff‚Ĺ‚˘‚˘‚Ż‚ǁA‹ßŽ—‚đŒŠ‚é‚É‚ÍŽg‚Ś‚Č‚˘‚ń‚ŁB

87 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/15(‰Î) 18:34:44
>>85
sed‚Í’P‘Ě‚Ě–˝—ß‚đŒŠ‚Äu’uŠˇvus‚̐؂čŽĚ‚āv‚Ý‚˝‚˘‚Č—p“r‚Ş
ƒpƒb‚ĆŒŠ‚ÄŽv‚˘•t‚­‚Ě‚Ĺ‹^–â‚Í•Ś‚Š‚Č‚˘‚ń‚Ĺ‚ˇB

awk‚͂ЂƂ‚ЂƂ‚̖˝—ß‚đŒŠ‚Ä‚ŕ
•’Ę‚ÉƒXƒNƒŠƒvƒgŒžŒę‚Ě–˝—ß‚Ć‚ľ‚ŠŽv‚Ś‚Č‚˘‚Ě‚Ĺ
uƒR[ƒh‘‚­‚Č‚ç‚Ć‚ŕ‚Š‚­Aƒƒ“ƒ‰ƒCƒi[‚Ĺ‚Ç‚¤Žg‚¤‚́Hv‚Ć
‹^–â‚đ‚ŕ‚Á‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇB

>>86
‚¤`‚ńAŒ‹\•ĄŽG‚É‚Č‚č‚Ü‚ˇ‚ˁB
‚ť‚ę‚ž‚ĆŽ„‚Č‚çƒ^[ƒ~ƒiƒ‹‚ɏ‘‚Š‚¸‚É
ƒR[ƒh‚É‹N‚ą‚ľ‚Ä‚ľ‚Ü‚˘‚ť‚¤‚Ĺ‚ˇB

‚Ĺ‚ŕAƒpƒ^[ƒ“‚ĆƒtƒB[ƒ‹ƒh‚đăŽč‚­Žg‚Ś‚Î
FXo—ˆ‚é‹C‚Ş‚ľ‚Ä‚Ť‚Ü‚ľ‚˝B
—á‚đ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

88 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/15(‰Î) 18:59:18
‚ AƒR[ƒh‘‚Ť‚ť‚¤‚Č‚Ě‚ÍŒăŽŇ‚Ĺ‚ˇB
•˝‹Ď‚Ć‚Š‡Œv‚Ý‚˝‚˘‚Čƒ‚ƒm‚É‚Í—Ç‚ł‚ť‚¤‚Ĺ‚ˇ‚ˁB

89 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/15(‰Î) 19:28:50
Ą“ú‘‚˘‚˝ˆęs–ě˜YB
--
awk '{for (ic = 1; ic <= NF; ++ic) {if (max < $ic) max = $ic;}} END {print max;}'
--
‚ą‚ę‚ŕ‘SƒtƒB[ƒ‹ƒh‚ÉŠg’Ł‚ľ‚Ä‚˘‚é‚ž‚Ż‚ŁA’P‚ÉĹ‘ĺ’l‚đ“ž‚Ä‚˘‚é‚ž‚Ż‚ž‚ˁB

90 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/22(‰Î) 16:52:32
‚ć‚­‘‚­ˆęs
du -k|awk '$1 > 10000'
‚Ĺ‚Š‚˘ƒfƒŒƒNƒgƒŠ‚đ‚ł‚Ş‚ˇ

91 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/29(‰Î) 23:34:51
‰´‚Ş‚ć‚­‘‚­ˆęs–ě˜Y
$ awk 1 > hoge.sh

92 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/31(–Ř) 12:58:14
>>91
‚ť‚ę‚ɉ˝‚ĚˆÓ–Ą‚Ş?
cat > hoge.sh‚Ĺ‚ŕŽ–‚Ş‘Ť‚č‚ť‚¤‚ž‚ށB

93 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/01/31(–Ř) 18:48:07
>92
Windows‚Éawk“ü‚ę‚Ä‚˝Žž‚ɁA‚ą‚ń‚Čƒwƒ“‚Č•Č‚Ş•t‚˘‚Ä‚ľ‚Ü‚Á‚˝B

94 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/02(“y) 12:38:28
‚ˇ‚Ý‚Ü‚š‚ńA‰SŽŇ‚Ĺ‚ˇ‚Şawk‚ÉŠÖ‚ˇ‚é˝Ú‚Ş‚ą‚ą‚ľ‚Š‚Č‚Š‚Á‚˝‚̂ŁB
Ť‚Ěƒ\[ƒX‚đ‘‚˘‚Ä‚˘‚˝‚ž‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށA‚˘‚Á‚˝‚˘‚Ç‚¤‚ˇ‚ę‚ÎŽg‚Ś‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚ż‚Ȃ݂ɁA‚ą‚ę‚̓tƒHƒ‹ƒ_“ŕ‚ĚWinrarŒ`ŽŽƒtƒ@ƒCƒ‹‚ĚƒŠƒJƒoƒŠƒŒƒR[ƒh‚Ş•t‚˘‚Ä‚˘‚é‚Š”Ű‚Š
ƒŠƒXƒg‚đˆęŠ‡‚ŏo—Í‚ˇ‚é‚ŕ‚Ě‚Ĺ‚ˇB
‚ć‚ë‚ľ‚ą
**************
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ž‚Ż‚Çunrar lt sample.rar‚̏o—Í—˜—p‚ľ‚ăŠƒXƒg‚đě‚é‚ž‚Ż
Žg‚˘•ű‚̓pƒCƒv‚Ĺawk‚É“n‚ľ‚ďˆ—unrar lt *.rar | gawk -f rr.awk
awk‚Č‚ń‚Š“ü‚Á‚Ä‚Č‚˘‚ž‚낤‚Š‚ç“–‘R‚ť‚Ě‚Ü‚Ü‚ś‚á“Ž‚Š‚Č‚˘

rr.awk
#!/usr/local/bin/gawk

BEGIN {$rr=0; printf "%-30s\t%s\n", "FileName", "RecoveryRecord";}

{if($1=="Solid" && $2=="archive"){
for(i=3;i<=NF;i++) printf "%-30s ",$i;printf "\t";getline;getline;
if($0=="Recovery record is present"){printf "Yes / ";
for(;;){getline;if($0=="Data header type: RR"){getline;printf "%sbyte\n",$2;break;}}
}else printf "No\n";}}


95 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/02(“y) 13:01:48
‚ť‚ę‚đ“Ž‚Š‚ˇ‚É‚Í‚Ü‚¸ gawk ‚đ‚Ç‚ą‚Š‚Š‚ç“üŽč‚ˇ‚éB

96 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/02(“y) 17:48:45
>>94
>Ť‚Ěƒ\[ƒX‚đ‘‚˘‚Ä‚˘‚˝‚ž‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށA

‘‚˘‚˝l‚É•ˇ‚­B

‚Ć“š‚Ś‚é‚ƁA‚í‚Ż‚Ě‚í‚Š‚ç‚ń——R‚đŒž‚Á‚Ä‚˛‚Ë‚é‚ž‚낤‚Š‚çA
ć‚ÉŒž‚Á‚Ć‚­‚ƁA‚ť‚ń‚ČŒŠ‹ę‚ľ‚˘Œž‚˘–󂡂é‚ȁB

‚Ç‚¤‚š“š‚Ś‚˝‚Á‚āAĄ“x‚́››‚Ş‚í‚Š‚č‚Ü‚š‚ń‚Ć‚ŠŒž‚˘o‚ˇ‚ń‚ž‚ëH
‚Ç‚Á‚Š‚Š‚çgawk‚đ—Ž‚Ć‚ľ‚Ä“WŠJ‚ľ‚ë‚ćB‘S‚­AˆęśƒOƒO‚Á‚Ä‚ë‚ćƒJƒX
"C:\Program Files\WinRAR\UnRAR.exe" lt *.rar | "gawk‚Ěƒtƒ‹ƒpƒX" -f rr.awk


97 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/10(“ú) 19:16:33
‚ˇ‚˘‚Ü‚š‚ńA‚ ‚éƒeƒLƒXƒg‚đ{print $1,$2}‚Ć‚ľ‚Ä’Šo‚ľ‚Ä

aaa 1
aaa 2
aaa 3
bbb 1
bbb 2
ccc 1
ccc 4
...

‚Ć‚Ü‚Ĺ‚Í‚Ĺ‚Ť‚˝‚ń‚Ĺ‚ˇ‚ށA•Ŕ‚ń‚Ĺ‚˘‚éƒf[ƒ^‚đ‚ť‚ę‚ź‚ęA

aaa 6
bbb 3
ccc 5

‚ƏWŒv‚ľ‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA‚ǂ̂悤‚É‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH

98 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/10(“ú) 19:28:07
awk '{count[$1] += $2;} END{for (aaa in count) {print aaa count[aaa]}}'
‚ ‚Ć‚Íƒ\[ƒg‚ˇ‚ę‚΂˘‚˘‚Í‚¸

99 F97F2008/02/10(“ú) 20:22:03
>98‚ł‚ńA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇI
î‚Ż‚Č‚˘‚Ě‚Ĺ‚ˇ‚ށAĄ‚Ü‚Ĺ•Ö—˜‚Čƒc[ƒ‹‚É—Š‚Á‚Ä‚˘‚Ä‘S‘RƒRƒ}ƒ“ƒh‚ɂ‚˘‚Ä—‰đ‚Ĺ‚Ť‚Ä‚˘‚Č‚Š‚Á‚˝‚Ě‚Ĺ˘‚Á‚Ä‚˘‚Ü‚ľ‚˝B
ŽŔ‚̓[ƒ‹ƒƒO‚Ĺ‘—MŽŇ‚Ş‚Ç‚ę‚ž‚Ż‚̒ʐ”‚𑗐M‚ľ‚Ä‚é‚Š‚đŠm‚Š‚ß‚é‚˝‚߂ɃRƒ}ƒ“ƒh‚Ĺ‚Ĺ‚Ť‚Č‚˘‚ŠA‚Ĺ>97‚ł‚܂¢‚Ä‚˘‚Ü‚ľ‚˝B
‰˝‚Ć‚Š“r’†‚Ü‚Ĺ‚Ĺ‚Ť‚˝‚ń‚Ĺ‚ˇ‚ށA”ńí‚ɃX[ƒp[ƒGƒŒƒKƒ“ƒg‚Č1sƒR[ƒh‚Ĺ‚ľ‚ācB

Žż–â‚‚˘‚łŐ\‚ľ–ó‚Č‚˘‚Ě‚Ĺ‚ˇ‚ށA
(aaa in count) {print aaa count[aaa]}
‚Ěaaa‚ɂ‚˘‚Ä‚Í‚Ç‚¤‰đŽß‚ˇ‚ę‚΂˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH



100 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/10(“ú) 20:33:27
>>99
bash‚Ć‚Š‚Ěfor‚Ć‚Š‚Ć“Ż‚ś‚Ĺ“K“–‚Č•śŽš—ń‚Č‚ç‚Č‚ń‚Ĺ‚ŕ‚˘‚˘‚Ĺ‚ˇD—á‚ɏo‚Ä‚Ť‚˝aaa‚Č‚ń‚Š‚É‚ˇ‚é‚Š‚ç‚â‚â‚ą‚ľ‚­‚Č‚Á‚Ä‚ˇ‚Ý‚Ü‚š‚ńD
for(hoge in list) {...}
‚Ĺ”z—ńlist‚ĚƒL[‚đ•Đ‚Á’[‚Š‚çhoge‚É“ü‚ę‚㋁[ƒv‚ˇ‚é‚Á‚ĈӖĄ‚É‚Č‚é‚Í‚¸‚Ĺ‚ˇ‚ćD

101 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/10(“ú) 20:36:22
98‚ś‚á‚Č‚˘‚Ż‚Ç

awk '{count[$1] += $2;} END{for (i in count) {printf "%s %i\n", i, count[i]}}'

‚ą‚¤‚â‚Á‚ď‘‚Ż‚΂ľ‚ń‚š‚‚ś‚á‚ˁH
ƒf[ƒ^‚Ě’†‚Ěaaa‚ĆloopƒJƒEƒ“ƒ^[‚Ěaaa‚đ“Ż‚ś–ź‘O‚É‚ˇ‚é‚Ě‚ÍˆÓ’nˆŤ‚ž‚ĆŽv‚¤‚ć



102 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/10(“ú) 20:37:23
101‚Ĺ‚ˇB‚ˇ‚Ü‚ńonz


103 F‚98F2008/02/10(“ú) 20:39:44
‚ [A‚Ý‚ń‚ȏ‘‚˘‚Ä‚˘‚é‚Š‚玄‚̏‘‚˘‚˝‚Ě‚Í‘ĺ•‚ɍí‚é‚ŠB
‚ť‚ĚENDƒuƒƒbƒN“ŕ‚́A
for (§Œä•Ď” in ˜A‘z”z—ń) {...;}
‚Ć‚˘‚¤ƒpƒ^[ƒ“B

‚ť‚Ě‘O’i‚Ěcount[$1] += $2‚͈ęs–Ú‚Ě‚Ć‚Ť
count["aaa"] += 1‚ƉđŽß‚ł‚ę‚éBˆČ‰ş“Ż—l‚ɁB
‚ą‚Ěcount‚ޘA‘z”z—ń‚Ć‚ľ‚ÄŽg‚í‚ę‚Ä‚˘‚é‚Ć‚˘‚¤‚ą‚ƁB

104 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/10(“ú) 20:42:05
>>101
c”˝Č‚ľ‚Ä‚Ü‚ˇ

‚˘‚âC‚Ů‚çC‚‚˘‚˘‚‚ŕ‚ĚƒNƒZ‚Łc‚˛‚ß‚ń

105 F97F2008/02/10(“ú) 20:52:15
‚˘‚Ś‚˘‚Ś‚˘‚Ś‚˘‚Śc‚ť‚¤‚˘‚¤ˆÓ–Ą‚ś‚á‚Č‚­‚Ä‹ł‚í‚Á‚Ä‚˘‚Č‚Ş‚ç‚ˇ‚˘‚Ü‚š‚ń‚Ĺ‚ˇB
ă‹L‚ŏ‘‚˘‚˝‚Ć‚¨‚č•Ö—˜ƒc[ƒ‹‚É—Š‚čŘ‚Á‚Ä‚Ä–w‚Ç’m‚ç‚Č‚˘Ž„‚ވŤ‚˘‚Ě‚Ĺ‚ˇ‚ށcB
ĄˆęśŒœ–˝3byte’ö“x‚Ě”]‚Ý‚ť‚ŕ׋­‚ľ‚Ä‚é‚ń‚Ĺ‚ˇ‚ށA2“ú–Ú‚ĹÁÜ‚ľ‚ť‚¤‚ĹŽż–â‚ł‚š‚ĖႢ‚Ü‚ľ‚˝cB

‚˝‚Ć‚Ś‚΃ƒO‚É‚Í
Feb 9 22:44:40 localhost postfix/qmgr[1936]: 345C48C0154: from=<use1@example.com>, size=556, nrcpt=1 (queue active)
‚Ć•K‚¸o‚Ü‚ˇB‚ŁA
1,śƒƒO‚đ‚ť‚Ě‚Ü‚Üˆ—‚ˇ‚é‚Ě‚Ş•|‚˘i‘ĺ‚Ť‚Čƒtƒ@ƒCƒ‹j‚̂ŁA“ú•t‚ĹƒƒO‚đ’Šo‚ľ‚Ä•Ęƒtƒ@ƒCƒ‹‚Ö•Ű‘śB
2,grep‚Ĺ nrcpt=‚Ć’Šo‚ľ‚āA‚ł‚ç‚Égrep -v‚ŏœŠO‚ˇ‚éƒhƒƒCƒ“‚đŽw’č‚ľ‚Ä’Šo
3,‚ť‚ľ‚Äsed‚Ĺnrcpt=‚đíœ‚ľ‚Ä
4,‚ą‚ą‚Ĺ>97‚̂悤‚É$7‚Ć$9‚đ•Ŕ‚ׂ˝‚Ć‚ą‚ë‚Ĺ”]‚Ý‚ť‚Ěƒoƒbƒtƒ@ƒGƒ‰[‚đ‹N‚ą‚ľ‚Ü‚ľ‚˝B

‚ą‚̏ˆ—‚Ě•ű–@‚ŕƒGƒŒƒKƒ“ƒg‚Č‚ą‚Ć‚Í•Ş‚Š‚Á‚Ä‚˘‚Ü‚ˇ‚ށA’p‚͏ł’m‚Ĺ‚¨Žf‚˘‚ľ‚˝ŽŸ‘ć‚Ĺ‚ˇcB

106 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/13(…) 07:31:34
gsub‚Ĺ[.*]‚đ’u‚ŤŠˇ‚Ś‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH

107 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/14(–Ř) 02:38:02
>>106
‚ť‚ę‚̓Šƒeƒ‰ƒ‹‚Ć‚ľ‚Ĉľ‚Á‚Ä‚Ć‚˘‚¤‚ą‚Ć‚Š‚˘?
‚Č‚ç‘S•”ƒGƒXƒP[ƒv‚ˇ‚ę‚΂˘‚˘‚ĆŽv‚¤‚މ˝‚Š–â‘č‚Ş‚ ‚é‚Ě?


108 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/16(“y) 01:08:44
awk‚ĹŒťÝŽž‚Š‚çn•Ş‘O‚Š‚çˆČ~‚ĚƒƒO‚ž‚Ż‚𔲂Ťo‚ľ‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠcB
02 15 12:34:56 xxxxxxxxx
02 15 13:45:01 xxxxxxxxx
...
...
...
‚Ć‚Š‚ĚŒ`ŽŽ‚Ȃ̂ŁAstrftime()‚Ć‚Š‚ĹŒťÝ‚ĆƒƒO‚ĚŽž‚đ”äŠr‚ľ‚Ä”˛‚Ťo‚ˇA‚Ć‚Š‚đŽŽ‚ľ‚˝‚ń‚Ĺ‚ˇ‚ރ_ƒ‚Ĺ‚ľ‚˝c

109 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/16(“y) 01:49:16
>>108 ‚ą‚ę‚Ĺ‘Ę–Ú‚Š‚ȁH(ˆę‰ž gawk 3.0.4 ‚Ĺ‚Í“Ž‚˘‚˝)
BEGIN{
n=5
basetime=strftime("%m %d %H:%M:%S", systime()-60*n)
}
{
chktime=substr($0, 1, 14)
if(chktime >= basetime) print
}

110 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/16(“y) 02:23:28
>109

‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇc‘f’ź‚É–Ú‚Ş—Ř‚Ĺ‚ľ‚˝cB

> chktime=substr($0, 1, 14)

‚Č‚ń‚Ĺ‚ˇ‚ˁc
perl‚ŞŽg‚Ś‚Č‚˘ŠÂ‹Ť‚Ȃ̂ŁA‚ą‚ę‚Ş•Ş‚Š‚ę‚΂˘‚낢‚ë—Ź—pŒř‚­‚Ě‚Ĺ•‚Š‚č‚Ü‚ľ‚˝B
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‚ŕ‚¤‚ż‚ĺ‚Á‚Ɛ¸i‚ľ‚Ü‚ˇBBB

111 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/18(ŒŽ) 18:58:36
>>29
đ”N6ŒŽ‚ɁuAWK‚đ256”{Žg‚¤‚˝‚ß‚Ě–{v‚Ş–{‰Ž‚̏‘’I‚É‚ ‚Á‚˝‚Ě‚Ĺ”ƒ‚˘‚Ü‚ľ‚˝B
‰œ•t‚É
1993”N8ŒŽ21“ú‰”Ĺ”­s
2007”N5ŒŽ9“ú@‘ć1”Ĺ‘ć16ü”­s
‚Ə‘‚Š‚ę‚Ä‚˘‚Ü‚ˇB

112 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/18(ŒŽ) 22:32:44
>>111
‚˘‚Â‚ĚƒŒƒX‚ɃŒƒX‚ľ‚Ä‚ń‚ži‚—

ÓÚ‚ŕ”ƒ‚Á‚˝‚Ż‚ǁA‚Ü‚ž‘ĺ‚Ť‚Č–{‰Ž‚ĹŒŠ‚Š‚Ż‚é‚ˁB


113 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/19(‰Î) 02:59:17
>2007”N5ŒŽ9“ú@‘ć1”Ĺ‘ć16ü”­s 

–{‰Ž‚Ě’I‚Ĺ–°‚č‘ą‚Ż‚Ä‚˝‚Á‚Ä‚í‚Ż‚ś‚á‚Č‚˘‚Ě‚Šw


114 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/24(“ú) 00:57:13
–Ú‚Ş—Ř ‚Ɉę’v‚ˇ‚é“ú–{Œę‚Ěƒy[ƒW –ń 1,920 Œ’† 1 - 20 Œ–Ú (0.24 •b)

115 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/02/24(“ú) 01:00:56
ƒƒK—Ř

116 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/03/28(‹ŕ) 21:53:28
sed, awk, ruby ‚đŽg‚¤B
‚ť‚ę‚ź‚ę“KŢ“KŠ‚ĹŽg‚¤‚Ż‚ǁA
used ‚ž‚Żvuawk ‚ž‚Żv‚ĹĎ‚Ü‚š‚ç‚ę‚é‚ƁA
•sŽv‹c‚ČŠě‚Ń‚đŠ´‚ś‚éB

117 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/03/30(“ú) 14:05:33
>>116
‚¤‚żAAIXŽg‚Á‚Ä‚é‚ń‚Ĺksh+sed+awk+perl‚ž‚ȁB
ruby‚Ş•W€‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚Ä‚éŠÂ‹Ť‚Á‚Ä‚ ‚ń‚Ü‚Č‚˘‚ĆŽv‚¤B

118 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/03/30(“ú) 16:22:26
ŒĂ‚˘ƒT[ƒo‚ž‚ĆPerl‚ˇ‚ç“ü‚Á‚Ä‚Č‚˘Ž–‚Ş‚ ‚é‚Š‚çawk‚͏d•ó‚ˇ‚éB


119 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 10:26:45
Ĺ‹ß‚Ěgawk‚ރlƒbƒgƒ[ƒN‚É‚ŕŽg‚Ś‚é‚Ć’m‚Á‚Ä‚ż‚ĺ‚Á‚Ć‹Á‚˘‚˝‚—
ƒJ[ƒjƒnƒ“‚Ě–{ƒŒƒxƒ‹i‚Ć‚Š256”{j‚ľ‚Š’m‚ç‚Č‚˘l‚Á‚Ä‘˝‚˘‚ĆŽv‚¤B

120 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 12:44:41
ƒm[ƒ}ƒ‹‚Ěawk‚ĹXML‚đŽš‰ş‚°‚ľ‚˝‚č‚ľ‚Ä‚¤‚Ü‚­•\ŽŚ‚ł‚š‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ě‚Š‚ȁEEE

121 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 17:09:18
sed‚ž‚Ż‚ŏ‘‚Ż‚é‚ƁA‰´‚Á‚ēރCƒC‚Š‚ŕ‚Á‚ÄŽv‚¤B

#!/bin/sed -f

122 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 17:16:17
•śŽš—ń‚Ě’Pƒ‚Č’uŠˇ‚ž‚Ż‚Č‚çawk‚ć‚čŠČ’P‚ɏ‘‚Ż‚é‚ń‚ž‚Ż‚ǁB
awk‚ÉŒĹŽˇ‚ľ‚Č‚˘‚Ĺ—Ő‹@‰ž•Ď‚Ésed‚đŽg‚¤‚Á‚ĈӖĄ‚Ĺ‚Č‚ç—v—Ě‚Ş‚˘‚˘‚Ć‚˘‚¤ˆÓ–Ą‚ĹŒŤ‚˘‚Ż‚ǁB
# awk‚ŏ‘‚˘‚˝•ű‚ŞŠČ’P‚Č‚ą‚Ć‚đsed‚ĹŠć’Ł‚Á‚ď‘‚˘‚˝‚Ě‚ž‚Ć‚ľ‚˝‚çA‚ť‚ĚˆÓ–Ą‚Ĺ‚Í“ŞˆŤ‚˘‚Čw

123 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 17:34:45
awk‚Š‚çsystem‚ĹsedŒÄ‚Ô‚ą‚Ć‚ÍŽžX‚ ‚é‚—

124 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 18:49:04
>>24
awk‚Á‚Ä•\ŒvŽZ‚̂悤‚ȏˆ—‚É“Á‰ť‚ľ‚Ä‚Ü‚ˇ‚ć‚ˁB
‚ť‚Ě“_‚Ş”ńí‚Ƀ†ƒj[ƒN‚Ć‚˘‚¤‚ŠŽ––ąˆ—‚ĚŒžŒę‚ž‚ȁA‚ƁB
visicalc(1979)awk(1977)‚Ĺ‚ˇ‚Š‚çawk‚Ě‚Ů‚¤‚ŞŽáŠąŒĂ‚˘‚ń‚Ĺ‚ˇ‚ށA
•\ŒvŽZ‚̓Zƒ‹‚É’źÚŽŽ‚đ‘‚­‚Ć‚˘‚¤”­‘z‚ސV‚ľ‚Š‚Á‚˝B‚¤‚ނށB

125 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/06(“ú) 19:26:56
VisiCalc‚̍lˆÄŽŇDan Bricklin‚É‚ć‚éƒAƒCƒfƒA‚Ěŕ–ž
ttp://www.danbricklin.com/history/saiidea.htm

Dan‚Ě“d‘ě‚ŞHP‚ś‚á‚Č‚­‚ÄTI‚Č‚Ě‚ŞˆÓŠO‚ČŠ´‚śB
The idea for the electronic spreadsheet came to me while I was a student at the Harvard Business School, working on my MBA degree, in the spring of 1978.
Sitting in Aldrich Hall, room 108, I would daydream.
"Imagine if my calculator had a ball in its back, like a mouse..." (I had seen a mouse previously, I think in a demonstration at a conference by Doug Engelbart, and maybe the Alto).
And "..imagine if I had a heads-up display, like in a fighter plane, where I could see the virtual image hanging in the air in front of me.
I could just move my mouse/keyboard calculator around, punch in a few numbers, circle them to get a sum, do some calculations, and answer '10% will be fine!'"
(10% was always the answer in those days when we couldn't do very complicated calculations...)

126 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 02:52:10
‚Í‚ś‚ß‚Ü‚ľ‚Ägawk‚ĚŽż–â‚Ĺ‚ˇ
‚¨Žč‚ˇ‚Ť‚ĚŽž‚É‚Ĺ‚ŕ‚˛‰đ“š’¸‚Ż‚Ü‚ľ‚˝‚珕‚Š‚č‚Ü‚ˇ

2ch‚Ĺ‚¨˜b‚ľ‚Ä‚˘‚˝‚ž‚˘‚˝•ű‚Š‚çgawk‚đ‹ł‚Ś‚Ä’¸‚Ť‚Ü‚ľ‚˝
ł‹K•\Œť‚Ĺƒ}ƒbƒ`‚ľ‚˝•”•Ş‚Ş‚˘‚­‚‚ ‚Á‚Ä‚ŕ‘S‚Ä‚Ě‰ÓŠ‚đ1ƒAƒNƒVƒ‡ƒ“‚Ĺ•Ű‘ś‚Ĺ‚Ť‚é—D‚ę‚ŕ‚Ě‚Ĺ‚ˇ
“–•űAŒžŒę‚Í‘S‚­’m‚ç‚Č‚˘‚̂Őć‚Ů‚Ç‚Ü‚ĹƒeƒXƒgŽŔs‚ľ‚Ä‚Í‹Á‚˘‚Ä‚˘‚Ü‚ľ‚˝
‚ą‚Ě—D‚ę‚ŕ‚Ě‚đĄŒă––‰i‚­Žg‚Á‚Ä‚˘‚Ť‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş
‰ş‹L‚ĚŽ–€‚đƒOƒO‚Á‚ÄŒŠ‚˝‚Ě‚Ĺ‚ˇ‚Ş‚í‚Š‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝
‚Ç‚Č‚˝‚Š‚í‚Š‚é•ű‚¨‚ç‚ę‚Ü‚ľ‚˝‚ç‹ł‚Ś‚ĉş‚ł‚˘

Ž„‚Ě‚â‚č‚˝‚˘‚ą‚Ć
EEUC‚đ“ǂݍž‚ń‚ĹS-JIS‚đo—Í
EŠů‘ś‚ĚƒeƒLƒXƒg––”ö‚ɒljÁ‘‚Ťž‚Ý•Ű‘ś
i‹ł‚Ś‚Ä’¸‚˘‚˝ƒXƒNƒŠƒvƒg‚Íă‘‚Ť•Ű‘ś‚Č‚Ě‚Ĺo—͐ć‚Ě“ŕ—e‚ޏÁ‚Ś‚Ä‚ľ‚Ü‚˘‚Ü‚ˇj

‹C’ˇ‚É‘Ň‚Á‚Ä‚˘‚Ü‚ˇ‚̂ʼn˝‘˛‚ć‚ë‚ľ‚­‚¨Šč‚˘’v‚ľ‚Ü‚ˇ

127 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 03:10:31
>>126
‘OŽŇ‚Íawk‚Ĺ‚â‚é‚ׂŤ‚ą‚Ć‚Ĺ‚Í‚Č‚˘Biconv, nkf‚Č‚Ç‚ť‚ęę—p‚Ěƒc[ƒ‹‚Ş‚ ‚éB
ŒăŽŇ‚ŕ•K‚¸‚ľ‚ŕawk‚Í•s—vBƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ŞŽg‚Ś‚éŠÂ‹Ť‚Ȃ畁’Ę‚É‚Ĺ‚Ť‚éB
—á‚Ś‚΁AUnixŒn‚Č‚ç cat append.txt >> original.txt ‚ĹŠů‘ś‚Ěƒtƒ@ƒCƒ‹‚ɒljÁ‚Ĺ‚Ť‚éB
DOSŒn‚Ĺ‚ŕAtype append.txt >> original.txt ‚Ĺ‚Ĺ‚Ť‚éB
—v‚́Aawk‚Ě‚˘‚˘‚Ć‚ą‚ë‚Í‚ť‚ę’P‘Ě‚Ĺ‚Č‚ń‚Ĺ‚ŕ‚Ĺ‚Ť‚é(ˆ˝‚˘‚Í‚Ĺ‚Ť‚Č‚˘)‚ą‚Ć‚Ĺ‚Í‚Č‚­A
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ŠÂ‹Ť‚Ĺ—Í‚đ”­Šö‚ˇ‚éƒc[ƒ‹‚Ĺ‚ ‚é‚ą‚ƁB

—á‚Ś‚΁Ał‹K•\Œť‚Ĺƒ}ƒbƒ`‚ľ‚˝•śŽš—ń‚đ’uŠˇ‚ˇ‚é‚ž‚Ż‚Č‚çƒeƒLƒXƒgƒGƒfƒBƒ^‚Ĺ‚ŕ‚Ĺ‚Ť‚éB
‚ [‚ť‚¤‚ť‚¤AƒGƒfƒBƒ^‚Ş‚ ‚ę‚ΕśŽšƒR[ƒh‚Ě•ĎŠˇ‚ŕ‚ť‚ę‚ž‚Ż‚Ĺ‚Ĺ‚Ť‚éB
ŠˆŕƒeƒLƒXƒgƒGƒfƒBƒ^‚đŽg‚Á‚˝‚ą‚Ć‚Ş‚Č‚˘‚Č‚çAˆę“x(ł‹K•\ŒťŒŸő‹@”\A
•śŽšƒR[ƒh•ĎŠˇ‹@”\‚Ě‚ ‚é)ƒeƒLƒXƒgƒGƒfƒBƒ^‚đG‚Á‚Ä‚Ý‚é‚Ć‚˘‚˘‚Š‚ŕ‚ľ‚ę‚Č‚˘B

128 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 03:32:54
>>127‚ł‚ń
>>126‚Ĺ‚ˇ
‚¨”ć‚ę‚Ě‚Ć‚ą‚둁X‚Ě‚˛‰đ“š˝‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
ƒRƒ“ƒo[ƒg‚Í•Ę‚Ěƒc[ƒ‹‚ōs‚¤
DOSŠÂ‹Ť‚Ĺ‚Ítype append.txt >> o—͐ćƒtƒ@ƒCƒ‹–ź‚ŒljÁ‘‚Ťž‚Ý
—š‰đ‚ľ‚Ü‚ľ‚˝
ƒGƒfƒBƒ^[‚͏GŠŰƒGƒfƒBƒ^[‚đŽg‚Á‚Ä‚˘‚Ü‚ˇ
ƒRƒ“ƒo[ƒg‚͏o—ˆ‚é‚Ě‚Ĺ‚ˇ‚ŞŒŸő‚Ĺƒ}ƒbƒ`‚ľ‚˝•śŽš—ń‚Í1‰ÓŠ‚¸‚ƒRƒs[‚Č‚ń‚Ĺ‚ˇ
sakuraƒGƒfƒBƒ^[‚ĹˆęŠ‡ƒRƒs[‚âŘ‚čŽć‚č‚Şo—ˆ‚é‚Ć‹ł‚Ś‚Ä‚­‚ę‚˝•ű‚ŕ‚˘‚Ä‚˝‚Ě‚Ĺ‚ˇ‚Ş
sakuraƒGƒfƒBƒ^[‚ÍŽŽ‚ľ‚˝‚ą‚Ć‚Ş–ł‚˘‚ń‚Ĺ‚ˇ
Ú‚ľ‚­‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝

129 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 03:56:33
AAA.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ƀy[ƒXƒg‚ˇ‚é

BBB.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ě––”ö‚Ƀy[ƒXƒg‚ˇ‚é

CCC.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ě––”ö‚Ƀy[ƒXƒg‚ˇ‚é

‚ć‚ë‚ľ‚­‚¨Šč‚˘‚ľ‚Ü‚ˇ

130 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 04:02:07
>>127‚ÍŒ‹‹Çawk‚̉𓚂͂ľ‚Č‚˘‚Ě‚É‚Č‚ń‚Ĺ‚ľ‚á‚ľ‚á‚čo‚Ä‚Ť‚˝‚́H
‚Ĺ‚Ť‚Č‚˘‚ś‚á‚ń

131 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 06:48:34
>>130
Žż–â‚É‹ď‘̐Ť‚Ş‚Č‚˘‚Š‚çˆę”Ę˜_‚đ‘‚˘‚˝‚ž‚Ż‚ž‚Ż‚ǁB

>>129
awk '/“Œ‹ž(.+?)†Žş/ {print > "TEST.txt";}' AAA.txt
awk '/“Œ‹ž(.+?)†Žş/ {print >> "TEST.txt";}' BBB.txt
ˆČ‰ş“Ż—l‚ɁB

132 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 12:02:34
>>131
ƒŒƒX‚ ‚č‚Ş‚Ć
gawk '/“Œ‹ž(.+?)†Žş/ {print > "TEST.txt";}' AAA.txt
gawk '/“Œ‹ž(.+?)†Žş/ {print >> "TEST.txt";}' BBB.txt
ƒtƒ@ƒCƒ‹–źAƒfƒBƒŒƒNƒgƒŠ–źA‚Ü‚˝‚̓{ƒŠƒ…[ƒ€@ƒ‰ƒxƒ‹‚̍\•ś‚ŞŠÔˆá‚Á‚Ä‚˘‚Ü‚ˇB
gawk3.16‚Ĺ‚ÍŽg‚Ś‚Č‚˘H



133 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 13:29:56
>>132
DOS‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚŽg‚˘•ű‚Í‘źŠ‚Ĺ•ˇ‚˘‚Ä‚­‚ęB

134 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 13:38:24
–đŠ‚Ě‘‹Œű‚Ý‚˝‚˘‚ȑΉž‚ž‚ȁB


135 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 13:43:47
DOS‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ɂ‚˘‚Ä‚Í‘˝‚­‚đ’m‚ç‚Č‚˘‚ń‚ž‚ćB

136 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 16:36:42
DOS‚Ěę‡‚Í‹ó”’‚đŠÜ‚Ţę‡ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚ś‚áƒ_ƒ‚ž‚Š‚ç‚ȁB
ƒ_ƒuƒ‹ƒNƒH[ƒg‚ĹŠ‡‚Á‚Ä’†‚ĚƒR[ƒh‚Í
ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚ŠAƒGƒXƒP[ƒv‚ľ‚ă_ƒuƒ‹ƒNƒH[ƒg“ü‚ę‚é‚ŠB

ˆę”ÔŠČ’P‚Ȃ̂́Aƒƒ“ƒ‰ƒCƒi[‚Ĺ‚ŕƒtƒ@ƒCƒ‹‚É‹N‚ą‚ľ‚Ä‚ľ‚Ü‚¤‚ą‚ƁB
gawk -f myscript.awk AAA.txt
‚Ć‚â‚Á‚Ä‚ľ‚Ü‚Ś‚΁AƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚Ć‚Šƒ_ƒuƒ‹ƒNƒH[ƒg‚Ć‚Š‹C‚É‚ˇ‚é•K—v‚Í‚Č‚˘B

137 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/07(ŒŽ) 18:22:15
>>132
“ń‚–â‘č‚Ş‚ ‚éB
gawk‚̐ł‹K•\Œť‚Ĺ‚Í.+?‚Ć‚˘‚¤‚Ě‚ÍŽg‚Ś‚Č‚˘B
cmd.exe‚ł́AƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚đˆř”‚đ
‚­‚­‚é‚Ě‚ÉŽg‚Ś‚Č‚˘B

‚Č‚ń‚Š‚ć‚­‚í‚Š‚ç‚ń‚ށAperl‚ĹƒeƒLƒXƒg‚đŠŰˆů‚Ý‚ľ‚Ä‚Š‚ç
ˆ—‚ˇ‚ę‚΂˘‚˘‚ń‚ś‚á‚Č‚˘‚Ě‚ŠH


138 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/12(“y) 19:00:42
VisiCalc ‚Ć‚˘‚Ś‚΁AoŽn‚ß‚Ě ‚É TRS-80 —p ‚đ Radio Shack ‚ĹŒŠ‚š‚Ä‚ŕ‚ç‚Á‚˝‚ń‚ž‚Ż‚ǁAŠwś‚ž‚Á‚˝Ž„‚ɂ͉ż’l‚Ş‚í‚Š‚ç‚Č‚Š‚Á‚˝‚Č‚ŸB
‚Ü‚ŸA‚ą‚ę‚ÉŒŔ‚炸Aw‚Č‚ń‚Ĺ‚ą‚ń‚ČƒRƒ}ƒ“ƒh‚âƒIƒvƒVƒ‡ƒ“‚Ş‚ ‚é‚ń‚žHx‚Á‚Ä‚Ě‚Í‘˝‚˘B
Žg‚˘•ű‚ś‚á‚Č‚­A‚Č‚ş‚ť‚ę‚Ş‚ ‚é‚Ě‚Š‚đ•ďŠ‡“I‚ɉđŕ‚ľ‚˝–{‚â web site ‚Á‚Ä‚ ‚č‚Ü‚ˇ‚ŠB(‚˝‚Ć‚Ś‚Α˝‚­‚Ě unix ƒRƒ}ƒ“ƒh‚đ–Ô—…‚ľ‚Ä‚˘‚é‚Ć‚Š)

139 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/12(“y) 19:01:22
‚ ‚ AƒXƒŒˆá‚˘‚ž‚Á‚˝B‚˛‚ß‚ń‚˛‚ß‚ńB

140 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/04/12(“y) 19:58:47
‚Č‚ń‚Ć‚˘‚¤Œë”š


141 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/05/06(‰Î) 02:42:04
>>132 ‚ŕ‚¤‹‚Č‚˘‚Š‚ȁBgawk3.1.6 + nkf2.0 Žg—p@cmd.exe

C:\work>type aaa.txt (ŚEUC‚Ȃ̂ʼnť‚Ż‚鎖‚đŠm”F)
¤Ű¤˛¤Ű¤˛
ŁEţšćźź
ŁEţŁ˛šćźź
ŁEţŁąŁ°šćźź
ŁEţ¤Ű¤˛šćźź
ŁEţ¤Ő¤ŹšEŁEŐ¤Źšćźź
ŁEţŁłšćźź¤ČŁEţŁľšćźź

C:\work>nkf -Es AAA.txt
‚Ů‚°‚Ů‚°
“Œ‹ž†Žş
“Œ‹ž‚Q†Žş
“Œ‹ž‚P‚O†Žş
“Œ‹ž‚Ů‚°†Žş
“Œ‹ž‚ӂލ†
“Œ‚ӂލ†Žş
“Œ‹ž‚R†Žş‚Ć“Œ‹ž‚T†Žş

C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žş/{print $0}"
“Œ‹ž†Žş
“Œ‹ž‚Q†Žş
“Œ‹ž‚P‚O†Žş
“Œ‹ž‚Ů‚°†Žş
“Œ‹ž‚R†Žş‚Ć“Œ‹ž‚T†Žş

Šůo‚Ě’Ę‚č•śŽš•ĎŠˇnkf(>>127) ł‹K•\Œť‚̐§–ń‚ĹđŒ•ĎX(>>137)
ŽŔŰ‚ÉŽg‚¤ę‡‚Í‚ą‚ń‚ČŠ´‚ś‚Ĺƒoƒbƒ`ě‚é‚Ć‚ŠB
C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žş/{print $0}" >>TEST.txt


142 F141F2008/05/06(‰Î) 02:56:02
‚ƁA•ű–@‚đ‘‚˘‚Ä‚¨‚˘‚ăAƒŒ‚ž‚Ż‚ǁA
GŠŰŽg‚Á‚Ä‚é‚Č‚çgrep‚ĚŽŔs‚ĹŒŸő‚ˇ‚éƒtƒ@ƒCƒ‹‚É(ŒťÝ‚Ě“ŕ—e)‚Ĺ
ŒŸőŒ‹‰Ę‚Š‚çƒtƒ@ƒCƒ‹–ź‚ƍs”ԍ†‚đœ‹Ž‚ˇ‚é‚Ě‚Ĺ‚ŕ‚Ĺ‚Ť‚ť‚¤‚Č‹C‚Ş‚ˇ‚éB
ˇ‘ĺ‚ɃXƒŒˆá‚˘‚ž‚Ż‚ǁB


143 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/05/06(‰Î) 14:28:43
>>142‚ł‚ń
‚ ‚č‚Ş‚Ć
‚Ü‚žŽv‚¤‚悤‚É‚Ĺ‚Ť‚Ä‚˘‚Č‚˘‚ń‚ž
ŽQl‚É‚Č‚é‚抴ŽÓ‚Ĺ‚ˇ

144 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/16(ŒŽ) 01:50:26
‚Đ‚Ĺ‚Ś‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—

145 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/16(ŒŽ) 01:50:57
‚ˇ‚Ü‚ńŒë”š

146 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 02:17:58
Žż–â‚Ĺ‚ˇI

ˆČ‰ş‚Ěƒtƒ@ƒCƒ‹hoge‚Š‚çawk‚ŁA‰żŠi‚𔲂Ťo‚ľ‚č‡Œv’l‚đo‚ľ‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇB
ƒtƒ@ƒCƒ‹‚Ě“ŕ—e‚́A‘Đ–ź‚ƉżŠi‚Ĺ‚ˇB‰żŠi‚͈ę”ÔŒă‚ë‚̐”Žš‚É‚Č‚č‚Ü‚ˇB

----------------------
$ cat hoge
‚ť‚ꂢ‚ŻI‚ ‚ń‚Ď‚ń‚Ü‚ń 1000
ƒƒ^ƒ{ƒŠƒbƒN‚đŒ‚‘Ţ‚š‚ć 1000
‰ş—ŹŽĐ‰ď 1000
ă—ŹŽĐ‰ď‚Ɖş—ŹŽĐ‰ď “ú–{‚Ě‚ą‚ę‚Š‚ç 1000
˜_•ś 2008 “ú–{‚Ě•ř‚Ś‚é–â‘č 1000
˜_•ś 2007 “ú–{‚Ě•ř‚Ś‚é–â‘č ‰ß‹Ž–â‘čW 1000
----------------------

“ď‚ľ‚˘‚Ě‚ŞA‘Đ–ź‚Ě2008‚â2007‚Ȃǂ̐”’l‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚ą‚Ć‚â‹ó”’‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚ą‚Ć‚Ĺ‚ˇB
1s–Ú‚Ěę‡2—ń–ڂމżŠi‚É‚Č‚č‚Ü‚ˇ‚ށA2s–Ú‚Ěę‡4—ń–ڂމżŠi‚Ć‚Č‚č‚Ü‚ˇB

‚ą‚̂悤‚Ɉę”ÔĹŒă‚Ě—ńi‰żŠij‚đŽć“ž‚ľA‡Œv’l‚đŒvŽZ‚ˇ‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂悢‚Ĺ‚ľ‚傤‚ŠH

‚˛‹łŽŚ‚¨Šč‚˘‚˘‚˝‚ľ‚Ü‚ˇB




147 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 02:28:00
awk '{x+=$NF}END{print x}' hoge

148 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 09:33:15
x‚ś‚á‚Č‚­‚Äsum‚Ć‚Š‚É‚ľ‚悤‚ćB

149 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 13:36:51
ˆęs–ě˜Y‚͎萔i‘Ő”jdŽ‹‚Č‚ń‚ś‚á‚Ü‚˘‚Š

150 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 15:27:28
“ď‚ľ‚˘‚Á‚ă}ƒjƒ…ƒAƒ‹“Ç‚ß‚ÎĹŒă‚Ě—v‘f‚đŽw‚ˇ‚ŕ‚Ě‚Ş‰˝‚Š‘‚˘‚Ä‚ ‚é‚ĆŽv‚¤‚Ş

151 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 16:09:13
“Ç‚ń‚Ĺ‚˝‚ç‘źl‚É‚Č‚ń‚Š•ˇ‚Ť‚Ü‚š‚ńB

152 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/25(…) 16:34:16
‚ś‚á‚ Aƒ}ƒjƒ…ƒAƒ‹“Ç‚ń‚Ĺ‚ŕ‚í‚Š‚ç‚Č‚Š‚Á‚˝‚炨Žčă‚°‚Š

153 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/06/29(“ú) 21:37:04
Windows ”Ĺ‚Ě gawk-3.1.5 ‚Ĺ`‘o•űŒüƒpƒCƒv‚Ş‚¤‚Ü‚­“Žě‚ľ‚Ü‚š‚ńBˆČ‰şA
http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html#SEC182
‚Š‚ç‚ĚƒTƒ“ƒvƒ‹ƒtƒ@ƒCƒ‹‚Ĺ‚ˇ‚ށA“r’†‚ĹŽ~‚Ü‚Á‚Ä‚ľ‚Ü‚Á‚āA•ÔŽ–‚Ş•Ô‚Á‚Ä‚Ť‚Ü‚š‚ńB

BEGIN {
command = "sort"
n = split("abcdefghijklmnopqrstuvwxyz", a, "")

for (i = n; i > 0; i--)
print a[i] |& command
close(command, "to")

while ((command |& getline line) > 0)
print "got", line
close(command)
}

Cygwin ‚Ě gawk ‚Ĺ‚Í–â‘č‚ ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B


154 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/01(‰Î) 20:42:14
‚ą‚ęŽg‚¤‚Ć‚˘‚˘‚ć
ttp://www.pipeunish.jp/


155 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 01:35:15
‚Ç‚¤‚â‚Á‚˝‚ç Cygwin ‚Ě gawk(GNU Awk 3.1.6) ‚Ĺ print length("‚ ‚˘‚¤") ‚Ş 3 ‚É‚Č‚é‚Ě‚Ĺ‚ˇ‚ŠH


156 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 02:13:54
Windows‚Ěƒo[ƒWƒ‡ƒ“‚­‚炢‘‚ą‚¤‚ȁB‚Ĺ‚Č‚˘‚Ć’Ţ‚č‚ĆŽv‚í‚ę‚é‚ć

157 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 08:51:57
jgawk?

158 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 09:32:16
gawk.dll‚Á‚āA‚Ü‚ž’N‚Šƒƒ“ƒe‚ľ‚Ä‚­‚ž‚ł‚Á‚Ä‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
ĹV”Ĺgawk‚Ědll‚đ’T‚ľ‚Ä‚é‚ń‚Ĺ‚ˇ‚ށAŒŠ‚‚Š‚č‚Ü‚š‚ńB

‚Ü‚˝‚́Aƒ\[ƒX‚Ětar.gz‚Š‚çdll‚đě‚é•ű–@‚ލڂÁ‚Ä‚˘‚éƒy[ƒW‚đ
Œä‘ś’m‚Ě•ű‚Ş‚˘‚ç‚Á‚ľ‚Ⴂ‚Ü‚ľ‚˝‚çA‹ł‚Ś‚Ä‚˘‚˝‚ž‚Ż‚é‚Ə•‚Š‚č‚Ü‚ˇB


159 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 10:34:53
‚Č‚É‚đ‚˘‚Á‚Ä‚é‚Ě‚Š‚í‚Š‚ç‚ń
ƒ\[ƒX‚Ětar.gz‚Á‚ĂȂɁH

160 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 10:42:47
http://ftp.gnu.org/gnu/gawk/ ‚Š‚çƒ_ƒEƒ“ƒ[ƒh‚Ĺ‚Ť‚égawk-*.tar.gz‚Ě‚ą‚Ć‚Ĺ‚ˇ‚ށBB
source‚Š‚çgawk.exe‚đě‚Á‚˝‚č‚ľ‚Č‚˘‚Ě‚Ĺ‚ˇ‚ŠHH

dll‚Ə‘‚˘‚Ä‚˘‚é‚Ě‚Ĺ‚í‚Š‚é‚Š‚Ć‚ÍŽv‚˘‚Ü‚ˇ‚ށA
windowsŠÂ‹Ť‰ş‚Ĺ‚Ě˜b‚Ĺ‚ˇB•’i‚Ícygwin‚Ĺmake‚ľ‚˝gawk‚đŽg‚Á‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚ށA
dll‚Ş‚ ‚é‚Ć‘ź‚ĚŒžŒę‚Š‚çŒÄ‚яo‚ľ‚ÄŽg‚Ś‚é‚Ě‚Ĺ•Ö—˜‚Š‚ȁ[‚ĆŽv‚Á‚Ä‚Ü‚ˇB


161 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 10:45:49
cygwin‚Íwin—p‚Ěƒ\[ƒX‚ś‚á‚Č‚˘‚Š‚ç
win—p‚Ěƒ\[ƒX‚Ş‚˘‚é

162 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 11:53:32
>>160
Ě‚ ‚Á‚˝DLL”Ĺ‚ÍěŽŇ‚Ş“ĆŽŠ‚ɍě‚Á‚˝‚ŕ‚Ě‚Ý‚˝‚˘‚Ĺ
–{‰Ć‚É”˝‰f‚ł‚ę‚Ä‚Č‚˘‚Š‚ç–{‰Ć‚Ěƒ\[ƒX‚Š‚çDLL‚đě‚é‚Ě‚Í–ł—B
DLL”Ĺ‚Ěƒ\[ƒX‚đŽQl‚É‚ľ‚ÄŽŠ—Í‚Ĺě‚é‚Š
‚Ĺ‚Ť‚Č‚˘‚Č‚çěŽŇ‚ɘA—‚ľ‚Ä‹Ś—Í‚đ‹‚ß‚é‚ľ‚Š‚Č‚˘B

163 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/02(…) 12:05:07
>>160
ŽŠ•Ş‚ʼnüC‚ˇ‚é‚ľ‚Š‚Č‚˘‚ž‚ë

164 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/03(–Ř) 02:36:53
(ɁÍ`)@ą˛ŔŔŔ

165 F155F2008/07/05(“y) 15:47:31
>156
XP [Version 5.1.2600] ‚Ĺ‚Â

166 F [\{}@{}@{}-] ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/05(“y) 17:55:22
>>153
‚Ü‚žŒŠ‚Ä‚é‚Š?
‘˝•Ş‚Č‚¨‚Á‚Ä‚é‚ĆŽv‚¤‚ń‚ŐV‚ľ‚˘‚Ě‚ĹŽŽ‚ľ‚Ä‚Ý‚Ä‚­‚č‚âB


167 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/06(“ú) 06:36:13
‚¤‚¨H
ěŽŇ~—Ő‚Š

168 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/06(“ú) 07:02:21
‚ˇ‚ń‚΂炡‚Ą

169 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/20(“ú) 00:40:48
AWK@Žg‚Á‚Ä‚P‚T”NH@‚R‚O”N‘O‚ĚƒR[ƒh‚Ş“f‚Ťo‚ˇƒf[ƒ^‚đ‚ż‚ĺ‚ą‚Á‚Əˆ—‚ľ‚悤‚Ć‚ľ‚āc
FS=/[ ()]+/ ‚ÍŠú‘Ň’Ę‚č‚Ě“Ž‚Ť‚đ‚š‚¸AFS="[ ()]+" ‚Ə‘‚Š‚˂΂Ȃç‚Č‚˘B
‰‚ß‚Ä’m‚Á‚˝B
@ŒŸő‚ľ‚Ä‚ŕA‚ą‚ę‚ɂ‚˘‚Ä–ž‰ő‚ɏ‘‚˘‚Ä‚ ‚éƒy[ƒW‚Ş‚Č‚Š‚Č‚ŠŒŠ‚‚Š‚ç‚Č‚Š‚Á‚˝‚Ş
„ł‹K•\Œť’萔‚Ş‚ť‚ꎊg‚Ć‚ľ‚ÄŒť‚ę‚˝‚Ć‚ŤA‚ť‚ę‚̓pƒ^[ƒ“’†‚ÉŒť‚ę‚˝‚Š‚̂悤‚ɁA
„‚‚܂č`($0 ~ /foo/)' ‚̂悤‚É‚Ý‚Č‚ł‚ę‚éB
<’†—Ş>
„ŒžŒę‚Ě‚ą‚Ě‹@”\‚́APOSIX•W€‚Ü‚ĹƒhƒLƒ…ƒƒ“ƒg‰ť‚ł‚ę‚Č‚Š‚Á‚˝B
orz
@‚ą‚ę‚Ĺ‚PŽžŠÔ‚Ž‚炢ƒ€ƒ_‚É‚ľ‚˝BŽ„‚Ş’m‚ç‚Č‚Š‚Á‚˝‚ž‚Ż‚Ĺ‚ˇ‚ŠHH


170 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/20(“ú) 00:58:40
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKx‚É‚Íˆę‰žÚ‚Á‚Ä‚é‚Ż‚Ç‚Č
> iFS‚É‘ă“ü‚ł‚ę‚éj•śŽš—ń‚Ş1•śŽš‚ć‚č’ˇ‚˘‚Ć‚Ť‚́Cł‹K•\Œť‚Ć‚ľ‚Ĉľ‚í‚ę‚é

171 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/20(“ú) 01:10:48
ƒxƒ‹Œ¤Œn“‚ĚŒžŒę‚Í‹Lq‚ĚŽŠ—R“x‚Í‚ ‚é‚Ş‹““Ž‚ނ‚Š‚݂Â炢

172 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/20(“ú) 02:09:53
>>170
@hh‚ĹˆÍ‚ń‚ž•śŽš—ń‚ސł‹K•\Œť‚Ć‚ľ‚Ĉľ‚í‚ę‚é@‚Ć‚˘‚¤‚ą‚Ć‚Ć
@//‚ĹˆÍ‚ń‚žł‹K•\Œť’萔‚ŏ‘‚˘‚Ä‚Í‚˘‚Ż‚Č‚˘@‚Ć‚˘‚¤‚ą‚Ć‚Í“Ż‚ś‚Ĺ‚Í‚Č‚˘B
ŽŔŰAsplitŠÖ”‚́@‘ć‚Rˆř”‚É—^‚Ś‚鐳‹K•\Œť‚́@‚Ç‚ż‚ç‚Ĺ‚ŕ“Ž‚­
@‚ނނށA‚ą‚ą‚Ĺ‚Í($0~/foo/)‚É’u‚ŤŠˇ‚Ś‚Ä•]‰ż‚ł‚ę‚Č‚˘‚ń‚žc
171‚ĚˆÓŒŠ‚ސł‚ľ‚˘‚悤‚ž‚ˁ@ƒ`ƒƒƒ“ƒ`ƒƒƒ“



173 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/21(ŒŽ) 12:39:44
•Ą”‚Ěƒtƒ@ƒCƒ‹‚Ě“Ç‚Ýž‚Ý‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
print ƒtƒ@ƒCƒ‹1‚Ě$2 ƒtƒ@ƒCƒ‹2‚Ě$1
‚Ý‚˝‚˘‚ČŠ´‚ś‚Ĺ

174 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/21(ŒŽ) 13:06:32
>>173
paste‚ĹŒq‚˘‚ś‚áƒ_ƒ?
Ž„‚Í‚ć‚­‚â‚é‚Ż‚ǁB
‰ź‚Ƀtƒ@ƒCƒ‹1‚Ş5ƒJƒ‰ƒ€ŒĹ’č‚Č‚çA
paste ƒtƒ@ƒCƒ‹1 ƒtƒ@ƒCƒ‹2| awk '{print $2 $6;}'
‚Ä‚ČŠ´‚ś‚ŁB
# ƒJƒ‰ƒ€”‰Â•Ď‚Č‚ç‚ŕ‚¤ˆę”P‚č•K—v‚ž‚Ż‚ǂˁB

175 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/21(ŒŽ) 13:50:02
>>173
awk‚ž‚Ż‚Ĺ‚â‚č‚˝‚˘‚Č‚çgetline‚đŽg‚Ś‚΂łŤ‚éB

176 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/22(‰Î) 18:37:52
awk‚ˇ‚˛‚˘•Ö—˜‚ŁAgnuplot‚Ć‘g‚ݍ‡‚í‚š‚ÄExcel‚Š‚ç‰đ•ú‚ł‚ę‚‚‚ ‚č‚Ü‚ˇB
ă‚Ě•ű‚É‚ ‚Á‚˝DFA‚ĆNFAŽg‚Á‚Ă鎖‚Š‚ç‚­‚éˆá‚˘‚Á‚Ä‚Č‚ń‚Ĺ‚ˇ‚ŠH


177 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/07/23(…) 02:40:07
>>176

ˆę”Ô‚Ěˆá‚˘‚́ADFA‚ž‚ĆŒă•űŽQĆ‚Ş‚Ĺ‚Ť‚Č‚˘‚ą‚Ć‚Š‚ȁB
‚Ć‚č‚ ‚Ś‚¸

DFA
‘O€”ő‚ÉŽčŠÔ‚đŠ|‚Ż‚é‚Ż‚Ǐˆ—‚ť‚Ě‚ŕ‚Ě‚Í‘‚˘

NFA
‘ŚŔ‚ɏˆ—‚đŽn‚ß‚é‚Ż‚ǁAˆ—‚ÉŽžŠÔ‚Ş‚Š‚Š‚éę‡‚Ş‚ ‚éB

‚Ž‚炢‚ɍl‚Ś‚Ä‚¨‚Ż‚΂˘‚˘‚ĆŽv‚¤B


178 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/02(“y) 00:57:57
•ŰŽç

179 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/02(“y) 14:34:05
sh + awk ‚Í–ž‚ç‚Š‚ÉŠČ’P‚ž‚ĆŽv‚¤B
sh + awk ‚ŏo—ˆ‚é‚ą‚Ć‚đ perl ‚Ě‚Ý‚Ĺ‹Lq‚ˇ‚él‚Ě‹CŽ‚ż‚Ş‚Ç‚¤‚ľ‚Ä‚ŕ—‰đo—ˆ‚Č‚˘B
‚˝‚žAƒlƒbƒgƒ[ƒNƒvƒƒOƒ‰ƒ~ƒ“ƒOˆČă‚É‚Č‚é‚ĆC, perl, ruby ‚É‚Č‚ç‚´‚é‚đ“ž‚Č‚˘‚Ż‚ǁB

ƒ}ƒVƒ“’P‘Ě‚Ĺ‚ĚŽíX‚ĚŽč‘ą‚Ť‹Lq‚ž‚ƁA
sh + awk ‚Ş‚â‚Á‚Ď‚čˆę”ÔŠŽŒ‹‚É‚Č‚é‚ĆŽv‚¤‚ń‚ž‚Ż‚ǂȁ`B

180 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/02(“y) 14:49:58
‚¨‚ę‚ŕawk‚Ĺ‚Ĺ‚Ť‚é‚ą‚Ć‚Č‚çawk‚Ĺ‚â‚éB
‚Ĺ‚ŕ‚ ‚Ü‚č‚ɃgƒŠƒbƒL[‚Č‚ą‚Ć‚É‚Č‚č‚ť‚¤‚ž‚Á‚˝‚çperl‚Ĺ‚â‚Á‚˝‚股‚é‚Š‚ȁB


181 F‚ ‚˘‚ż‚á‚ńF2008/08/03(“ú) 01:39:18
l‚É“n‚ˇ‰Â”\Ť‚Ş‚ ‚é‚Č‚çAawk‚ÍŒ‹\‚‚炢‚ą‚Ć‚Ş‚ ‚éB
Perl‚Ĺ‚â‚ę‚Ίî–{“I‚É–â‘č‚Č‚˘‚Š‚çAPerl‚ŏ‘‚­•Č‚ނ‚­B
ShellScript‚Ĺ‚˘‚Á‚˝‚ńŽg‚¤‚ž‚Ż‚Č‚çAawk‚Í•Ö—˜‚ž‚Ż‚ǁB

182 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/04(ŒŽ) 01:23:58
>>180
‰´‚ŕ@AWK ‚Ĺ‚Ĺ‚Ť‚é‚Č‚çAWKB
‚ƍl‚Ś‚é‚Ɓ@ƒoƒCƒiƒŠ[‚Ěƒf[ƒ^‚˘‚ś‚éˆČŠO‚ÍAWK‚Ĺ‚Ĺ‚Ť‚é‚̂ł́c
i­‚Č‚­‚Ć‚ŕ@‰´‚É“úí‚Ěƒj[ƒd‚ł́@‚ť‚¤‚žj

183 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/04(ŒŽ) 02:16:24
>>182
“ŻŠ´B‚˝‚žƒoƒCƒiƒŠ‚ÍŽd•ű‚Č‚˘‚É‚ľ‚Ä‚ŕA
‘S”źŠpŹÝ‚ĚŒĹ’č’ˇƒtƒH[ƒ}ƒbƒg‚ވľ‚˘‚É‚­‚˘‚ń‚ž‚ć‚ȁB
ASCII‚É‚ˇ‚é‚Ć‘SŠp‚Ě‚Ý•”•Ş‚ޏˆ—‚ľ‚É‚­‚˘‚ľA
SJIS‚Ć‚Š‚É‚ˇ‚é‚Ɛł‚ľ‚­Ř‚čo‚š‚Č‚˘‚ľĽĽĽ
‚ ‚ę‚Í‚Č‚ń‚Ć‚Š‚Č‚ç‚ń‚ŕ‚Ě‚Š‚ȁB

184 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/07(–Ř) 01:55:09
‚â‚Á‚Ď‚č ASCII ‚ž‚Ż‚Ě–â‘č‚É‚ľ‚Ä‚¨‚˘‚˝•ű‚Ş–ł“ďB

185 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/11(ŒŽ) 15:38:13
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚Ĺƒ_ƒEƒ\‚Ĺ‚Ť‚é‚Ě‚ŞASCII‚ĆSJIS‚đ‚¤‚Ü‚­ˆľ‚Ś‚é‚â‚‚Ŕ‚á‚˂́H

186 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/13(…) 00:38:23
>>185
‚˘‚âA‚ť‚ĚgawkŽg‚Á‚Ä‚é‚Ż‚ǁA‘S”źŠpŹÝ‚ĚŒĹ’č’ˇ‚͍˘‚é‚Í‚¸B
—ź•ű•ĘX‚Č‚ç–â‘č‚Č‚­ˆľ‚Ś‚é‚Ż‚ǁA“ŻŽž‚ɂ͈ľ‚Ś‚Č‚˘B
—á‚Ś‚΁BSJIS‚Ps5ƒoƒCƒg+‰üs‚ĚŒĹ’č’ˇƒtƒ@ƒCƒ‹‚Ĺ
‚Ps‚Í‚Q€–ځia:‘S”źŠpŹÝ4ƒoƒCƒg b:”źŠp‚Ě‚Ý1ƒoƒCƒgj‚Ěƒtƒ@ƒCƒ‹‚Ş‚ ‚é‚Ć‚ŤB
asciiƒ‚[ƒh‚Č‚ça, b‚đŘ‚č•Ş‚Ż‚ç‚ę‚é‚Şa‚Ě‘SŠp•śŽš‚͏ˆ—‚Ĺ‚Ť‚Č‚˘B
sjisƒ‚[ƒh‚Č‚ça, b‚đŘ‚č•Ş‚Ż‚ç‚ę‚Č‚˘B

”Y‚Ü‚ľ‚˘‚̂́A€–Ú‚đŘ‚č•Ş‚Ż‚éƒXƒNƒŠƒvƒg‚đascii ƒIƒvƒVƒ‡ƒ“‚Ĺ‹N“Ž‚ľ‚Ä
o—ÍŒ‹‰Ę‚đsjis‚ŏˆ—‚ˇ‚ę‚΁i‚ß‚ń‚Ç‚­‚ł‚˘‚Ż‚ǁjŒťó‚ŏˆ—‚Ĺ‚Ť‚Ä‚ľ‚Ü‚¤B
‚̂ŁAƒ}ƒjƒ…ƒAƒ‹‚ɏ‘‚˘‚Ä‚ ‚é’Ę‚čAěŽŇ‚đ‚¨‚Ë‚Ş‚˘‚ˇ‚ę‚Ή”\Ť‚Í‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚ށA
‚¨Šč‚˘‚ˇ‚é‚Ě‚ŞçSçO‚í‚ę‚銴‚ś‚Ȃ̂ˁB


187 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/13(…) 22:12:09
awk‚ÍŽž‘ă‚̊֐”‚ž‚Š‚çŽg‚í‚ę‚Č‚­‚Č‚Á‚Ä‚˘‚­‚ń‚ž‚ë‚Č‚ 

188 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/15(‹ŕ) 02:08:00
UTF-8‚Ěę‡‚Ĺ‚ŕŒĹ’č’ˇ‚Í”źŠp•‚ľ‚Š‘Ήž‚Ĺ‚Ť‚Ä‚Č‚˘B
•śŽš”‚ĆƒoƒCƒg”‚Ć•\ŽŚ•‚Ć‚ŠA“ú–{Œę‚Í–Ę“|‚ž‚Ě‚¤B

length()‚Ć‚Š‚ĹƒoƒCƒg”‚đE‚Ś‚Č‚˘‚Š‚玊‘O‚ŏˆ—‚ŕ‚â‚č‚É‚­‚˘B

189 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/19(‰Î) 22:37:59
>>188
ˆęu”[“ž‚ľ‚Š‚Ż‚˝‚Ż‚ǁB
—âĂ‚ɍl‚Ś‚é‚ƁA‚ť‚ŕ‚ť‚ŕ‚P•śŽš‚Ş‰Â•Ď’ˇ‚Ĺ‚ ‚éUTF8‚đ
ŒĹ’č’ˇƒtƒ@ƒCƒ‹‚Ě•śŽšƒR[ƒh‚ÉŽg‚¨‚¤‚ƍl‚Ś‚˝“z‚đ’÷‚ßă‚°‚Ä
‹ƒ‚­‚قǖ₢‹l‚ß‚é•ű‚Şć‚ž‚ĆŽv‚¤‚͉̂´‚ž‚ŻH

l‚Ś‚Ä‚ŕl‚Ś‚Ä‚ŕƒƒŠƒbƒg‚ŞŽv‚˘‚‚Š‚Č‚˘‚ćc

190 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/21(–Ř) 00:40:10
>>189
‚Ů‚Ć‚ń‚Ç‚Ě•śŽšƒR[ƒh‚Ş‰Â•Ď’ˇ‚ž‚Š‚ç‚Č‚ B
‘Š‘ΓI‚ÉŒŠ‚ę‚΃}ƒV‚Č•ű‚É“ü‚é‚ń‚ś‚á‚Č‚˘?
ƒzƒXƒg‚Ş—‚Ţ‚Ć•śŽšƒR[ƒhŽü‚č‚͔ߎS‚ž‚ćc
ƒzƒXƒg‚ś‚á‚Č‚˘‚Č‚ç‚ť‚ŕ‚ť‚ŕŒĹ’č’ˇ‚ś‚á‚Č‚­‚Ä—Ç‚˘‚ń‚ž‚Ż‚ǂˁB

191 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/23(“y) 01:53:25
‚ ‚éƒtƒBƒ‹ƒ^ƒXƒNƒŠƒvƒg‚đgawk‚ŏ‘‚˘‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚Ş
•śŽš‚ĚƒR[ƒh‚𐎐”’l‚É•ĎŠˇ‚ľ‚悤‚Ć‚ľ‚Ä‚¤‚Ü‚­‚˘‚Ť‚Ü‚š‚ń
‚˝‚Ć‚Ś‚΁ucv‚Ć‚˘‚¤•śŽš‚ĚƒR[ƒh‚𐎐”’l‚É‚ľ‚悤‚Ć‚ľ‚Ä
BEGIN {
@testChar = "c";
@printf("testChar=%d\n",testChar);
}
‚̂悤‚É‚ľ‚Ä‚ŕutestChar=0v‚Ć•\ŽŚ‚ł‚ę‚Ä‚ľ‚Ü‚˘‚Ü‚ˇ
—Ç‚˘•ű–@‚Ş‚ ‚ę‚΂¨‹ł‚Ś‚­‚ž‚ł‚˘

192 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/08/23(“y) 03:21:15
>>191

awklib ‚É ord ‚Á‚ㆁ[ƒU[’č‹`‚Ěƒ‰ƒCƒuƒ‰ƒŠŠÖ”‚Ş‚ ‚é‚Š‚ç‚ť‚ę‚đŽg‚¤B
ŽŠ‘O‚ōě‚Á‚Ä‚ŕ‚˘‚˘‚Ż‚ǂˁB

‚­‚í‚ľ‚­‚Í info gawk ‚Ĺ’˛‚ׂāB


193 F191F2008/08/23(“y) 03:28:08
>>192
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
‘‘ŹŒŸ“˘‚ľ‚Ä‚Ý‚Ü‚ˇ

194 F191F2008/08/23(“y) 10:56:41
>>192
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_16.html
‚É‚ ‚Á‚˝‚ŕ‚Ě‚đŽŽ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝.Šú‘Ň‚Ç‚¨‚č‚Ě“Žě‚đ‚ľ‚Ä‚­‚ę‚Ü‚ˇ.
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝.

195 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/15(ŒŽ) 01:12:37
“ü—Í“ŕ—e‚đawk‚ŐśŹ‚ˇ‚é‚ą‚Ć‚Ío—ˆ‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š
‚ŕ‚ľ‚­‚ÍBEGIN“™‚ĚƒuƒƒbƒN“ŕ‚Ĺ•śŽš—ń‚𐜐Ź‚ľ‚Ä
‚ť‚Ě•śŽš—ń‚Ěƒpƒ^[ƒ“–ˆ‚É•ŞŠňAƒtƒB[ƒ‹ƒh‚đŽg‚Á‚Ä‚Ěˆ—
i—v‚Íawk‚É“ü—̓tƒ@ƒCƒ‹“n‚ľ‚˝Žž‚ÉŠČ’P‚ɏ‘‚Ż‚鏈—j
‚đŠČ’P‚ɏ‘‚­‚ą‚Ć‚Ío—ˆ‚é‚Ě‚Ĺ‚ľ‚傤‚Š

—á‚Ś‚΁c‚Ç‚ń‚ȏˆ—‚Ş“KŘ‚Čŕ–ž‚Š”ť‚č‚Ü‚š‚ń‚Ş
BEGIN{for(i=0;i<10;i++) print int(rand()*10),int(rand()*10),int(rand()*10)}
‚ĚŒ‹‰Ę‚ɑ΂ľ‚Ä
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
c‚Ć‚Š‚ť‚ń‚ČŠ´‚ś‚ŁAƒeƒLƒXƒg‚𐜐Ź‚ľ‚˝Œ‹‰Ę‚ɑ΂ľ‚Ä
ƒtƒBƒ‹ƒ^[‚Ć‚ľ‚Ä”äŠrŽŽ‚␳‹K•\Œť‚Ĺ•ŞŠň‚ľ‚āAƒtƒB[ƒ‹ƒh‚đŽg‚Á‚ďˆ—‚ˇ‚銴‚ś‚Ĺ‚ˇB

‚â‚Á‚Ď‚čƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ćawkƒtƒ@ƒCƒ‹‚đ‚˘‚­‚‚ŕě‚Á‚˝‚č
ˆęsˆęs‚ɑ΂ľ‚Äif•ś‚Ĺ•ŞŠň‚ľ‚˝‚čsplit‚Ĺ•ŞŠ„‚ˇ‚é‚ľ‚Š–ł‚˘‚Ĺ‚ˇ‚Š‚ˁcB

196 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/15(ŒŽ) 01:52:51
>>195
Š¸‚Ś‚Ä“ü—͂𐜐Ź‚ľ‚˝‚˘‚Ě‚Č‚çAawk‚đƒpƒCƒv‚ĹŒq‚°‚΂˘‚˘‚ĆŽv‚¤B
‚ť‚¤‚Ĺ‚Í‚Č‚­A’P‚É—”‚ŏˆ—‚đU‚č•Ş‚Ż‚˝‚˘‚̂Ȃ畁’Ę‚Éif•ś‚Ĺ‚˘‚˘‚ĆŽv‚¤B

‚ť‚ę‚Í‚ł‚Ä‚¨‚ŤA
--
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
--
‚Í•Ę‚Éă‚ĚđŒŽŽ‚Í—v‚ç‚ń‚ž‚ëBˆęŒ…‚̐”’l‚đ10‚ĹŠ„‚Á‚˝—]‚č‚ÍŒł‚Ě‚Ü‚Ü‚ž‚Š‚ç‚ȁB

197 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/15(ŒŽ) 14:18:55
>196
‚˘‚â‚ ‚­‚Ü‚Ĺ—á‘č‚Č‚Ě‚Ĺ“ŕ—e‚͐[‚­l‚Ś‚Č‚˘‚Ĺ‚­‚ž‚ł‚˘corz

•’Ę‚Éif•ś‚Ć‚ÍŒž‚¤‚ŕ‚̂́AÜŠpawk‚Ş•W€‚Ĺ”ő‚Ś‚Ä‚é•Ö—˜‚Č‹@”\‚𖳎‹‚ľ‚Äç’ˇ‚ȏ‘‚Ť•ű‚ˇ‚é‚Ě‚ŕ“ď‚ž‚ľ
‚Š‚ĆŒž‚Á‚Ä.awkƒtƒ@ƒCƒ‹•Ą”ŒÂ‚Ćƒoƒbƒ`‚ŁAƒpƒCƒv‚ł‚Ȃ°‚ďˆ—‚ˇ‚é‚Ě‚ŕc‚¤`‚ńA‚Ć‚Č‚Á‚Ä‚ľ‚Ü‚¤B
—Ç‚˘‘‚Ť•ű–ł‚˘‚Š‚Č‚Ÿ‚ĆŽv‚Á‚˝‚Ě‚Ĺ•ˇ‚˘‚Ä‚Ý‚˝‚Ě‚Ĺ‚ˇ‚ށAif‚Ćsplit‚ĹŠć’Ł‚č‚Ü‚ˇB

198 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/16(‰Î) 02:58:54
Žż–â‚Ş‚ć‚­‚í‚Š‚ç‚ń‚Ě‚ž‚ށABEGIN•”‚ŐśŹ‚ľ‚˝ƒtƒ@ƒCƒ‹‚đˆ—•”‚Ĺˆľ‚˘‚˝‚˘‚Ć‚˘‚¤‚ą‚Ć‚Š‚ȁH
—á‚Ś‚΁A
gawk 'BEGIN{ ARGV[1]="in_file.txt"; ARGC=2; }{ print }'
‚Á‚Ä‚â‚Á‚˝‚ç in_file.txt ‚đ•\ŽŚ‚Ĺ‚Ť‚é‚ź‚˘

199 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/16(‰Î) 09:51:03
>198
III
–Ú‚Š‚ç—Ř‚Ĺ‚ˇB

‚ť‚Á‚ŠAƒtƒ@ƒCƒ‹śŹ‚ľ‚ż‚á‚Ś‚Îˆę”­‚ōs‚Ż‚é‚Ě‚Šc‚â‚Á‚Ä‚Ý‚Ü‚ˇ

200 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/16(‰Î) 15:07:48
‚¤‚°Aˆę’Uƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í‚ ‚č‚Č‚Ě‚Š‚ćB
if‚đŽg‚¤‚Ě‚Íç’ˇ‚Ȃ̂ɁAƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Íç’ˇ‚ś‚á‚Č‚˘‚Á‚Ä‚Ç‚ń‚ČƒZƒ“ƒX‚Č‚ń‚žB

201 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/16(‰Î) 17:48:16
>200
“ü—̓f[ƒ^‚Í‹K‘ĽŤ‚Ě‚ ‚é‚ŕ‚̂ŁAśŹ‚ľ‚Ä‚ľ‚Ü‚Ś‚é‚Ż‚Ç
‚ť‚ę‚ɑ΂ľ‚Ä‚Ě•ŞŠň‚Í‘˝‚˘c‚Ć‚˘‚¤ę‡
if‚âsplit‚đ—…—ń‚ˇ‚é‚ć‚č‚ŕAawk‚ŞŒłXŽ‚Á‚Ä‚é
ƒpƒ^[ƒ“‚ĆƒtƒB[ƒ‹ƒh•ŞŠ„‚đŽg‚Á‚˝•ű‚Ş
ƒXƒbƒLƒŠ‚ˇ‚é‚ĆŽv‚¤‚Ě‚Ĺ‚ˇ‚ŞŠÔˆá‚Á‚Ä‚é‚Ĺ‚ľ‚傤‚ŠcB

202 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/16(‰Î) 19:39:26
>>201
•Ę‚É‚˘‚˘‚ń‚ś‚á‚Ë?
‹‘ĺ‚Č’†ŠÔƒtƒ@ƒCƒ‹‚đě‚é‚Á‚Ä‚í‚Ż‚Ĺ‚ŕ‚Č‚˘‚ń‚ž‚낤‚ľB
‚Ü‚ŸAŽŸ‚Ě——R‚ĹŽ„‚Í’†ŠÔƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í”đ‚Ż‚é‚Ż‚ǂˁB
Eƒtƒ‹ƒpƒX‚đŽw’č‚ľ‚Č‚˘ę‡AƒJƒŒƒ“ƒgƒfƒBƒŒƒNƒgƒŠ‚ɏ‘‚Ťž‚ÝŒ ŒŔ‚Ş‚ ‚é•Űá‚Ş‚Č‚˘B
E‚ť‚ŕ‚ť‚ŕ“Ż–źƒtƒ@ƒCƒ‹‚Ş‘śÝ‚ľ‚Ä‚˘‚ď‘‚Ťž‚ÝŒ ŒŔ‚Ş‚Č‚˘‚Š‚ŕ’m‚ę‚Č‚˘B
E‚[‚ŠA“ŻŽž‚É2Œ“Ž‚Š‚ľ‚˝‚çƒoƒbƒeƒBƒ“ƒO‚ľ‚Ä‚ľ‚Ü‚¤B
E‚ž‚Š‚ç‚ĆŒž‚Á‚āAˆęXƒ†ƒj[ƒN‚Č–ź‘O‚Ěƒtƒ@ƒCƒ‹–ź‚𐜐Ź‚ˇ‚é‚Ě‚ŕ–Ę“|‚žB
E‚ľ‚Š‚ŕA’†ŠÔƒtƒ@ƒCƒ‹‚ÍŒă‚ŏÁ‚ľ‚Ä‚¨‚­•K—v‚Ş‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘B

‚ť‚ę‚ƁAŽŠ‘O‚Ĺ“ü—͂𐜐Ź‚ˇ‚é‚Č‚çAĹ‰‚Š‚ç•ŞŠ„‚ł‚ę‚˝ó‘Ô‚Ĺě‚ę‚΂˘‚˘‚Š‚çsplit‚Í—v‚ç‚Č‚˘‚ˁB
ƒpƒ^[ƒ“‚đŽg‚¤‚Šif‚đŽg‚¤‚Š‚ÍŽď–Ą‚Ě–â‘č‚̂悤‚Č‹C‚Ş‚ˇ‚é‚Ż‚ǁB
# $1+$2+$3<10{print;}‚Ə‘‚­‚Šif($1+$2+$3<10){print;}‚Ə‘‚­‚Š‚Ěˆá‚˘‚ž‚ŕ‚ń‚ˁB

203 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/18(–Ř) 01:19:00
FXl‚Ś•ű‚Ş‚ ‚é‚̂ˁB

ŽŠ•Ş‚Č‚çƒgƒŠƒbƒL[‚ȍ׍H‚ľ‚Ä‚P‚‚Ɏű‚ß‚¸•ŞŠ„‚ľ‚ÄifŽg‚킸‚ɏ‘‚­‚Ż‚ǁB
Žč‘‚­ƒJƒ^‚đ‚‚Ż‚ç‚ę‚é‚Ě‚Şawk‚Ě—Ç‚˘Š‚ž‚ĆŽv‚¤‚ľA
‹ZI‚É‘–‚é‚ĆŠÔˆá‚˘‚Č‚­–Y‚ę‚é‚Ě‚Ĺƒƒ“ƒe•s‰Â”\‚É‚Č‚é‰Â”\Ť‘ĺ

‚܁A‚ť‚ę‚Í‚ť‚ę‚Ć‚ľ‚Ä>>198‚̓pƒYƒ‹“I‚Č–Ę”’‚ł‚Ş‚ ‚Á‚Ä—Ç‚˘‚ˁB


204 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/19(‹ŕ) 19:54:42
>202
‚¤`‚ńAŒž‚í‚ę‚Ä‚Ý‚ę‚΂ť‚¤‚Š‚ŕB
ˆę‰žAĄ‰ń‚Ě‚ÍŽdŽ–‚ĹŽg‚¤‚í‚Ż‚Ĺ‚ŕ‚Č‚Ż‚ę‚Αźl‚ÉŽg‚Á‚Ä‚ŕ‚炤—\’č‚ŕ‚Č‚˘
ŠŽ‘S‚ČŒÂl—pƒXƒNƒŠƒvƒg‚Č‚Ě‚Ĺ‚Ç‚¤‚É‚Ĺ‚ŕ‚Č‚č‚Ü‚ˇ‚Ş
‚ą‚ę‚Ş‹Ć–ą‚⎊•ŞˆČŠO‚ŕŽg‚¤‚ŕ‚Ě‚Ĺ‚ ‚ę‚Αf’ź‚Éif‚Č‚ń‚Ĺ‚ľ‚傤‚ˁB

205 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/22(ŒŽ) 20:50:40
2008/09/15 13:17 61 20080915142145.txt
2008/09/16 13:17 316 2008091611529.txt
2008/09/22 20:09 24,028 2008_0922asahiindex.txt
2008/09/22 12:57 1,545 clean.txt

‚Ć‚˘‚¤ƒtƒ@ƒCƒ‹ˆę——‚Š‚çAgawk‚ōĄ“ú‚Ě“ú•t‚Ěƒtƒ@ƒCƒ‹‚ž‚Ż”˛‚Ťo‚ˇ‚É‚Í‚Ç‚¤‚ˇ‚č‚Ⴂ‚˘‚ń‚ž‚Á‚Ż?

BEGIN{month = strftime("%m",systime()); date = strftime("%d",systime())}

/month/ && /date/ {print $0}

‚Ĺ‚˘‚˘‚Š‚ĆŽv‚Á‚˝‚çA/ /‚Ě‚Č‚Š‚Émonth‚Ć‚Š‚ÍŽg‚Ś‚Č‚˘‚ç‚ľ‚˘B

/strftime("%d",systime())/ {print $0}
‚Ƃׂ˝‘‚Ť‚ľ‚Ä‚ŕ‚ž‚߁B
‚Ç–Y‚ę’†Bƒwƒ‹ƒvƒ~[B


206 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/22(ŒŽ) 21:05:13
BEGIN{date=strftime("%m/%d")} $0 ~ date {print $0}

207 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/09/22(ŒŽ) 21:45:34
>>206
thanks!

208 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/10/10(‹ŕ) 19:41:51
Žż–â‚Ĺ‚ˇB
“ü—Í’†‚Ěƒtƒ@ƒCƒ‹–ź‚ÍFILENAME‚ɃZƒbƒg‚ł‚ę‚Ü‚ˇ‚ށA
“ü—Í’†‚Ěƒtƒ@ƒCƒ‹‚ĚƒpƒX‚đŽć“ž‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ˇ‚ŠB


209 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/10/10(‹ŕ) 22:13:43
>>208
FILENAME‚Ĺ“ž‚ç‚ę‚éî•ń‚Ş‘S‚āBƒtƒ‹ƒpƒX‚Ş—~‚ľ‚˘‚Ć‚˘‚¤‚ą‚Ć‚Č‚çA
cwd‚đŽć“ž‚ľ‚Ä‚ť‚ą‚Š‚ç‚Ě‘Š‘΃pƒX‚ŞFILENAMEB

210 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/12(…) 19:19:08

awk‚ĚŒ‹‰Ę‚đ set ‚Š@setenv ‚̕ϐ”‚É‘ă“ü‚ľ‚˝‚˘‚Ĺ‚ˇB

awk '{ print $1+ $3 }' test.txt
‚Ő”’l‚ޏo‚Ü‚ˇB
‚ą‚ĚŒ‹‰Ę‚đ•Ď”‚É‘ă“ü‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚炢‚˘‚ń‚Ĺ‚ľ‚傤‚ŠH

set tmp=`awk '{ $1+ $3 }' test.txt`

‚ą‚ę‚ž‚ƏăŽč‚­‚˘‚Ť‚Ü‚š‚ńBprint ‚Í‚ť‚Ě‚Ü‚Ü‚Ĺ‚˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH

211 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/12(…) 20:24:22
‚Č‚ń‚Ĺ print ‚đČ—Ş‚Ĺ‚Ť‚é‚ƍl‚Ś‚˝‚Ě‚Š‚Ş“ä‚ž‚Ş

212 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/12(…) 23:57:16
>print ‚Í‚ť‚Ě‚Ü‚Ü‚Ĺ‚˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚Ü‚¸ŽŽ‚š‚ć‚—

213 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/13(–Ř) 14:17:14
V‹IŒłŽĐ‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęawk‚Ş‚Ç‚ą‚ŕ”„‚čŘ‚ę‚Č‚ń‚ž‚Ż‚Ç
‚ŕ‚¤“ü‚ç‚Č‚˘‚Ě‚Š‚Č

214 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/16(“ú) 03:02:56
>>211
print‚͉ć–Ę•\ŽŚ‚ˇ‚é‚ŕ‚́¨•Ď”‚É“ü‚ę‚é‚ž‚Ż‚Č‚ç•s—v
c‚ĆŽv‚Á‚˝‚ń‚ś‚á“ŕ‰Č‚Ë

215 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 11:28:33
ƒJƒ“ƒ}‹ćŘ‚č‚Ěƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ş‚ ‚čA‚ť‚Ě’†‚ŁA‘ć‚PƒtƒB[ƒ‹ƒh‚Ć‘ć‚RƒtƒB[ƒ‹ƒh“ŕ‚É‚ŕ‚ľ
Žq‰šAŽq‰šAŽq‰šA•ę‰š‚Ş‘śÝ‚ˇ‚ę‚΂ť‚̍s‚ž‚Ż”˛‚Ťo‚ˇƒI[ƒN‚ĚƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚đ‚‚­‚č‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚¤‚ˇ‚ę‚΂悢‚Ĺ‚ˇ‚Š

216 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 11:41:15
>>215
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚ĚƒTƒ“ƒvƒ‹‚Ć”˛‚Ťo‚ľ‚˝‚˘sƒˆƒ

217 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 11:50:40
‚ą‚ń‚ČŠ´‚ś‚Ĺ‚ˇ
takeshi,fiad,fdjioaf,fdjsoafdsiŠŠY“–‚Č‚ľj
dddacea,fsaofsa,rrra,fjisaofdjsaiddda‚Ćrrra‚ŞŠY“–j
aexxxu,dsoifsa,yyyuo,fjsaofaixxxu‚Ćyyyu‚ŞŠY“–j

218 F‚Ń‚Ź‚Č‚ŸF2008/11/18(‰Î) 12:12:55
ƒI[ƒNƒXƒNƒŠƒvƒg‚đŽŔs‚ˇ‚é‚Əî•ń‚đ•\ŽŚ‚ˇ‚é‚悤‚É‚ľ‚˝‚Ě‚Ĺ‚ˇ‚Ş‚Ps–Ú‚ĆĹŒă‚̍s‚ž‚Ż‚đ•\ŽŚ‚ľ‚Č‚˘‚悤‚É‚ˇ‚é‚É‚Í
END“ŕ‚ɉ˝‚ď‘‚Ż‚΋X‚ľ‚˘‚Ĺ‚ľ‚傤‚Š

219 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 12:43:59
>>215
BEGIN{FS=","}
function term_check(term, lower_term) # lower_term ‚͋ǏŠ•Ď”
{
lower_term=tolower(term)
if(lower_term ~ /[bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][aiueo]/) return 1
return 0
}
{
if(term_check($1) && term_check($3)) print
}

ƒpƒ^[ƒ“ŒJ‚č•Ô‚ľ‚Á‚Ä {3} ‚Ć‚Š‚Ĺ‚˘‚Ż‚é‚Í‚¸‚Č‚ń‚ž‚Ş
‘‚Ť•ű’m‚ç‚Č‚˘‚Ě‚ĹƒRƒsƒy‚ľ‚˝‚—

220 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 12:47:37
>>218
’€ŽŸo—Í‚ľ‚Ä‚éH
END ‚Ĺ‚Ü‚Ć‚ß‚Äo—Í‚ľ‚Ä‚éH

221 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 13:53:22
>>218
1s‚¸‚ƒoƒbƒtƒ@ƒŠƒ“ƒO‚ľ‚āAŽŸ‚̍s‚Ě“ü—Í‚Ĺ‘O‚̍s‚đo—Í‚ˇ‚ę‚ÎĹŒă‚̍s‚͏Á‚Ś‚Ä‚Č‚­‚Č‚éB
awk 'NR > 2 {print buffer;} NR > 1 {buffer = $0;}'

222 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 14:20:29
>>215
gawk‚Č‚ç
awk -F "," -v r="[bcdfghj-np-tv-z]{3}[aiueo]" --posix '$1 ~ r && $3 ~ r'
$1‚Ć$3‚Ç‚ż‚ç‚Šˆę•ű‚É‚ ‚ę‚΂˘‚˘‚Č‚ç&&‚đ||‚É•Ď‚Ś‚Ä‚Ë

223 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/18(‰Î) 16:29:37
>>219
•‚Š‚č‚Ü‚ľ‚˝I

224 F‚Ń‚Ź‚Č‚ŸF2008/11/18(‰Î) 16:46:03
o—ˆ‚Ü‚ľ‚˝@‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ

225 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/19(…) 23:48:41
ž‚Ý“ü‚Á‚ĂĐŽ—‚Ĺ‚Ť‚Č‚˘‚Ě‚Ĺ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B
E‘ÎŰ‚ĚƒeƒLƒXƒg‚Í2s–Ú‚Ş‚Č‚˘(1s–Ú‚ľ‚Š‚Č‚˘)‚Š‚Â
E1s–Ú‚Í‚Đ‚ç‚Ş‚ČƒJƒ^ƒJƒiŠżŽš‚Ĺ15•śŽšˆČ“ŕ
‚Ć‚˘‚¤đŒ‚đ‘‚­‚Ě‚Á‚āAŽŸ‚̂悤‚É‚ľ‚˝‚Ě‚Ĺ‚ˇ‚ށA‚¤‚Ü‚­ƒqƒbƒg‚ľ‚Ü‚š‚ńB
‚Ç‚¤‘‚Ż‚΂˘‚˘‚Ĺ‚ľ‚傤?

NR==2 && length($0) == 0 && NR==1 && /[‚Ÿ-‚ńƒ@-ƒ–ˆŸ-˜r]{1,15}/


226 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/19(…) 23:53:31
>>225
NR == 2 && NR == 1‚ś‚áAâ‘ΐŹ—§‚ľ‚Č‚˘‚ž‚ëB

227 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/19(…) 23:54:54
awk‚͍s‚đ1s‚¸‚ˆ—‚ˇ‚é‚Š‚çAŽ–‘O‚Ƀg[ƒ^ƒ‹s”‚đ’m‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘B
ƒg[ƒ^ƒ‹s”‚Ş1s‚Ĺ‚ ‚é‚ą‚Ć‚đ•ŰŘ‚ľ‚˝‚˘‚Č‚çAENDƒuƒƒbƒN‚ŏˆ—‚ˇ‚é‚ľ‚Š‚Č‚˘B

228 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/20(–Ř) 00:22:37
>Ž–‘O‚Ƀg[ƒ^ƒ‹s”‚đ’m‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘
BEGIN•”‚Ő”‚Ś‚ę‚΁H

229 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/20(–Ř) 00:28:19
>>228
‚Ç‚¤‚â‚Á‚Ä? ‘ÎŰ‚Şƒtƒ@ƒCƒ‹‚Ĺ‚ ‚é•ŰŘ‚Ş‚ ‚é‚Č‚çwc‚Ĺ‚ŕŒÄ‚ׂ΂˘‚˘‚Ż‚Ç‚ť‚ę‚Č‚çawk‚Ĺ‚â‚é•K—v‚ł‚Ś‚Č‚˘‚ć‚ˁB

230 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/20(–Ř) 03:49:07
{ a = $0 }
END { if (NR == 1 && a ~ /re/) print a }
‚Ć‚Š?

231 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/20(–Ř) 23:58:06
‚Ç‚Č‚˝‚ŠA”CˆÓƒrƒbƒg•‚Ě2‚̕␔HEX‚đDEC‚É•ĎŠˇ‚ˇ‚éƒvƒƒOƒ‰ƒ€‚đ‘‚˘‚Ä‚ŕ‚ç‚Ś‚Ü‚š‚Ę‚ŠH

232 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/22(“y) 12:02:58
Žd—l‚Ş•s–žŠm‚Č‚Ć‚ą‚ë‚Ş‚ ‚é‚ľA‚Č‚É‚ć‚č‚Č‚ń‚Ĺawk‚Ĺ?


233 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/26(…) 22:53:51
>>232
‚ą‚ą‚ŞawkƒXƒŒ‚ž‚Š‚ç‚Ĺ‚ľ‚ĺB

234 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/11/29(“y) 03:05:38
>>232
l‚Ś‚é‚ȁBŠ´‚ś‚ë‚—

235 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/12/12(‹ŕ) 07:21:00
u‚ ‚Č‚˝‚͉˝ŒĚawk‚Ĺ‚â‚낤‚Ć‚ˇ‚é‚Ě‚Ĺ‚ˇ‚ŠHv
u‚ť‚ą‚Éawk‚Ş‚ ‚é‚Š‚çv

236 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/12/13(“y) 04:23:45
awk‚Š‚çsystem()‚Ĺgrep‚Ć‚Šsed‚Ć‚ŠŒÄ‚ń‚ž‚股‚é•Č‚Ş•t‚˘‚Ä‚˘‚é
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚ˇ‚é•ű‚Ş‚Ţ‚ľ‚ëˆá˜aŠ´

237 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/12/13(“y) 23:56:31
‚¨‚˘‚¨‚˘Agrep‚âsed‚Ž‚炢ŒÄ‚яo‚ł‚¸‚Éawk‚Ĺ‚â‚낤‚şB


238 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2008/12/16(‰Î) 00:29:26
grep‚âsed‚̓pƒCƒv‚ł‚Ȃ°‚ÄŽg‚¤‚ŕ‚Ě‚ś‚á‚Č‚˘‚́H(^^;

239 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/10(“y) 22:10:41
gawk 3.1.4 mb@‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c

240 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/11(“ú) 00:38:51
‚Č‚ń‚Ĺ‚ť‚ń‚ČŒĂ‚˘ƒo[ƒWƒ‡ƒ“‚Ş—~‚ľ‚˘‚Ě?


241 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/11(“ú) 12:16:04
>‚Č‚ń‚Ĺ‚ť‚ń‚ČŒĂ‚˘ƒo[ƒWƒ‡ƒ“‚Ş—~‚ľ‚˘‚Ě?
length‚Ć‚Šsubstr‚ŁAujv•t‚Ť•śŽš—ńŠÖ”‚Ş‚ ‚é‚Š‚ç‚Ĺ‚ˇB
3.1.5ˆČ~‚ž‚ƁA“Ż‚śƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹“ŕ‚ŁAƒoƒCƒg’PˆĘˆ—‚Ć
ƒLƒƒƒ‰ƒNƒ^[’PˆĘˆ—‚̍ŹÝ‚Ş“ď‹V‚Č‚Ě‚Ĺ‚ˇB


242 F240F2009/01/11(“ú) 15:01:36
3.1.5‚Ĺ•śŽš‚Ěˆľ‚˘‚Ş•Ď‚í‚Á‚˝‚Ě‚Í‚ť‚Ě’Ę‚č‚ž‚Ż‚ǁA3.1.4‚ĚWindows”Ĺ‚Ä
jlength‚â‚ç‚ ‚Á‚˝‚Á‚Ż?
‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB


243 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/11(“ú) 15:48:22
>‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB
‚Ś‚ÁB3.1.4ˆČ‘O‚Ě‚ÍƒoƒCƒg’PˆĘƒIƒ“ƒŠ[‚Á‚ÄŽ–‚Ĺ‚ˇ‚ŠH
c‚ť‚ę‚Ĺ‚ŕ2ƒoƒCƒgŠˇŽZ‚Ĺˆľ‚Ś‚΂˘‚˘‚Š‚çA‚Ü‚žƒ}ƒV‚Š‚ŕB

j•t‚Ť‚ޒljÁ‚ł‚ę‚Ä‚˘‚˝‚Ż‚ǁA“Žě•ĎX‚É”ş‚Á‚Ä”pŽ~‚ł‚ę‚˝c
‚ĆŽv‚Á‚Ä‚˘‚Ü‚ľ‚˝B
‹L‰Ż‚É‚ ‚é‚̂́A‚Ç‚Č‚˝‚Š‚Ě“ĆŽŠŠg’Ł•ĘVer‚ž‚Á‚˝‚Ě‚ŠcH


244 F240F2009/01/11(“ú) 17:54:21
> ‚Ś‚ÁB3.1.4ˆČ‘O‚Ě‚ÍƒoƒCƒg’PˆĘƒIƒ“ƒŠ[‚Á‚ÄŽ–‚Ĺ‚ˇ‚ŠH ‚ż‚ႤB
j‚Č‚ń‚Ć‚Š‚Ş‚ ‚Á‚˝‚̂́A
2.11ƒx[ƒX‚Ějgawk‚Ć2.15ƒx[ƒX‚Ějgawk
2.15ƒx[ƒX‚Ě‚Ćgawk+mb
3.0.xƒx[ƒX‚Ěgawk+mb
‚ŁA3.1.xƒx[ƒX‚Ě‚É‚Í‚Č‚Š‚Á‚˝‚Ć‚˘‚¤˜b‚ž‚Á‚˝‚ĆŽv‚¤B
‚ť‚ę‚ź‚ę‚â‚Á‚Ä‚él‚ވႤB


245 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/11(“ú) 19:05:17
>3.1.xƒx[ƒX‚Ě‚É‚Í‚Č‚Š‚Á‚˝‚Ć‚˘‚¤˜b‚ž‚Á‚˝‚ĆŽv‚¤B
‚ť‚¤‚Ĺ‚ˇ‚ŠcB
gawk 3.1.4 mb ‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
‚Ĺ‚Í‚Č‚­‚āA
3.0.xƒx[ƒX‚Ěgawk+mb ‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
‚Ć‚˘‚¤Ž–‚É‚Č‚é–ó‚Ĺ‚ˇ‚ށc–ł—‚Á‚Ű‚˘B
‚ ‚Á‚Ä‚ŕŠÖ”‚â‘gž•Ď”‚ŞŒ¸­c‚ť‚Ě‘O‚É16bitDOS”ĹONLY‚Ě—\Š´cB
’ú‚ß‚Ü‚ˇB240‚ł‚ńA‚Ç‚¤‚ŕ‚Ĺ‚ľ‚˝B

246 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/11(“ú) 19:50:26
>>245

http://www.hinadori.atnifty.com/~wills/
‚É‚ ‚é‚ćB3.0.6‚̂₁B
DOS”Ĺ‚ž‚Ż‚ś‚á‚Č‚­‚ÄWin32”Ĺ‚ŕ‚ ‚éB

3.0.6→3.1.x‚Ĺ‘‚Ś‚˝‹@”\‚Ĺ‚ŕŽg‚Á‚Ä‚ń‚Ě?



247 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/01/11(“ú) 22:30:39
>‚ ‚é‚ćB3.0.6‚̂₁B
‚¨‚¨B ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
>3.0.6¨3.1.x‚Ĺ‘‚Ś‚˝‹@”\‚Ĺ‚ŕŽg‚Á‚Ä‚ń‚Ě?
‚˘‚‰˝‚Ş‘‚Ś‚˝‚Ě‚Š‚ć‚­”cˆŹ‚ľ‚Ä‚˘‚Č‚˘‚ń‚Ĺ‚ˇ‚ށA
gensub‚Ć‚Šmktime‚Ć‚Šswitch-case‚Ć‚Šc‚ ‚č‚Ü‚ˇ‚Š‚ˁB
‚Ü‚ A‘ă‘ÖŽč’i‚Í‚ ‚é‚Ě‚ĹŽŽ‚ľ‚Ä‚Ý‚Ü‚ˇB‚Ç‚¤‚ŕ‚Ĺ‚ˇB

248 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/02/23(ŒŽ) 08:11:12
awk‚ŁA‘g‚ݍ‡‚í‚š‚Ě‘S‚Ä‚đě‚éA‚Ć‚˘‚¤Ž–‚Í‚Ĺ‚Ť‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚˘‚í‚ä‚én‚br‚́AŒÂ”‚Ĺ‚Í‚Č‚­‚āA’†g‚đ’m‚č‚˝‚˘‚Ć‚˘‚¤Ž–‚Č‚Ě‚Ĺ‚ˇ‚ŞĽĽĽB
imawk‚đŽg‚Á‚Ä‚˘‚Ü‚ˇj


249 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/02/24(‰Î) 18:18:34
>>248
‚Ĺ‚Ť‚Ü‚ˇ

250 FsageF2009/03/04(…) 15:23:19
248‚Ĺ‚ˇB
‚Č‚ń‚Ć‚Š‚Ĺ‚Ť‚Ü‚ľ‚˝B249‚ł‚ń‚Ç‚¤‚ŕ‚Ĺ‚ˇB

251 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/03/04(…) 15:24:16
sageŠÔˆá‚Ś‚˝c

252 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/03/23(ŒŽ) 11:47:59
int(0.5005*10000)‚Ş5004‚É‚Č‚é‚Ě‚Í‚Č‚ş‚Ĺ‚ˇ‚ŠB

253 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/03/23(ŒŽ) 12:41:00
ŠŰ‚ßŒëˇ‚Ĺ‚ľ‚傤B
Ř‚čŽĚ‚Ä‘O‚É0.5‘Ť‚ˇ‚Ć‚ŠH•v‚ľ‚Ä‚Ý‚Ä‚Í”@‰˝‚Ĺ‚ľ‚傤‚ŠB
Ú‚ľ‚­‚́AIEEE‚ĆŠŰ‚ßŒëˇ•Ó‚č‚ĚƒL[ƒ[ƒh‚ĹŒŸő‚Ě‚ą‚ƁB

254 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/03/23(ŒŽ) 19:57:34
>253
‚ ‚č‚Ş‚Ć‚¤

255 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/04/13(ŒŽ) 21:36:16
gawk‚ĹŒfŽŚ”ě‚č‚˝‚˘‚ń‚Ĺ‚ˇ‚Ż‚ǁA
gawk‚ŞŽg‚Ś‚é–ł—żŽI‚Ç‚ą‚Š‚É‚ ‚č‚Ü‚š‚ń‚ŠH

256 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/04/13(ŒŽ) 21:58:14
Linux‚Ş“ü‚Á‚Ă郌ƒ“ƒ^ƒ‹ŽI‚Č‚ç“ü‚Á‚Ä‚é‚ń‚ś‚á‚Č‚˘‚Š‚Č‚ŸH
ƒŒƒ“ƒ^ƒ‹ŽI”‚łŤ‚˘‚Ä‚Ý‚˝‚çB
‚ł‚­‚ç‚ĚFreeBSD‚ÍFreeBSD‚Ěawk(!=gawk)‚ž‚Á‚˝B

257 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/04/13(ŒŽ) 22:07:10
>>256
‚ł‚­‚ç‚Ígawk‚Ĺ‚ˇ‚ŠB
Windows‚ś‚á‚Č‚˘ƒŒƒ“ƒ^ƒ‹ŽI‚Č‚çawk‚ŞŽg‚Ś‚Ä‚ŕ—Ç‚ł‚ť‚¤‚Ĺ‚ˇ‚Ż‚ǁA
–ł—ż‚Ĺ‚Í‚Č‚Š‚Č‚ŠŒŠ‚‚Š‚ç‚Č‚˘‚ń‚Ĺ‚ˇ‚ć‚ˁB
perlCrubyCphp‚Í‘˝‚˘‚ń‚Ĺ‚ˇ‚Ż‚Ç‚Ë‚ĽBB

258 F257F2009/04/13(ŒŽ) 22:14:30
Ž¸—çB
‚ł‚­‚ç‚Ígawk‚ś‚á‚Č‚˘awk‚Ĺ‚ˇ‚ŠB

259 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/04/18(“y) 13:07:13
‚í‚炤w
ttp://awk.info/?doc/dsl/awkplusplus.html

object_variable = class_name.new[(optional parameters)]
object_variable.method_name(parameters)
object_variable.delete

260 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/04/18(“y) 13:30:10
>>259
“Ż‚ś‚­ƒEƒP‚˝
awk‚͉i‘ą“I‚ÉŽg‚Á‚Ä‚˘‚āCC-->C++-->Java‚Əć‚čŒp‚˘‚Ĺ‚Ť‚˝‚ށCawk‚Í‚ą‚ę‚çƒRƒ“ƒpƒCƒ‰ŒžŒę‚đŽg‚¤ă‚Ĺ
—Ç‚˘ŠwKŢ—ż‚É‚Č‚Á‚Ä‚Ť‚˝‚ĆŽv‚˘Š´ŽÓ‚ľ‚Ä‚˘‚é(‚ŕ‚ż‚ë‚ń–˘‚ž‚Éscript‚Ěawk‚đawk‚ŏ‘‚˘‚Ä‚˘‚é)D
—Bˆęawk‚ŕ׋­‚Ĺ‚Ť‚Č‚Š‚Á‚˝‚Ě‚ŞOOP‚ž‚Á‚˝‚Š‚çCŠwKŢ—ż‚Ć‚ľ‚Ä‚Ěawk‚Ş‚ą‚¤‚˘‚¤•űŒü‚ÉŠˆ˜H‚đŒŠ‚˘‚ž‚ˇ‚Ě‚Í
—Ç‚˘‚ą‚Ć‚Š‚ŕ‚ľ‚ę‚Č‚˘D‚˝‚ž‚ľŽŔ—p‚ÉŒü‚Ż‚čl‚Ś‚Ä‚Ý‚é‚ƁCŒÂl“I‚É‚ÍOOP‚Ş–{—Ě‚đ”­Šö‚ˇ‚é‚Ě‚Í“Ş‚Ě’†‚Ĺalgorithm‚đ
”cˆŹ‚ľ‚Ť‚ę‚Č‚­‚Č‚é’ö“x‚É‘ĺ‚Ť‚ČƒVƒXƒeƒ€‚đ‘g‚Ýă‚°‚éę‡‚Ȃ̂ŁC‰Ę‚˝‚ľ‚Ä‚ť‚ę‚đawk‚ŏ‘‚­‚Š‚Ć‚˘‚í‚ę‚é‚ƁcD

261 F260F2009/04/18(“y) 13:57:19
s/algorithm/ƒf[ƒ^\‘˘/

262 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/05/09(“y) 23:49:39
Ĺ‹ßruby‚̕׋­Žn‚ß‚˝‚ń‚ž‚ށA
uruby‚Ş‚ ‚ę‚ÎAWK‚˘‚ç‚ˁv‚Ć‚ÍŽv‚Ś‚ńB
‹t‚ÉAWK‚Ě•Ö—˜‚ł‚đÄ”FŽŻ‚ľ‚˝B

‚â‚Á‚Ď‚čAŠČ’P‚ČƒeƒLƒXƒgˆ—‚Í
AWK‚Ĺ‚â‚Á‚˝‚Ů‚¤‚ŞŠČ’P‚žB

263 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/05/09(“y) 23:58:09
Šes‚ɑ΂ľ‚ďˆ—‚Á‚Äę‡‚Íawk‚Ş—Ç‚˘‚Ë

264 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/05/10(“ú) 00:37:15
ruby‚̓IƒuƒWƒFƒNƒgŽwŒü‚đ‹­§‚ł‚ę‚é‚Š‚珬‰ń‚č‚Ş‚Ť‚Š‚ń

265 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/05/10(“ú) 01:20:35
JavaScript‚Ş“Ž‚­ HTMLŽŔŒą•”‰Ž
ttp://homepage2.nifty.com/tomoarai/java/exper.html


266 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/05/14(–Ř) 08:38:05
jawk‚Ě˜b‘č‚Ş‘S‘Ro‚Č‚˘‚ˁB
Žg‚Á‚Ä‚él­‚Č‚˘‚́H

267 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/05/19(‰Î) 23:16:20
>>266
‚ł‚­‚Á‚Ć1s‚ĹĎ‚Ţ‚Ě‚Ş‹C‚É“ü‚Á‚Ă鉴‚É‚Í–ł—p‚ž‚Č

268 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/01(ŒŽ) 15:22:34
>>266
JƒA(ƒI)[ƒNAƒvƒ‰ƒOƒAƒEƒbI

269 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/08(ŒŽ) 01:31:39
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_167
Geocoding - ZŠ‚Š‚çˆÜ“xŒo“x‚đŒŸő ‚ž‚Á‚āB‰˝‚ą‚ꂨ‚ŕ‚낢B

270 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 16:39:12
{if(miso<$1){printf($1)}} miso=30
‚đŽŔs‚ˇ‚é‚Ć$1‚Ş‚PŒ…‚̐”Žš‚Ě‚Ć‚Ť‚É‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚ń‚Ĺ‚ˇ‚Ż‚Ç‚Č‚şH

271 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 19:43:04
•śŽš—ń‚Ĺ”äŠr‚ł‚ę‚Ä‚é‚ń‚ś‚á‚ˁH
miso<$1-0
‚Ĺ‚â‚Á‚˝‚ç‚Ç‚¤H

272 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 21:34:56
>>271
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‚Ĺ‚ŕ‚ž‚ß‚Ĺ‚ľ‚˝B
•śŽš—ń‚Ĺ”äŠr‚ł‚ę‚Ä‚é‚Á‚Ű‚˘‚Ĺ‚ˇ‚ˁB

273 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 22:04:19
>>270
‰˝‚đ“ü—Í‚ľ‚˝‚Ć‚Ť‚ɉ˝‚ޏo‚Ä—~‚ľ‚˘‚́H
‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚Á‚Ä‚Ç‚¤‚Č‚é‚́H

274 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 22:23:40
>>273
$1‚Ş4‚Ě‚Ć‚Ť‚ɏo‚Ä‚Ů‚ľ‚­‚Č‚˘‚Ě‚Éo‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇDDD

275 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 22:31:41
>>274
‚ą‚ń‚Č‚ńH
BEGIN{miso=30}{if(miso<$1){printf("%d\n",$1)}}

276 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 22:46:46
>>275
o‚Ä‚ľ‚Ü‚¤——R‚Ş‹C‚É‚Č‚č‚Ü‚ˇDDD‚Č‚ń‚Ĺ‚Ĺ‚ľ‚傤
‚â‚Á‚Ď‚č‚Q‚V‚P‚ł‚ń‚ĚŒž‚¤‚Ć‚¨‚č•śŽš—ń”äŠr‚ľ‚Ä‚é‚ń‚Ĺ‚ľ‚傤‚ŠH

277 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/21(“ú) 22:54:47
>>276
awk ‚Ěƒo[ƒWƒ‡ƒ“iŽí•Ęj‚Ş•Ş‚Š‚ç‚Č‚˘
‰˝‚đH‚í‚š‚Ä‚é‚Ě‚Š•Ş‚Š‚ç‚Č‚˘
ƒXƒNƒŠƒvƒg‚͈ęs‚ŏ‘‚˘‚Ä‚é‚Ě‚Šƒtƒ@ƒCƒ‹‚É‚ľ‚Ä‚é‚Ě‚Š•Ş‚Š‚ç‚Č‚˘
ˆęs‚ŏ‘‚˘‚Ä‚˘‚é‚Č‚çƒVƒFƒ‹‚ɉ˝‚đŽg‚Á‚Ä‚˘‚é‚Ě‚Š

278 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/22(ŒŽ) 00:38:26
•śŽš—ń”äŠr‚ł‚ę‚Ä‚é‚Č‚çˆęŒ…‚Ě‚Ć‚Ť‚ɏăŽč‚­‚˘‚Š‚Č‚˘‚Ć‚˘‚¤‚ć‚č
“ńŒ…‚Ě‚Ć‚Ť‚ž‚ŻăŽč‚­‚˘‚­‚Ć‚˘‚¤Š´‚ś‚Č‚Ě‚Š‚ˁB
WindowsXP‚ĚƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ĺgawk(3.1.5)Žg‚Á‚ĉş‹L‚đŽŽ‚ľ‚Ä‚Ý‚˝‚Ż‚Ç
‚ť‚ĚŒťŰÄŒť‚Ĺ‚Ť‚Č‚Š‚Á‚˝B
gawk "{if(miso<$1){printf($1)}}" miso=30

279 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/22(ŒŽ) 07:43:07
$awk -W version
mawk 1.3.3 Nov 1996, Copyright (C) Michael D. Brennan

compiled limits:
max NF 32767
sprintf buffer 2040
$seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940
‚¤‚Ü‚­“Ž‚˘‚Ä‚˘‚é‚悤‚ž‚ށB

280 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/22(ŒŽ) 18:20:09
>>279‚đƒ}ƒl‚ł‚š‚Ä‚ŕ‚ç‚Á‚˝
$ awk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

$ seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940

281 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/22(ŒŽ) 19:59:10
miso=30‚Á‚Ä-v•t‚Ż‚Č‚­‚Ä‚˘‚Ż‚é‚ń‚žB‚ľ‚ç‚ń‚Š‚Á‚˝B

282 F270 ‚Ě‚ŞÄŒť‚Ĺ‚Ť‚Č‚˘...F2009/06/23(‰Î) 01:02:55
gawk‚Í
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĹŽw’č‚ł‚ę‚˝ƒtƒ@ƒCƒ‹–ź‚Ş var=val ‚Ć‚˘‚¤Œ`ŽŽ‚Č‚ç‚΁A‚ť‚ę‚͕ϐ”‚Ö‚Ě‘ă“ü‚Ĺ‚ ‚é‚ƉđŽß‚ł‚ę‚Ü‚ˇB•Ď” var ‚Í’l val ‚ɐݒ肳‚ę‚Ü‚ˇ (‚ą‚ę‚́A‚ˇ‚×‚Ä‚Ě BEGIN ƒuƒƒbƒN‚đŽŔs‚ľ‚˝‚ ‚Ć‚És‚í‚ę‚Ü‚ˇ)B


‚â‚Á‚Ď‚č‚ŕ‚ę‚Ě XPƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒgŠÂ‹Ť‚Ĺ‚ŕ
>gawk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

>seq 1 40 | gawk "{if(miso<$1) print}" miso=30
31
32
33
34
35
36
37
38
39
40

‚Á‚ÄŠú‘Ň’Ę‚č‚Ě“Ž‚Ť‚žYO!

283 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/24(…) 00:39:07
ŒĹ’č’ˇ‚ʼnüs‚Č‚ľ‚Ěƒtƒ@ƒCƒ‹i6MB’´j‚đˆ—‚ˇ‚é‚ą‚Ć‚É‚Č‚čA
‘ź‚Ěƒ\ƒtƒg‚މüs‚ ‚č‚ĚŒĹ’č’ˇŁ‚É‚ľ‚Ä‚Š‚çAawk‚ŏˆ—‚ľ‚Ä‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށc

ƒf[ƒ^ƒtƒ@ƒCƒ‹‚É‚ć‚­o‚Ä‚­‚é•śŽš‚đ‚Ć‚č‚ ‚Ś‚¸RS‚ÉŒŠ—§‚Ăēǂݍž‚Ý
¨RS‚ÉŽw’č‚ľ‚˝•śŽš‚đ˜AÚ
¨ŒĹ’č’ˇ‚Ě1s•Ş‚ć‚č’ˇ‚Š‚Á‚˝‚ç‚ť‚Ě•”•Ş‚đŘ‚čo‚ľ

‚ľ‚Ä‚˘‚­‚Ƣ‰üs‚ ‚č‚ĚŒĹ’č’ˇŁA‚Ĺ‚Ť‚ż‚Ⴂ‚Ü‚ľ‚˝B
RS‚ÉŽw’č‚ľ‚˝•śŽš‚Ş‚ľ‚΂炭o‚Ä‚ą‚Č‚Ż‚ę‚Εϐ”ƒpƒ“ƒN‚ľ‚ż‚Ⴄ‚ľA‘ĺ•ŞŠë‚Č‚Á‚Š‚ľ‚˘‚Ě
‚Ĺ‚ˇ‚ށA‚Ć‚č‚ ‚Ś‚¸awk‚Ĺ‚Ĺ‚Ť‚˝‚Ě‚Ş­‚ľ‚¤‚ę‚ľ‚˘B

284 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/24(…) 03:25:12
‰üs‚ ‚č‚ĚŒĹ’č’ˇ‚đawk‚Ĺ“Ç‚ń‚ž‚Ě‚Č‚ç
substr($0, start, length) ‚ł΂炚‚ćw

285 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/26(‹ŕ) 11:29:46
>>283
>284‚Ý‚˝‚˘‚ȓljđ—Í‚Č‚˘”nŽ­‚Ş—N‚Š‚Č‚˘‚悤‚ɁA”ť‚čˆŐ‚­‘‚Ť‚Ü‚ľ‚傤B
‚[‚ŠA‹ď‘Ě“I‚ČƒR[ƒh‚ŕo‚ł‚¸‚Ɂuawk‚Ĺ‚Ĺ‚Ť‚Ä‚¤‚ę‚ľ‚˘v‚Č‚ń‚Ä‚Ě‚Íƒ`ƒ‰ƒV‚Ě— ‚É‚Ç‚¤‚źB

286 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/06/30(‰Î) 01:27:46
fold ‚Ć‚ŠH

287 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/13(ŒŽ) 09:52:52
ł‹K•\Œť‚Ĺ‹ó”’‚Ĺ‹ćŘ‚ç‚ę‚˝ƒeƒLƒXƒg‚đHTML‚Ĺ‚˘‚¤table‚É‚ľ‚˝‚˘‚Ĺ‚ˇB
—áj

10i 2i 8i
000 000 000
001 001 001
002 010 002
003 011 003

ŤŤŤŤŤŤŤ

<table>
<tr><th>10i</th> <th>2i</th> <th>8i</th></tr>
<tr><td>000</td> <td>000</td> <td>000</td></tr>
<tr><td>001</td> <td>001</td> <td>001</td></tr>
<tr><td>002</td> <td>010</td> <td>002</td></tr>
<tr><td>003</td> <td>011</td> <td>003</td></tr>
</table>

288 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/13(ŒŽ) 12:07:49
>>287
ł‹K•\Œť‚đŽg‚¤‚Ů‚Ç‚Ě‚ą‚Ć‚Ĺ‚Í‚Č‚˘
ƒRƒA‚Ě•”•Ş‚ž‚Ż‘‚­‚Ć‚ą‚ę‚ž‚Ż
for(i=1;i<=NF;i++) printf("<td>%s</td>", $i)

289 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/13(ŒŽ) 16:12:21
ł‹K•\ŒťŽg‚Á‚ă^ƒO‚đŘ‚č‘Ö‚Ś‚˝‚˘‚Ě‚Š‚ȁH

290 FhogehogeF2009/07/17(‹ŕ) 16:37:34
split ‚â asort ‚ľ‚˝‚ç‚Ç‚¤‚ľ‚Ä“YŽš‚Ş1‚Š‚ç‚É‚Č‚é‚ń‚žI
‚Č‚ń‚Ĺ‚žI
Žd—l‘“Ç‚Ý”ň‚΂ľ‚Ăăf[ƒ^Œ‡—Ž‚ł‚š‚é‚Ć‚ą‚ë‚ž‚Á‚˝(LĽƒÖĽM)

>>287
sed ‚Ĺ‚Ś‚Ś‚â‚ń

291 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/17(‹ŕ) 18:35:54
Ą‚Ü‚Ĺawk '{print $3}'’ö“x‚ľ‚ŠŽg‚Á‚Ä–ł‚Š‚Á‚˝‚ށAĹ‹ß‚ą‚ę‚đ“Ç‚ń‚Ĺawk‚đŒŠ’ź‚ľ‚˝B

http://www.eecs.harvard.edu/cs152/lectures/CS152-Lecture_14-Kernighan.pdf

292 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/26(“ú) 15:10:31
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚ą‚ą‚Ěgawk‚Ĺ>>17‚ĚƒTƒ“ƒvƒ‹‚đŽŽ‚ľ‚˝‚Ş“Ž‚Š‚Č‚Š‚Á‚˝B

gawk: test.awk:4: ’v–˝“I: “üo—Í—p‚Ě‘o•űŒüƒ\ƒPƒbƒg `/inet/tcp/0/www.yahoo.com/80' ‚ŞŠJ‚Ż‚Ü‚š‚ń (No such file or directory)B

293 FhogehogeF2009/07/27(ŒŽ) 11:13:15
‚ť‚ę‚Í‚ť‚ą‚ĚƒTƒCƒg‚̐l‚ÉŒž‚Ś‚ć

294 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/28(‰Î) 00:11:42
‚˘‚‚̂܂ɂŠgawk 3.1.7‚ޏo‚Ä‚˝B

295 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/07/30(–Ř) 11:45:58
Ruby •×‹­’†‚ž‚Ż‚Ç AWK ‚Ě‚Ů‚¤‚ŞŠy‚ľ‚˘‚ş(LĽƒÖĽM)

296 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 10:22:37
7ŒŽ7“ú¨[[7ŒŽ7“ú|07ŒŽ07“ú]]
7ŒŽ28“ú¨[[7ŒŽ28“ú|07ŒŽ28“ú]]
11ŒŽ3“ú¨[[11ŒŽ3“ú|11ŒŽ3“ú]]
12ŒŽ16“ú¨[[12ŒŽ16“ú|12ŒŽ16“ú]]

‚Ć’u‚ŤŠˇ‚Ś‚˝‚˘‚Ĺ‚ˇB
perl‚Č‚ç‚í‚č‚ĆŠČ’P‚Č‚Ě‚Ĺ‚ˇ‚ށAawk‚ĹŠČ’P‚É‚˘‚Ť‚Ü‚ˇ‚ŠH
ŽŠ•Ş‚Şawk‚Ě‚ą‚Ć‚đ•×‹­•s‘Ť‚ž‚Š‚ç‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ż‚ǁcB

297 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 10:24:13
ŞŠÔˆá‚˘‚Ü‚ľ‚˝B
7ŒŽ7“ú¨[[7ŒŽ7“ú|07ŒŽ07“ú]]
7ŒŽ28“ú¨[[7ŒŽ28“ú|07ŒŽ28“ú]]
11ŒŽ3“ú¨[[11ŒŽ3“ú|11ŒŽ03“ú]]
12ŒŽ16“ú¨[[12ŒŽ16“ú|12ŒŽ16“ú]]

298 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 11:03:17
—á‚Ş‚ć‚­‚í‚Š‚ç‚Č‚˘‚ń‚ž‚Ż‚ǁC”Žš1Œ…‚Ě•”•Ş‚đ2Œ…‚É‚ľ‚˝‚˘‚Á‚Ä‚ą‚ƁH

299 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 11:13:12
{
gsub(/ŒŽ|“ú/," ");
printf("%02dŒŽ%02d“ú\n",$1,$2);
}
‚Ć‚ŠD
ƒtƒB[ƒ‹ƒhƒZƒpƒŒ[ƒ^‚ރfƒtƒHƒ‹ƒg(”źŠpƒXƒy[ƒX)‚Ěę‡‚ˁD

300 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 11:15:10
>296
Perl‚ĹŠČ’P‚ɏ‘‚Ż‚é‚Č‚çAˆę’UPerlƒR[ƒhŽN‚ľ‚Ä‚­‚ę‚é‚ŠH
‚Ç‚¤‚ŕŽd—l‚Ş‚ć‚­‰đ‚ç‚ń‚Ě‚žc

301 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 11:54:28
print gensub(/0([0-9])([0-9])/, "\\1\\2", "g", gensub(/([0-9]+)/, "0\\1", "g",
$1))

‰ä‚Č‚Ş‚ç‰˜‚Ë‚Ľ‚Č‚Ÿ(LĽƒÖĽM)
>>299‚Ě•ű‚Ş‚˘‚˘‚Č

302 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 12:27:22
>>298,300 ’uŠˇ‚ľ‚Č‚˘‚Ĺ•Ď‚Ś‚˝‚˘‚Ć‚ą‚ž‚Żo—Í‚ˇ‚é‚Č‚ç‚ą‚¤‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
#!/usr/bin/perl
while(1){
$line = <STDIN>;
if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú/){
$month = $1; $day = $2;
if($month >= 10) {
if($day >=10){
print "$& -> [[$monthŒŽ$day“ú]]";
}
else {
print "$& -> [[$monthŒŽ$day“ú|$monthŒŽ0$day]]";
}
}
else{
if($day >=10){
print "$& -> [[$monthŒŽ$day“ú|0$monthŒŽ$day]]";
}
else{
print "$& -> [[$monthŒŽ$day“ú|0$monthŒŽ0$day]]";
}
}
}
}
1ŒŽ1“ú - ƒ†[ƒ“ą“ü10Žü”NB
1ŒŽ1“ú -> [[1ŒŽ1“ú|01ŒŽ01]]
12ŒŽ31“ú - ƒjƒ…[ƒˆ[ƒN‚Ěƒ}ƒ“ƒnƒbƒ^ƒ“‹´ŠJ’Ę100Žü”NB
12ŒŽ31“ú -> [[12ŒŽ31“ú]]
8ŒŽ21“ú - ƒnƒƒCBB§50Žü”NB
8ŒŽ21“ú -> [[8ŒŽ21“ú|08ŒŽ21]]
10ŒŽ1“ú - ƒpƒ‰ƒI“Ć—§15Žü”NB
10ŒŽ1“ú -> [[10ŒŽ1“ú|10ŒŽ01]]

303 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 14:16:23
‚Č‚ń‚Š‘f’ź‚ÉPerl‚Ĺ‚â‚Á‚˝‚Ů‚¤‚ŞŠy‚ť‚¤‚ž‚Č‚ A‚ť‚ęB
‚ż‚Ȃ݂ɁA‚ť‚ĚƒR[ƒh‚ś‚á–łŒŔƒ‹[ƒv‚ˇ‚é‚źB
#!/usr/bin/perl
while($line = <STDIN>) {
    if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú/) {
        $month = $1; $day = $2;
        if($month < 10 || $day < 10) {
            printf "%s -> [[%dŒŽ%d“ú|%02dŒŽ%02d]]\n", $&, $month, $day, $month, $day;
        }
        else {
            print "$& -> [[$monthŒŽ$day“ú]]\n";
        }
    }
}

304 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 14:44:03
‚ž‚ß‚žcƒR[ƒh‚ĚˆÓ–Ą‚Í•Ş‚Š‚é‚ŞCŽd—l‚Ş—Ç‚­•Ş‚Š‚ç‚ńD

305 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 14:47:14
7ŒŽ7“ú
‚Ć‚˘‚¤•śŽš—ń‚đ
[[7ŒŽ7“ú|07ŒŽ07“ú]]
‚Ć’u‚ŤŠˇ‚Ś‚éA‚Á‚Ä‚ą‚Ć‚Ĺ‚ľ‚ĺB
‚Č‚ń‚Ĺ•Ş‚Š‚ç‚ń‚Š‚Č‚ŸB‚ť‚Á‚ż‚Ě‚Ş•Ş‚Š‚ç‚ńB

306 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 14:53:30
“ü—Í‚Ş07ŒŽ07“ú‚ž‚Á‚˝‚çC
o—Í‚Í[[07ŒŽ07“ú|07ŒŽ07“ú]]‚É‚Č‚é‚ć‚ˁH‚ą‚ę‚ÍOK?
‚ť‚ŕ‚ť‚ŕC‚ť‚¤‚˘‚¤“ü—Í‚Í‹N‚ą‚č‚Ś‚Č‚˘‚́H

307 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 18:17:38 ?2BP(0)
>>305
‚ť‚ń‚ČŠ´‚ś‚Ĺ‚ˇB
–Ú“I‚đŒž‚Á‚Ä‚˘‚Č‚˘‚̂ŁA‰˝‚Ş‚â‚č‚˝‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ç‚Č‚˘‚Ě‚ž‚ĆŽv‚˘‚Ü‚ˇB
‘‚˘˜bAWiki‚Ě‹L–@‚đŽg‚Á‚ăŠƒ“ƒN‚đ’Ł‚č‚˝‚˘‚Ě‚Ĺ‚ˇB
0‚đ‚­‚í‚Ś‚ÄŒ…‚𒲐Ž‚ľ‚Ä‚˘‚闝—R‚Í
•śŽš—ń‚Ć‚ľ‚ă\[ƒg‚ľ‚Đł‚ľ‚­¸‡‚É•Ŕ‚Ԃ悤‚É‚ˇ‚é‚˝‚ß‚Ĺ‚ˇB—á‚Ś‚ÎWikipedia‚Č‚ç
7ŒŽ7“ú‚Ě‚Ć‚Ť‚́A[[7ŒŽ7“ú|07ŒŽ07“ú]]‚Ć‚ˇ‚é‚ą‚Ć‚Ĺ
ƒŠƒ“ƒN‚Íhttp://ja.wikipedia.org/wiki/7ŒŽ7“ú
•\ŽŚ‚ł‚ę‚é•śŽš—ń‚Í 07ŒŽ07“ú@
‚Ć‚Č‚č‚Ü‚ˇB
‚ą‚ę‚đƒ\[ƒg‚Ĺ‚Ť‚éƒe[ƒuƒ‹‚Ě—v‘f‚É‚ľ‚Ü‚ˇBŽQl‚Ü‚Ĺ‚É
http://ja.wikipedia.org/wiki/Help:%E8%A1%A8%E3%81%AE%E4%BD%9C%E3%82%8A%E6%96%B9#.E5.86.8D.E6.95.B4.E5.88.97.E5.8F.AF.E8.83.BD.E3.81.AA.E8.A1.A8
‚ą‚̏ˆ—‚Íawk‚Ĺ‚ŕ‰Â”\‚Č‚ą‚Ƃ͉”\‚ž‚Á‚˝‚ń‚Ĺ‚ˇ‚ށA–ł’m‚Č‚š‚˘‚Š
‚¨‚ť‚ë‚ľ‚­•sŠiD‚É‚Č‚č‚Ü‚ľ‚˝B

>>306
‚ť‚ęŽv‚˘‚Ü‚ľ‚˝B‚Ĺ‚Ť‚ę‚Î
07ŒŽ07“ú->[[7ŒŽ7“ú|07ŒŽ07“ú]]
‚̂悤‚ɏˆ—‚ľ‚˝‚˘‚Ĺ‚ˇB

308 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 18:26:07
>>303
‚ť‚ę‚Ĺ‚ˇB‚ť‚¤‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB

309 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 21:17:06
# gawk ‚É‚ć‚é match ŠÖ”‚ĚŠg’Ł‚đŽg‚Á‚Ä‚˘‚é.
# ˆęs‚É•Ą”‰ńŒť‚ę‚˝ę‡‚Í–łŽ‹.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ú|%02dŒŽ%02d“ú]]", $0, a[2], a[1], a[2], a[1]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ú]]", $0, a[2], a[1]));
        }
    }
    print $0;
}

310 F309F2009/08/06(–Ř) 21:21:15
# ’ůł.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ú|%02dŒŽ%02d“ú]]", a[1], a[2], a[1], a[2]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ú]]", a[1], a[2]));
        }
    }
    print $0;
}

311 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/06(–Ř) 23:59:03
>>310 ŠŽŕř‚Ĺ‚ˇBĄ“x‚Š‚ç‚ą‚ę‚đŽg‚˘‚Ü‚ˇ—L“‚˛‚´‚˘‚Ü‚ľ‚˝B

$ cat test.txt
1ŒŽ1“ú #mŒŽd“ú
01ŒŽ1“ú #0mŒŽd“ú
1ŒŽ01“ú #mŒŽ0d“ú
01ŒŽ01“ú #0mŒŽ0d“ú

2ŒŽ10“ú #mŒŽdd“ú
02ŒŽ10“ú #0mŒŽdd“ú

11ŒŽ3“ú #mmŒŽd“ú
11ŒŽ03“ú #mmŒŽ0d“ú

12ŒŽ16“ú #mmŒŽdd“ú

$ awk -f test.awk test.txt
[[1ŒŽ1“ú|01ŒŽ01“ú]] #mŒŽd“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #0mŒŽd“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #mŒŽ0d“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #0mŒŽ0d“ú

[[2ŒŽ10“ú|02ŒŽ10“ú]] #mŒŽdd“ú
[[2ŒŽ10“ú|02ŒŽ10“ú]] #0mŒŽdd“ú

[[11ŒŽ3“ú|11ŒŽ03“ú]] #mmŒŽd“ú
[[11ŒŽ3“ú|11ŒŽ03“ú]] #mmŒŽ0d“ú

[[12ŒŽ16“ú]] #mmŒŽdd“ú

312 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/07(‹ŕ) 06:34:47
Ĺ‰‚É‚ť‚¤‚˘‚¤ƒeƒXƒgƒoƒ^[ƒ“‚đo‚ť‚¤‚Ë

313 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/07(‹ŕ) 11:45:35
‚ą‚ą‚̏Zl‚ރR[ƒfƒBƒ“ƒOD‚Ť‚ž‚Š‚ç‚Á‚ÄŠĂ‚Ś‚â‚Ş‚Á‚Ä(LĽƒÖĽM)

> perl‚Č‚ç‚í‚č‚ĆŠČ’P‚Č‚Ě‚Ĺ‚ˇ‚ށAawk‚ĹŠČ’P‚É‚˘‚Ť‚Ü‚ˇ‚ŠH
‚Á‚ÄŒž‚Á‚Ä‚é‚ń‚ž‚Š‚çAu‚˘‚Ť‚Ü‚ˇv‚Á‚Ä“š‚Ś‚č‚Ⴂ‚˘‚ń‚ž‚ć‚Č

314 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/07(‹ŕ) 11:46:39
>>312
‚Č‚É‚ť‚ĚŽ€‚̍si‚ą‚킢

315 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/15(“y) 11:36:30
ƒoƒ^[ƒ“@ƒeƒXƒg‚ĚƒfƒXƒ}[ƒ`

316 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/08/16(“ú) 09:46:09
>>294
3.1.7ƒx[ƒX‚ĚWindows—pƒoƒCƒiƒŠAo‚Ü‚ľ‚˝B
ttp://www.kt.rim.or.jp/%7Ekbk/gawk-3.1/index.html#GAWK-DOWNLOAD

317 F222.248.109.70F2009/08/17(ŒŽ) 17:45:07
ŽŠ“ŽÄl š@@ŽŠ“Ž•ŰŽç ŸKAWORUKOFI@@ŽŠ“Ž•ŰŽç#K9K?_D[L

–źŒžW@‚ť‚Ě‚R
w‚˘‚‚ŕƒTƒ{‚Á‚Ă΂Š‚č‚ĚƒLƒƒƒbƒv‚ރEƒ[‚Śx

http://yutori7.2ch.net/test/read.cgi/news4vip/1249830540/@ID:PVAf+dux0@@ŽŠ“ŽÄl š
> 71 FˆČ‰şA–ź–ł‚ľ‚É‚Š‚í‚č‚Ü‚ľ‚ÄVIP‚Ş‚¨‘—‚č‚ľ‚Ü‚ˇ [sage] F2009/08/10(ŒŽ) 00:58:57.28 ID:PVAf+dux0
> >>69
> ‘ĺ•Ď‚Á‚ÄŒž‚¤‚Š
> –ˆ“úA•ń‚ł‚ę‚˝‚Ě‚đŒŠ‚ÄA”ť’f‚ľ‚āAˆ—‚ľ‚āAŠŽ—š•ń‚ľ‚āAˆČ‰şƒ‹[ƒvB
> ‚ż‚ĺ‚Á‚Ć‚Ĺ‚ŕƒ~ƒX‚ˇ‚é‚ƁA•’i‚͍ě‹Ć‚ŕ‚ľ‚Ä‚Č‚˘ƒLƒƒƒbƒv‚ł‚ń‚˝‚ż‚Ş‚ł‚ń‚´‚ń•ś‹ĺŒž‚Á‚Ä‚Ť‚Ä
> ‚ť‚ĚŒž‚˘‚í‚Ż‚đl‚Ś‚Č‚˘‚ƁAƒLƒƒƒbƒv‚Í‚­’D‚ł‚ę‚˝‚čƒAƒJƒEƒ“ƒg“€Œ‹‚ł‚ę‚˝‚股‚é‚Š‚ç
>
> “o˜^‚ł‚ę‚Ä‚Š‚çˆę”NˆČăŒo‚Á‚āA‚â‚Á‚Ć‚˘‚˘‚˝‚˘‚ą‚ĆŒž‚Ś‚é‚悤‚É‚Č‚Á‚Ä‚Ť‚˝‚ćB



----------------------------------------------
‚ą‚ĚŽŠ“ŽÄl šƒ[ƒ‹ƒ}ƒKƒWƒ“‚Ě”zM’âŽ~‚đ‚˛Šó–]‚ł‚ę‚é•ű‚Í
http://qb5.2ch.net/test/read.cgi/sec2chd/1250169591/
‚É‚ÄŽŠ“ŽÄl š‚Ü‚Ĺ‚˛˜A—‚­‚ž‚ł‚˘

318 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/10/24(“y) 17:23:04
ĹŒă‚Ě10s‚đˆ—‚ľ‚˝‚­‚Č‚˘ę‡A‚Ç‚¤‘‚Ż‚Ηǂ˘‚Ĺ‚ľ‚傤‚ŠH

319 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/10/24(“y) 18:19:03
ĹŒă‚Ü‚Ĺ“Ç‚Ü‚¸‚ÉĹŒă‚Ě10s‚Š‚Ç‚¤‚Š”ť’股‚é•ű–@‚Í–ł‚˘‚ž‚낤‚Č
ˆ—‘ÎŰ‚Şƒtƒ@ƒCƒ‹‚Č‚çAŽ–‘O‚Éwc -l‚Š‰˝‚Š‚ōs”’˛‚×‚Ä awk ‚É“n‚ľ‚Ä‚Ý‚Ä‚Í

320 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/10/24(“y) 18:52:07
Ź‚é’öA‚ą‚ęA‚Ć‚˘‚¤•ű–@‚Í–ł‚ł‚ť‚¤‚Ĺ‚ˇ‚Ë
‚ż‚ĺ‚Á‚ƍl‚Ś‚Č‚Ş‚ç‚â‚Á‚Ä‚Ý‚Ü‚ˇ

321 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/10/24(“y) 19:15:52
‚Ć‚č‚ ‚Ś‚¸A‚ą‚ń‚ČŠ´‚ś‚É‚ľ‚Ü‚ľ‚˝
BEGIN {
SKIPTAILS = 10
}
{
line = buf[1]
for(i=1;i<SKIPTAILS;i++) buf[i] = buf[i+1]
buf[SKIPTAILS] = $0
}
NR > SKIPTAILS {
# line‚đˆ—
}

322 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/10/24(“y) 22:11:41
>>321 l‚Ś•ű‚Í“Ż‚ś‚ž‚Ż‚ǁAfor‚Ş‹C‚É‚Č‚Á‚˝‚Ě‚Ĺ
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ŏˆ—‚ˇ‚é‚悤‚É‚ľ‚Ä‚Ý‚˝B

BEGIN {
@@SKIPTAILS = 10
@@ringpos = SKIPTAILS
}
{
@@ringpos = (ringpos + 1) % SKIPTAILS
@@line = buf[ringpos]
@@buf[ringpos] = $0
}
NR > SKIPTAILS {
@@# line‚đˆ—
}


323 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/10/24(“y) 23:18:06
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
ƒŠƒ“ƒOƒoƒbƒtƒ@A•×‹­‚É‚Č‚č‚Ü‚ľ‚˝
Žg‚í‚š‚Ä’¸‚Ť‚Ü‚ˇ


324 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/11/19(–Ř) 20:22:22
>>42
sed awk ‚ľ‚Ä‘DŽR‚É“o‚é@‚ž‚ëH


325 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/11/23(ŒŽ) 12:06:14
Žż–â‚Ĺ‚ˇ
gawk‚Ĺ
{
printf("%d,%s\n", NR, $0 ) > FILENAME;
}
‚Ć‚˘‚¤s“ނɔԍ†‚đU‚Á‚Ä•Ű‘ś‚ˇ‚鏈—‚đ‚ľ‚Ä

batƒtƒ@ƒCƒ‹‚ĹˆęŠ‡ˆ—‚ł‚š‚悤‚Ć‚ľ‚˝‚ń‚Ĺ‚ˇ‚Ş
c:\windows\gawk\gawk -f g:\ě‹Ć—p\n.awk g:\ě‹Ć—p\*.txt

ŽŔsŒ‹‰Ę‚Ş
ƒtƒ@ƒCƒ‹1@@ƒtƒ@ƒCƒ‹2
1‚`@@@@@@4‚c@@
2‚a@@@@@@5‚d@
3‚b@@@@@@6‚e
‚É‚Č‚č‚Ü‚ˇ

ƒtƒ@ƒCƒ‹2‚ŕ
1‚c
2‚d
3‚e
‚É‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH

326 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/11/23(ŒŽ) 12:27:22
FNR

327 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/11/23(ŒŽ) 12:35:21
>>326
‚¨‚¨Ao—ˆ‚˝I
v‘Ź‚ȉń“š‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ

328 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/12/21(ŒŽ) 13:53:34
”N––‚Ƀpƒ\ƒRƒ“‚đ”ƒ‚˘Šˇ‚Ś‚悤‚ĆŽv‚Á‚Ä‹@Ží‘I‚Ń‚đ‚ľ‚Ä‚˘‚Ä‚Ó‚Ć‹C‚Ă‚˘‚˝A
‚ ‚ęAvaio‚ĚOS‚ŞWindows7 64bitƒo[ƒWƒ‡ƒ“‚ɁEEE
ƒ_ƒ‚ś‚á‚ńIgawk‚ŞŽg‚Ś‚Č‚­‚Č‚Á‚Ä‚ľ‚Ü‚¤EEE
‚¤[‚ńAAA‚Ü‚˝XP‚đ”ƒ‚¤‚ׂŤ‚ŠEEE”Y‚ށEEE

329 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2009/12/21(ŒŽ) 14:21:01
>>328
ŽŠ•Ş‚ĹƒRƒ“ƒpƒCƒ‹‚ľ’ź‚š‚΂˘‚˘‚ž‚Ż‚ś‚á‚Č‚˘‚́H

330 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/01/14(–Ř) 03:52:20
ƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK•œŠ§‚ž‚Á‚ĂˁB
ttp://slashdot.jp/developers/article.pl?sid=10/01/06/0345207

‘˝•Ş•K—vŤ‚đŠ´‚ś‚Č‚˘’ö“x‚É‚ÍŽg‚Á‚Ä‚é‚Š‚çA”ƒ‚í‚Č‚˘‚Ż‚ÇŠđ‚ľ‚˘B
•z‹ł—p‚É”ƒ‚¤‚Á‚Ä‚Ě‚ŕ‚ż‚ĺ‚Á‚ƂȁB



331 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/02/28(“ú) 11:08:56
AAA BBB CCC c -O ZZZ YYY XXX c

awkVŽQ‚Ĺ‚ˇB
-O(ƒIƒvƒVƒ‡ƒ“)‚đŒŸő‚ľA
-O‚Ć‚ť‚ęˆČ~‚đƒŠƒ_ƒCƒŒƒNƒg‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށc
—Ç‚˘•ű–@A‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š

332 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/02/28(“ú) 15:36:31
ƒŠƒ_ƒCƒŒƒNƒg‚Á‚Ä‚Ç‚¤‚˘‚¤ˆÓ–Ą‚ĹŽg‚Á‚Ä‚é?

‚ť‚Ě AAA ‚ĹŽn‚Ü‚é•śŽš—ń‚ŕˆę‘Ě‚Ç‚¤‚˘‚¤‚ŕ‚̂Ȃ́B
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Č‚Ě‚ŠAƒtƒ@ƒCƒ‹‚Š‚ç“ǂݍž‚ń‚Ĺ‚­‚é‚Ě‚Ć‚ŠB

—pŒę‚Ćó‹ľ‚Í‚Ť‚ż‚ń‚Ə‘‚˘‚Ä‚­‚ęB


333 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/02/28(“ú) 16:19:07
D:\My Documents\gawk\331>type 331.txt
AAA BBB CCC c -O ZZZ YYY XXX 0c
AAA BBB CCC c -O ZZZ YYY XXX 1c
AAA BBB CCC c -O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>type 331.awk
{match($0, " -O .*", a);
print a[0];}

D:\My Documents\gawk\331>gawk -f 331.awk 331.txt >a.txt

D:\My Documents\gawk\331>type a.txt
-O ZZZ YYY XXX 0c
-O ZZZ YYY XXX 1c
-O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>

334 F331F2010/02/28(“ú) 18:43:32
ƒŒƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>332‚ˇ‚Ý‚Ü‚š‚ńB‘‚Ť’ź‚ľ‚Ü‚ˇB
AAA BBB CCC c -O ZZZ YYY XXX c
‚Ə‘•Ą”s‘‚Š‚ę‚˝ƒtƒ@ƒCƒ‹‚Ş‚ ‚čA
u-OvˆČ~‚Ě•śŽš—ń‚đ•Ęƒtƒ@ƒCƒ‹‚É•Ű‘ś‚ˇ‚é
‚Á‚Ä‚ą‚Ć‚đ‚ľ‚˝‚Š‚Á‚˝‚Ě‚Ĺ‚ˇB

>>333
ƒGƒXƒp[‚Č•ś‚ž‚Á‚˝‚Ě‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‘z’č‚ľ‚Ä‚˝‚Ě‚Í‚ť‚ń‚ČŠ´‚ś‚Ĺ‚ˇB
‚˝‚žˆČ‰ş‚ĚƒGƒ‰[‚ޏo‚ďăŽč‚­‚˘‚Ť‚Ü‚š‚ńc

gawk: 331.awk:2: fatal: match() cannot have 3 arguments

matchŽg‚Á‚Ä‚é‚Ě‚Éa‚Ć‚˘‚¤3‚Â–Ú‚Ěˆř”‚đŽg‚Á‚Ä‚é‚Š‚çc‚Á‚Ä‚ą‚Ć‚Ĺ‚ľ‚傤‚ŠcH


335 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/02/28(“ú) 19:00:04
Q: make spits out errors like Makefile.awk:256: fatal: match() cannot have 3 arguments

A: Your AWK is too old to recreate the Makefile. The build is done based on the distributed Makefile. Everything shall compile successfully though.
So if the compile succeeds just ignore such errors, please.

336 F335F2010/02/28(“ú) 19:22:38
{print substr($0, match($0, " -O .*")+1);}

337 F331F2010/02/28(“ú) 20:03:12
>>336
o—ˆ‚Ü‚ľ‚˝B‚Ü‚ł‚Š–{“ú’†‚É‰đŒˆ‚Ĺ‚Ť‚é‚Ć‚ÍŽv‚˘‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‘ĺ•Ď•×‹­‚É‚Č‚č‚Ü‚ľ‚˝B

338 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/02/28(“ú) 22:25:50
ÎŢż@–{“–‚ɕ׋­‚É‚Č‚Á‚˝‚Š‚Ç‚¤‚Š‚Í‹^–â‚žĽĽĽ
@‚¨‚Á‚ĆˆęŒžƒIƒE‚Š‚Á‚˝‚ŠB

339 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/04(–Ř) 15:04:38
gsub()‚Ć‚Š‚Ĺˆř”‚ɕϐ”‚đ—˜—p‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
gsub(str1,str2)‚Ý‚˝‚˘‚ɁB

340 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/04(–Ř) 21:44:52
>>339
man gawk‚ć‚č
gsub(r, s [, t])
For each substring matching the regular expression r in the string t,
substitute the string s, and return the number of substitutions.
If t is not supplied, use $0. An & in the replacement text is
replaced with the text that was actually matched. Use \& to get a
literal &. (This must be typed as "\\&"; see GAWK: Effective AWK
Programming for a fuller discussion of the rules for &'s and
backslashes in the replacement text of sub(), gsub(), and gen sub().)


341 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/08(ŒŽ) 21:36:03
awk 'BEGIN{x="ABCDE";y="BCD";z="XXX";gsub(y,z,x);print x}'

‰˝‚Ş“ď‚ľ‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ç‚ńB

342 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/17(…) 22:07:37
ŽžXawk‚ž‚Ć’x‚˘‚Ě‚Ĺperl‚ɏ‘‚ŤŠˇ‚Ś‚é‚Ć‚˘‚¤l‚Ş‚˘‚Ü‚ˇ‚ށA
ŽŔŰ‚Ě‚Ć‚ą‚ë‘Ź‚­‚Č‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
Ž„‚̊‹Ť‚Ĺ‚Íforƒ‹[ƒv‚â‰ÁŽZ‚Č‚Ç‚Íawk‚Ě‚Ů‚¤‚Ş‘Ź‚ť‚¤‚Ĺ‚ˇ‚ށA
‚ǂ̂悤‚ȏˆ—‚Ěę‡‚Éperl‚Ě‚Ů‚¤‚Ş‘Ź‚­‚Č‚č‚Ü‚ˇ‚ŠH

$ time mawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};printf("%f\n" ,x)}'
500000500000.000000

real 0m0.131s
user 0m0.120s
sys 0m0.000s
$ time gawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};print x}'
500000500000

real 0m0.289s
user 0m0.284s
sys 0m0.000s
$ time perl -e '$x=0;for($i=1;$i<=1000000;$i++){$x=$x+$i};print $x'
500000500000
real 0m0.379s
user 0m0.376s
sys 0m0.004s


343 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/17(…) 22:26:14
>>342
uawk‚ž‚Ć’x‚˘‚Ě‚Ĺperl‚ɏ‘‚ŤŠˇ‚Ś‚é‚Ć‚˘‚¤lv ‚É•ˇ‚Ż‚ΕނŠ‚é

344 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/19(‹ŕ) 09:08:06
>>342
’x‚˘‚Ć‚˘‚¤awk‚Ígawk‚Č‚Ě?
‘f‚Ěawk‚ć‚čgawk‚Ě•ű‚Ş‘‚­‚Č‚Š‚Á‚˝‚Á‚ŻH


345 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/20(“y) 01:03:01
ƒJ[ƒjƒnƒ“‚ĆƒpƒCƒN‚́wƒvƒƒOƒ‰ƒ~ƒ“ƒOě–@x‚Éawk‚Ćperl
i‚ĆC‚ĆC++‚ĆJAVAj‚Ě”äŠr‚Ş‚ ‚é‚Č

Ą‚Ěƒ}ƒVƒ“Žg‚Á‚ď‘‚ŤŠˇ‚Ś‚Č‚Ť‚á‚Č‚ç‚Č‚˘‚Ů‚Ç’x‚˘‚Á‚Ä
‚Ç‚ń‚ȏˆ—‚Č‚ń‚ž‚낤H

346 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/21(“ú) 13:44:10
>342
awk “™‚đ‘g‚ݍ‡‚í‚š‚ÄŽŔs‚ˇ‚é‚ĆƒvƒƒZƒX‹N“Ž‚ĚƒRƒXƒg‚Ş‚Š‚Š‚é‚Ě‚Ĺ perl ‚Ĺˆę‚‚ɓZ‚ß‚éA‚Ć‚˘‚¤˜b‚ś‚á‚Č‚˘‚́H

347 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/22(ŒŽ) 17:35:11
•śŽšƒR[ƒh‚ĚƒR[ƒh‚đ•Ď”‚É‚ľ‚Ä•śŽš—ń‚đ‘€ě‚ˇ‚é‚ą‚Ć‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
•śŽš—ń’†‚Ě‘SŠp•śŽš‚𔟊p•śŽš‚É•Ď‚Ś‚é‰Ř—í‚Č•ű–@‚đ–͍ő‚ľ‚Ä‚˘‚Ü‚ˇB

348 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/22(ŒŽ) 18:01:58
Use iconv.

349 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/22(ŒŽ) 18:25:10
> •śŽšƒR[ƒh‚ĚƒR[ƒh‚đ•Ď”‚É‚ľ‚Ä•śŽš—ń‚đ‘€ě‚ˇ‚é‚ą‚Ć‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH

‚Č‚É‚đ‚ľ‚˝‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ń‚Č‚˘‚ń‚ž‚Ż‚ǁB

> •śŽš—ń’†‚Ě‘SŠp•śŽš‚𔟊p•śŽš‚É•Ď‚Ś‚é‰Ř—í‚Č•ű–@‚đ–͍ő‚ľ‚Ä‚˘‚Ü‚ˇB

‰Ř—í‚Č‚Ě‚ÍtrƒRƒ}ƒ“ƒh‚đŽg‚¤•ű–@B‚˝‚žtr‚ރ}ƒ‹ƒ`ƒoƒCƒg‚đ‚¤‚Ü‚­ˆľ‚Á‚Ä‚­‚ę‚é‚Š
‚Ç‚¤‚Š‚Í‚ą‚ą‚ë‚ŕ‚Ć‚Č‚˘B
Perl‚Č‚çtr‚đARuby‚Č‚ç•śŽš—ńƒNƒ‰ƒX‚Ětrƒƒ\ƒbƒh‚đA
Python‚Č‚çstringƒ‚ƒWƒ…[ƒ‹‚ĚmaketransŠÖ”‚Ć•śŽš—ń‚Ěƒƒ\ƒbƒhtranslete‚đŽg‚¤A
‚Ć‚˘‚¤Žč‚Ş‚ ‚éB
awk‚Č‚˘‚ľitrˆČŠO‚́jŒĂ“T“I‚Čƒc[ƒ‹‚ʼnؗí‚É‚â‚é•ű–@‚Í‚Č‚˘‚ĆŽv‚¤B

350 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/24(…) 17:11:16
Excel‚Ĺ
‘SŠp”źŠp•ĎŠˇ‚Í ASC()
”źŠp‘SŠp•ĎŠˇ‚Í JIS()


351 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/25(–Ř) 08:34:11
>>347
1. EUC-JP‚É‚ľ‚Ä(nkf‚Ć‚Š)kakasi ‚ŁA–ß‚ˇ
2. ‚ť‚ę‚ž‚Á‚˝‚çĹ‰‚Š‚çAnkf -Z
3. gawk‘O’ń‚ŁA•śŽš–ˆ‚ɏˆ—(LANG‚đŽw’č‚ľ‚ÄŽqƒvƒƒZƒX‹N“Ž)

awk‚Ě’†‚ŕ‚ś‚Ä‚â‚é‚Ě‚Í‚ß‚ń‚Ç‚­‚ł‚ť‚¤

352 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/03/29(ŒŽ) 23:34:27
gawk 3.1.6
system(cmd) ‚đŽg‚¤‚ƁAƒAƒ“ƒ`ƒEƒBƒ‹ƒXƒ\ƒtƒg(kaspersky)‚Ě
ƒAƒvƒŠƒP[ƒVƒ‡ƒ“—š—đ‚Ƀoƒbƒ`ƒtƒ@ƒCƒ‹‚Ş“o˜^‚ł‚ę‚é‚Ě‚đ”­ŒŠB
close(cmd) ‚ľ‚Ä‚ŕ“Ż‚śB

while(cmd|getline>0){}
‚Ĺ‘ă—p‚ˇ‚é‚ĆŽc‚ç‚Č‚­‚Č‚Á‚˝B??

353 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/13(–Ř) 00:22:57
•§‚Ĺƒuƒ‹ƒJ”Ű’č‚ĚŒˆ‹cĚ‘đ@u‘‚̉ż’lŠĎ‚Ć‘Š—e‚ę‚Č‚˘v
http://www.cnn.co.jp/world/AIC201005120004.html

ƒeƒwƒ‰ƒ“‚ŁAƒuƒ‹ƒJ‚đ’…‚Ä“üo‘‚ˇ‚鎞‚Á‚āAŠç‚Ěƒ`ƒFƒbƒN‚Ç‚¤‚ˇ‚é‚ń‚ž‚낤B
‘źl‚â’j‚Ĺ‚ŕ‚΂ę‚Č‚˘‚́H

354 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/13(–Ř) 00:23:49
>>353
Œë”šƒXƒ}ƒ“

355 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/14(‹ŕ) 13:38:24
http://pc11.2ch.net/test/read.cgi/linux/1215431118/65

356 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 10:51:40
awk‚Ěprint‚ɂ‚˘‚Ä‚˛‹łŽŚ‰ş‚ł‚˘B

‰ş‚̂悤‚ȏo—Í‚Ş—L‚Á‚˝ę‡A—á‚Ś‚Î
lrwxrwxrwx 1 root root 70 May 18 10:37 hoge

ls -al | awk '{print$1$2$2$4$6$7$8$9}' ‚Ć‚ˇ‚ę‚΁u$5v‚Ě
u70v‚𔲂­‚ą‚Ć‚Şo—ˆ‚Ü‚ˇ‚ށA‚ą‚ę‚Ş$100‚Ć‚Š‚Ü‚Ĺ‘ą‚­ę‡A
u$5v‚ž‚Ż‚𔲂Ť‚˝‚˘ę‡‹Lq‚Ş‘ĺ•Ď‚É‚Č‚č‚Ü‚ˇB

‰˝‚Š—Ç‚˘•ű–@‚Í–ł‚˘‚ŕ‚Ě‚Ĺ‚ľ‚傤‚ŠH

357 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 11:01:32
$n‚É‘ă“ü‚Ş‚ ‚é‚ƁA‚ť‚ĚŽž“_‚Ĺ$0‚ލč\Ź‚ł‚ę‚éB

‹ćŘ‚č‚Ě‹ó”’‚Ş$5‚Ě‚ ‚Á‚˝‚Ć‚ą‚ë‚ž‚Ż2ŒÂ‚É‚Č‚é‚Ě‚Ş‹C‚É‚Č‚ç‚Č‚Ż‚ę‚΁A
ls -al | awk '{$5 = ""; print}'
‚Ć‚ˇ‚ę‚΂悢B

‹ó”’2ŒÂ‚đCł‚ˇ‚é‚Č‚ç‚ą‚¤‚ˇ‚éB
ls -al | awk '{$5 = ""; print $0}' | awk '{$1 = $1; print}'

358 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 11:03:15
$0 ‚Í—]Œv‚ž‚Á‚˝B
ls -al | awk '{$5 = ""; print}' | awk '{$1 = $1; print}'

359 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 11:07:03
2‚‚߂Ěawk‚Ě$1 = $1‚͉˝‚Ě‚˝‚ß?

360 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 11:34:06
‚Č‚É‚ŕ‚ľ‚Č‚˘‚ƁA$0‚͓ǂݍž‚ń‚ž‚ť‚Ě‚Ü‚Ü‚Č‚Ě‚Ĺ‹ó”’2ŒÂ‚Í‹ó”’2ŒÂ‚̂܂܁B
$1=$1‚Ĺ‘ă“ü‚ľ‚Ä‚â‚é‚ƁA$1, $2, ...‚đ‹ó”’1ŒÂ‚ł‚Ȃ˘‚ž‚ŕ‚Ě‚Ş$0‚É‘ă“ü‚ł‚ę‚é‚̂ŁA
‹ó”’2ŒÂ‚ž‚Á‚˝‚Ć‚ą‚ë‚Ş‹ó”’1ŒÂ‚É‚Č‚éB

361 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 11:35:04
2‚‚߂Ěawk‚ɐH‚í‚š‚˝Žž“_‚Ĺ$n (n>0)‚Í‹l‚Ü‚é‚Ż‚Ç$0‚Í“ü—͍s‚ť‚Ě‚Ü‚Ü
‹ó”’2ŒÂ‚Č‚Ě‚Ĺ$0‚đÄ\Ź‚ˇ‚é‚Ć‹ó”’1ŒÂ‹ćŘ‚č‚É‚Č‚é

362 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 12:21:12
>>357-358
”ńí‚ɉđ‚č‚₡‚˘‚˛ŕ–žA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚Č‚é‚Ů‚Ç‘ă“ü‚ˇ‚é‚ą‚Ć‚Ĺ‰đŒˆ‚ˇ‚é‚ń‚Ĺ‚ˇ‚ˁB
•×‹­‚É‚Č‚č‚Ü‚ľ‚˝B

363 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 15:08:38
$1 = $1 ‚Á‚ăCƒ}ƒCƒ`‚ć‚­‰đ‚ç‚ń

$1‚Á‚ÄFS‚Ĺ‹ćŘ‚ç‚ę‚˝ˆę‚–ڂž‚ć‚ˁH
‚Č‚ń‚Ĺ‚ť‚ꎊg‚đŽŠ•Ş‚É‘ă“ü‚ľ‚˝‚çƒXƒy[ƒX‚ޏÁ‚Ś‚é‚ńH

364 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 15:27:35
$0‚̍č\Ź‚ލs‚í‚ę‚é‚Š‚ç‚Á‚Äŕ–ž‚ł‚ę‚Ä‚é‚ž‚ëB

$0‚̍č\Ź‚Ć‚Í‚˘‚Á‚˝‚ń‚΂炾‚˝$1,$2,...‚đOFS‚đ‹˛‚ń‚Ĺ
‚‚Ȃ°’ź‚ˇ‚Á‚Ä‚ą‚ƂȂ̂ŁA‰˝‚Ĺ‹ćŘ‚ç‚ę‚Ä‚˘‚˝‚Š‚Í
•Ű‘ś‚ł‚ę‚Č‚˘B

365 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 15:41:56
>>364
>$1=$1‚Ĺ‘ă“ü‚ľ‚Ä‚â‚é‚ƁA$1, $2, ...‚đ‹ó”’1ŒÂ‚ł‚Ȃ˘‚ž‚ŕ‚Ě‚Ş$0‚É‘ă“ü‚ł‚ę‚é

‚Á‚Ä–ń‘ŠŽ–‚đŠo‚Ś‚Ä‚¨‚Ż‚Á‚Ä‚ą‚Ć‚Š‚˘H

366 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 15:42:39
‚ż‚ĺ‚Á‚Ć‹C‚É‚Č‚Á‚ÄŽŽ‚ľ‚Ä‚Ý‚˝B

% echo a b | gawk '{OFS="-";$1=$1;OFS="=";print}'
a=b

Ä\Ź‚Í$1=$1‚đ‚â‚Á‚Ä‚ˇ‚Ž‚ś‚á‚Č‚­‚āAŽŸ‚É$0‚ŞŽg‚í‚ę‚é‚Ć‚ŤA‚Á‚Ä‚ą‚Ć
‚Č‚Ě‚Š‚Č?

367 F365F2010/05/18(‰Î) 16:27:59
‰đ‚Á‚˝

http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html

Œx: ˆę•”‚Ěƒo[ƒWƒ‡ƒ“‚Ěawk‚Í NF‚đŒ¸‚ś‚˝‚Ć‚Ť‚É$0‚̍č\’z‚đs‚í‚Č‚˘B
Œ‹‹Ç‚Ě‚Ć‚ą‚ëAawk‚ɃŒƒR[ƒh‘S‘Ě‚ĚÄ\’z‚đ‹­§‚ľ‚˝‚Ć‚Ť‚É‚Í‚ť‚ĚŽž“_‚Ĺ
ƒtƒB[ƒ‹ƒh‚Ě’l‚ĆOFS‚ŞŽg‚í‚ę‚éBÄ\’z‚đs‚¤‚˝‚߂ɂ́A‰˝‚ç‚Š‚Ě–łŠQ‚Č
‘ă“ü‚đs‚¤:

$1 = $1 # force record to be reconstituted


ŒŤ‚­‚Č‚Á‚˝B‚ ‚ń‚Ş‚ĆB

368 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/18(‰Î) 16:46:58
awk‚Íšú‚ސ[‚˘‚Ě‚§

369 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/19(…) 22:24:52
‹v‚ľ‚Ô‚č‚É‚˘‚˘‚ŕ‚ń‚đŒŠ‚ł‚š‚Ä‚ŕ‚炢‚Ü‚ˇ‚˝„ƒ


370 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/24(ŒŽ) 09:55:14
’m‚ç‚Č‚Š‚Á‚˝B
•×‹­‚É‚Č‚Á‚˝B

371 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/24(ŒŽ) 15:25:46
‚Ý‚ń‚Č>357‚Ě‚¨ˆü‚Ĺ‘˝‚­‚đŠw‚ń‚ž‚ȁB

372 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/05/29(“y) 04:53:07
–ź‘OF
E-mailF
“ŕ—eF
cygwin‚ž‚Ć
% cut -f1 -d, hoge.csv
‚ć‚č
% awk -F, '{print $1}' hoge.csv
‚Ě•ű‚Ş‘Ź‚Š‚Á‚˝B
#ŽŔsŽžŠÔ‚Ë
#PerlHƒVƒ‰ƒl


373 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/06/07(ŒŽ) 11:45:38
>>372
sed -e 's/,.*//'‚Ĺ‚ŕawk‚Ć“Ż‚ś‚­‚炢‚ž‚Š‚çAcut‚ĚŽŔ‘•‚Ş’x‚˘‚ń‚ž‚ˁB
cut‚Ş–ł‘Ę‚ÉƒIƒvƒVƒ‡ƒ“‘˝‚˘Šˆ×‚ś‚á‚Č‚˘?

374 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/06/07(ŒŽ) 12:04:05
ŽčŒł‚ĚlinuxŠÂ‹Ť‚ž‚Ćcut‚Ě•ű‚Ş‘Ź‚˘‚Ć‚˘‚¤•’Ę‚ĚŒ‹‰Ę‚Ĺ‚ľ‚˝‚ށB
hoge.csv‚Í6Œ…‚Ě—”3‚‚đu,]‚Ĺ‹ćŘ‚Á‚Ä•Ŕ‚ׂ˝100–œs‚Ě
ƒtƒ@ƒCƒ‹‚Ĺ‚ˇB

% time cut -f1 -d, hoge.csv >/dev/null
cut -f1 -d, hoge.csv > /dev/null 0.21s user 0.01s system 99% cpu 0.222 total
% time awk -F, '{print $1}' hoge.csv >/dev/nulll
awk -F, '{print $1}' hoge.csv > /dev/nulll 1.52s user 0.03s system 99% cpu 1.558 total

‚ż‚Č‚Ý‚Éƒo[ƒWƒ‡ƒ“‚Í

cut (GNU coreutils) 8.5
GNU Awk 3.1.7

375 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/06/07(ŒŽ) 12:22:48
‚ [‚Č‚é‚قǁA‚Č‚ń‚Š”ť‚Á‚˝Bcygwin‚Ěfgetc()‚Ş’x‚˘‚Š‚ç‚ś‚á‚Č‚˘‚Š‚ȁB
fgetc()‚Ćfgets()‚ĹŽžŠÔ‚đŠr‚ׂ˝‚Ć‚Ť‚Éfgetc()‚Ě•ű‚Ş‚¸‚Á‚Ć’x‚Š‚Á‚˝‹L‰Ż‚Ş‚ ‚éB

376 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/13(ŒŽ) 14:14:54
xgawk (gawk‚Ĺ‚Č‚­)‚É‚Ć‚ ‚éwebƒy[ƒW‚đH‚ׂł‚š‚é‚ƁAXMLERRR (not well-formed)‚Ĺ’†’f‚ľ‚Ü‚ˇB
‚ť‚Ěƒy[ƒW‚Şwell-formed‚Š‹ÉˆŤ‚Š‚ÍŽ„‚É‚Ć‚Á‚Ä‚Ç‚¤‚Ĺ‚ŕ‚ć‚­A’P‚É“ŕ—e‚đ“ž‚˝‚˘‚ž‚Ż‚Ȃ̂ŁA•ś––‚Ü‚Ĺˆ—‚ľI‚Ś‚Ä—~‚ľ‚˘‚Ě‚Ĺ‚ˇB
‚Ç‚¤‚É‚Š‚Č‚ç‚Č‚˘‚Ĺ‚ľ‚傤‚ŠB

377 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/25(“y) 14:55:22
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg“ŕ‚ĹƒpƒCƒv“ü—Í‚ł‚ę‚˝‚ŕ‚Ě‚đˆ—‚ˇ‚é
ƒAƒNƒVƒ‡ƒ“‚đƒqƒAƒhƒLƒ…ƒƒ“ƒg‚ŏ‘‚­Ž–‚͏o—ˆ‚é‚Ĺ‚ľ‚傤‚ŠB


378 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 14:57:18
Žż–â‚Ĺ‚ˇB
ƒf[ƒ^‚Ş
|1|aaa|
|2|bbb|
|3|ccc|
‚Č‚Ç‚Ć‚Č‚Á‚Ä‚˘‚é‚Ć‚Ť
aaa
bbb
ccc
‚đŽć‚čo‚ť‚¤‚Ć‚ľ‚Ä
awk 'FS="|"{print $3}' ƒtƒ@ƒCƒ‹–ź
‚Ć‚ľ‚˝‚ń‚Ĺ‚ˇ‚ށA1s–Ú‚ž‚Ż‚Ş‚¤‚Ü‚­‚Ć‚ę‚Ü‚š‚ńB
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ě1s–Ú‚đ‹ós‚É‚ˇ‚ę‚Î‰đŒˆ‚Ĺ‚Ť‚Č‚˘‚ą‚Ć‚Í‚Č‚˘‚ń‚Ĺ‚ˇ‚ށA
‹ós‚đ“ü‚ę–Y‚ę‚Ä‚ľ‚Ü‚¤Œœ”O‚Ş‚ ‚č‚Ü‚ˇB
‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚ń‚Ĺ‚ľ‚傤‚Š?

379 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 15:01:46
‚â‚č‚˝‚˘‚ą‚Ć‚Í awk 'BEGIN {FS="|"} {print $3}' ‚ś‚á‚Č‚˘‚Š‚ĆŽv‚¤‚ń‚ž‚Ż‚Ç

380 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 15:08:38
378‚Ĺ‚ˇB
>>379
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B

381 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 18:42:12
gensub()‚ɂāAƒ}ƒbƒ`‚ľ‚˝10”Ô–ÚˆČ~‚ĚƒOƒ‹[ƒv‚ĚŽw’č‚ĚŽd•ű‚đ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B
‰ş‹LƒTƒCƒg‚ł́A17”Ô–Ú‚Ü‚Ĺ•’Ę‚ÉŽw’č‚Ĺ‚Ť‚é‚悤‚ČŽ–‚ޏ‘‚˘‚Ä‚ ‚é‚Ż‚ǁA
http://tounderlinedk.blogspot.com/2010/08/gensub-n-awk.html

gensub(pattern,"\\10","g",$2) ‚Ć‚Š‚­‚Ć
\\1(ƒ}ƒbƒ`‰ÓŠ)‚Ć0(•śŽš)‚Ć‚ľ‚ĉđŽß‚ł‚ę‚ż‚á‚Á‚ďăŽč‚­‚˘‚Č‚Š‚˘B

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg•—‚Š‚ĆŽv‚Á‚āA\\{10} ‚ம‚ľ‚˝‚Ż‚ǃ_ƒƒ_ƒbƒ^[B

GNU Awk 3.1.5‚Ĺ‚ˇB


382 F381F2010/09/27(ŒŽ) 19:00:47
BSD‚Ějman‚ɂ́A1‚Š‚ç9‚܂ł̐”Žš‚Á‚Ä–ž‹L‚ł‚ę‚Ä‚é‚Č‚ B
ŽŔ‘•‚É‚ć‚Á‚ĈႤ‚Ě‚Š‚Č‚ 
ƒpƒ^[ƒ“‚đ“Ž“I‚ɐśŹ‚ľ‚ă}ƒbƒ`‚ł‚š‚悤‚Ć‚ľ‚Ä‚é‚Š‚猋\˘‚é(LEƒÖE`)
http://www.linux.or.jp/JM/html/GNU_gawk/man1/gawk.1.html


383 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 19:04:47
>>381
ƒ}ƒjƒ…ƒAƒ‹‚É‚Í1‚Š‚ç9‚Ü‚Ĺ‚Á‚ď‘‚˘‚Ä‚ ‚é‚ľ

Within the replacement text s, the sequence \n, where n is a digit from 1 to 9, may be
used to indicate just the text that matched the n'th parenthesized subexpression.

ƒ\[ƒX‚ĚŠY“–‰ÓŠ(builtin.c‚Ě2542s–Ú‚ ‚˝‚č‚Š‚ç)‚Ý‚Ä‚ŕ1Œ…ŒŔ’č‚ĚƒƒWƒbƒN‚ž‚ćB(3.1.7’˛‚×)

int dig = scan[1] - '0';

‚Č‚ń‚Ä‚â‚Á‚Ä‚éB

384 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 19:08:03
ˆę’U‚Ô‚Á‚˝Ř‚é‚ľ‚Š‚Č‚˘‚ń‚ś‚á‚Ë

385 F381F2010/09/27(ŒŽ) 19:12:31
>>383
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>384
‚ż‚ĺ‚Á‚ĆŒŠ‰h‚ŚˆŤ‚­‚Č‚é‚Ż‚Ç‚ť‚¤‚ˇ‚é(LEƒÖE`)

386 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/27(ŒŽ) 21:27:29
>>381
‚Č‚ń‚Ĺ‚ť‚ą‚Ě‚Đ‚Ć‚Í16‚Ü‚Ĺ‚Ĺ‚Ť‚˝‚ń‚žH

387 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 00:32:52
10‚Ě‘ă‚í‚č‚É:‚đŽg‚Á‚Ä‚˘‚˝‚č‚ľ‚āB

388 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 03:15:24
‚ą‚ĚƒXƒŒ‚ސˇ‹ľ‚Č‚Ě‚Ş’ż‚ľ‚˘‚Š‚ç
‹L”OƒpƒsƒRB

389 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 03:41:50
15”NˆČă‘O‚ž‚Ż‚Çawk‚̕׋­Žn‚ß‚Ä“ŻŽž‚Éperl‚̕׋­‚ŕ‚ľ‚Ä‚˝‚ç
‹C•t‚˘‚˝‚çperl‚΂Á‚Š‚č‚â‚Á‚Ä‚Äawk‚ˇ‚Á‚Š‚č–Y‚ę‚Ä‚ľ‚Ü‚Á‚˝‚Č‚Ÿ
Ą‚ÍperlŽĚ‚ĂĐę‚çpython‚â‚Á‚Ä‚é‚Ż‚Çawk‚ŕ‚˘‚˘‚ć‚Ë

390 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 09:40:13
Busybox‚É‘g‚ݍž‚߂΁A‚ť‚ę‚ą‚ť†”ŃŠí‚â—â‘ ŒÉ‚Ĺ‚ŕ“Ž‚­‚Š‚ç‚Č‚ B
ŽčŒy‚Ĺ‚ ‚é‚É‚ŕŠÖ‚í‚炸AŒ‹\‚“x‚ȏˆ—‚ŕƒKƒŠƒKƒŠ‘‚Ż‚é‚Š‚çD‚ŤB

C‚ĆƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ލD‚Ť‚ž‚Š‚çA•ś–@“I‚É‚ŕ‚ľ‚Á‚­‚č—ˆ‚éB
ăˆĘŒÝŠˇ‚ĚPerl‚ŕ‘ĺD‚ŤB

391 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 14:37:59
>>376‚Ĺ‚ˇ‚ށA’N‚ŕ‚Š‚Ü‚Á‚Ä‚­‚ę‚Č‚˘‚Ě‚ĹŽâ‚ľ‚ł‚ĹŽ€‚É‚ť‚¤‚Ĺ‚ˇB

392 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 14:52:08
>>391
‚Ç‚ę‚Ĺ‚ŕD‚Ť‚Č‚Ě‚đ‘I‚×

1. xgawk‚đ‰ü‘˘
2. ƒGƒ‰[‚É‚Č‚éXML‚đŽ–‘O‚ɏCł‚ľ‚Äwell-formed‚É‚ľ‚Ä‚Š‚çH‚í‚š‚é
3. xgawk‚ÍŽĚ‚Ä‚Ä•Ę‚ĚŒžŒęAƒ‰ƒCƒuƒ‰ƒŠ‚đŽŽ‚ˇ

393 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/09/28(‰Î) 17:23:08
jawk‚Şjwalk‚ÉŒŠ‚Ś‚Ä‚ľ‚Ü‚¤

394 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/01(‹ŕ) 11:21:26
“Ž‚­ŠÂ‹Ť‚Ě‘˝‚ł‡‚ɃCƒ“ƒ^ƒvƒŠƒ^‚đ‘I‚Ô‚ń‚Č‚çA

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg > awk >>> perl >>>>> python >>>>> ruby >>> haskel etc.

‚Ć‚Č‚é‚ž‚낤‚ȁB

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚̓VƒFƒ‹ˆË‘ś‚Č•”•Ş‚Ş‘˝‚­Aperl ‚Ů‚Ç‚‹@”\‚Č‚ŕ‚Ě‚ŕ—v‚ç‚Č‚˘B
‚ť‚ń‚ČŽžAŹ‚ł‚Č’[––‚Ĺ‚ŕƒXƒ}[ƒg‚É“Ž‚˘‚Ä‚­‚ę‚é awk ‚É‚ż‚ń‚ą–u‚B

>>389
ŒžŒę‚ÉŽĚ‚Ä‚é‚ŕE‚¤‚ŕ‚Č‚˘‚ćB‚ť‚ĚŽžX‚É“s‡‚Ě—Ç‚˘‚ŕ‚Ě‚đ‘g‚ݍ‡‚í‚š‚ÄŽg‚¤‚Ě‚ŞUNIX“I‚Č”­‘zB

395 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/01(‹ŕ) 15:33:40
>>394
uˆę”­‚â‚낤v‚Ĺ‚ˇ‚ˁI

396 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/09(“y) 04:40:48
awkĹ‹ß•×‹­‚ľ‚Ä‚éBperl‚ć‚č‘S‘RŠČ’PB
‚ą‚ę‚Ȃ牴‚Ĺ‚ŕÁÜ‚ľ‚Č‚­‚Ä‚ˇ‚Ý‚ť‚¤

397 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/09(“y) 04:57:14
>>396@‚Ş‚ń‚΁I

398 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/21(–Ř) 20:16:46
sjis‚ŏ‘‚˘‚˝
/[/{print}
‚đŽŔs‚ˇ‚é‚Ć

awk:
awk: ^ ł‹K•\Œť‚ޏI’[‚ł‚ę‚Ä‚˘‚Ü‚š‚ńB
awk: ’v–˝“I: [ ‚Ü‚˝‚Í [^ ‚ޑΉž‚ľ‚Ü‚š‚ńB: /[/{print}/

‚ĚƒGƒ‰[‚É‚Č‚Á‚Ä‚ľ‚Ü‚˘‚Ü‚ˇB
[‚Ě2ƒoƒCƒg–Ú‚Ş[‚Č‚š‚˘‚ž‚ĆŽv‚˘‚Ü‚ˇ‚ށA‚Ç‚¤‘Ήž‚ľ‚˝‚炢‚˘‚Ĺ‚ľ‚傤‚ŠH
“ü—̓tƒ@ƒCƒ‹‚Ísjis‚ŏ‘‚Š‚ę‚Ä‚˘‚āA•śŽšƒR[ƒh•ĎŠˇ‚Í‚Ĺ‚Ť‚Ü‚š‚ńB


399 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/21(–Ř) 20:55:41
>>398
ŠÂ‹Ť‚Ě–â‘č‚Č‚ń‚ž‚Š‚çAŽŔsŠÂ‹Ť‚­‚炢‚Ü‚Ć‚ŕ‚ɏ‘‚Ż‚ćB

400 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/21(–Ř) 21:38:24
>>398
gawk ‚đŽg‚¤

401 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/21(–Ř) 22:52:57
ŠÂ‹Ť‚ÍCentOS-5.5-x86_64‚ĹGNU Awk 3.1.5‚Ĺ‚ˇB
/bin/awk‚̓Vƒ“ƒ{ƒŠƒbƒNƒŠƒ“ƒN‚ŁAŽŔ‘Ě‚Ígawk‚Ĺ‚ľ‚˝B

402 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/21(–Ř) 23:49:35
>>401
--help ‰Ĺ

403 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/22(‹ŕ) 01:41:07
Windows‚V(64bit)‚ĹŽg‚Ś‚éawk‚ ‚č‚Ü‚ˇ‚ŠH


404 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/22(‹ŕ) 02:19:30
32bit”Ĺ‚Ěawk‚đ‚đŽg‚¤‚ń‚ś‚áƒ_ƒH

405 F398F2010/10/22(‹ŕ) 07:32:34
‚ą‚¤‚ˇ‚é‚ą‚ƂőΉž‚Ĺ‚Ť‚Ü‚ľ‚˝B
/\x81\[/{print}

406 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/22(‹ŕ) 09:41:36
‚ť‚ę‚Ĺ‚˘‚˘‚Č‚çA/[[]/‚Ĺ‚ŕ‚˘‚˘ŠóƒKƒXB
Ş–{“I‚Č‰đŒˆ‚É‚Č‚Á‚Ä‚Č‚˘‚Ż‚Ç‚Ë‚ĽB

407 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/22(‹ŕ) 13:52:10
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚âƒ_ƒuƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚ĚŽg‚˘•Ş‚Ż‚ś‚á‚ˁ`

408 F398F2010/10/22(‹ŕ) 19:55:53
Ş–{“I‚Č‰đŒˆ‚ˇ‚é‚Ć‚ľ‚˝‚ç•śŽšƒR[ƒh‚đ•Ď‚Ś‚é‚ą‚Ć‚Ĺ‚ľ‚傤‚ŠH


409 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/22(‹ŕ) 20:03:18
“ú–{Œę‚Ě•śŽšƒR[ƒh‚ɑΉž‚ľ‚Ä‚éawk‚đŽg‚¤A‚Ć‚˘‚¤•ű–@‚ŕ‚ ‚éB
Ą‚ ‚é‚Ě‚Š‚Ç‚¤‚Š’m‚ç‚Č‚˘‚Ż‚ǁB

410 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/22(‹ŕ) 20:28:38
Ą‚Ěgawk‚Í•’Ę‚ÉUnicode‘Ήž‚ľ‚Ä‚é‚Ý‚˝‚˘

$ echo '‚Ä‚ˇ‚Ć' | gawk '/[‚Ÿ-‚ń]/ { print length($0) }'
3

UTF-8ƒƒP[ƒ‹‚Ĺ‚ľ‚ŠŽŽ‚ľ‚Ä‚Č‚˘‚Ż‚Ç
cygwin‚Ĺ‚ŕ‘ĺä•v

411 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/23(“y) 01:29:00
>>404
gawk‚Ĺ‚˘‚˘‚Š‚Č

412 F399F2010/10/23(“y) 06:55:10
>>405

–â‘č‚Í‰đŒˆ‚ľ‚˝‚Ě‚Š‚ŕ‚ľ‚ç‚ń‚ށAˆę‰žB
ˆČ‰ş2‚‚ĚWin—pƒoƒCƒiƒŠ‚Í–â‘č‚Č‚˘‚̂ŁAƒ\[ƒX‚ŕ‚ç‚Á‚ÄLinuxă‚ĹƒRƒ“ƒpƒCƒ‹‚ľ‚Ä‚Ý‚˝‚çH

ttp://gnuwin32.sourceforge.net/packages/gawk.htm
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/


413 F398F2010/10/23(“y) 10:53:14
ƒT[ƒoŠÇ—ŽŇ‚ś‚á‚Č‚˘‚Ě‚ĹƒT[ƒo‚đ‚˘‚ś‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘‚Ĺ‚ˇB
‚ą‚ę‚É‚ľ‚˝‚çsjis‚Ĺ‚ŕ“Ž‚­‚悤‚É‚Č‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH

414 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/10/23(“y) 12:27:19
>>413
­‚Č‚­‚Ć‚ŕŽŠ•Ş‚ŞŽŽ‚ľ‚˝Windows2003ă‚ł͂ȁB

¤tes.awk Śsjis
/[/{print}
˘

CentOS5.5ă
$ gawk -f tes.awk readme.ja
awk: tes.awk:1:
awk: tes.awk:1: ^ ł‹K•\Œť‚ޏI’[‚ł‚ę‚Ä‚˘‚Ü‚š‚ńB
awk: tes.awk:1: ’v–˝“I: [ ‚Ü‚˝‚Í [^ ‚ޑΉž‚ľ‚Ü‚š‚ńB: /[/{print}/

Windows2003ă
> gawk -f tes.awk readme.ja
Ëƒ}ƒbƒ`‚ľ‚˝•¨‚Ş•\ŽŚ‚ł‚ę‚é

Linuxă‚ĹƒƒP[ƒ‹‚đsjis.japanese‚Ć‚Š‚É‚ˇ‚ę‚΂˘‚˘‚Ě‚Š‚ĆŽv‚Á‚˝‚ށAƒƒP[ƒ‹•ĎXŽŠ‘Ě‚Ş‚¤‚Ü‚­‚˘‚Š‚Č‚Š‚Á‚˝‚íB
˘‚Á‚Ă鎖‚Ş‚ ‚é‚Č‚çAĹI“I‚ɉ˝‚Ş‚ľ‚˝‚˘‚ŠŒž‚Á‚˝‚Ů‚¤‚Ş‚˘‚˘‚ćB

415 F398F2010/10/23(“y) 12:40:31
Windows2003‚ž‚Ć‚ż‚á‚ń‚Ć“Ž‚­‚ń‚Ĺ‚ˇ‚ˁB
˘‚Á‚Ä‚˘‚˝‚ą‚Ć‚Í405‚Ĺ‰đŒˆ‚ľ‚˝‚Ě‚Ĺ‘ĺä•v‚Ĺ‚ˇB
Ą‚́uŞ–{“I‚Č‰đŒˆv‚É‹ť–Ą‚Ş‚ ‚Á‚˝‚Ě‚Ĺ‚¨•ˇ‚Ť‚ľ‚˝ŽŸ‘ć‚Ĺ‚ˇB

416 F‰SŽŇF2010/11/04(–Ř) 22:14:10
awk‚ĹƒVƒFƒ‹‚ĚPATH•Ď”‚đƒ}ƒbƒ`‚ł‚š‚é‚Ć‚Ť‚ɃXƒ‰ƒbƒVƒ…//‚đŽg‚í‚Č‚˘•ű–@‚đ‹ł‚Ś‚Ä‚˘‚˝‚ž‚Ż‚Ü‚š‚ń‚ŠH

417 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/11/04(–Ř) 23:14:10
>>416
‰SŽŇ‚ž‚Š‚çƒ}ƒ‹ƒ`‚Ş‹–‚ł‚ę‚é‚Ć‚Ĺ‚ŕŽv‚Á‚˝‚ŠH

418 F‰SŽŇF2010/11/05(‹ŕ) 06:32:09
‚˛‚ß‚ń‚Č‚ł‚˘I
’m‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B

419 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/15(…) 01:54:35
”z—ń‚Ě—v‘f”‚𒲂ׂé‚Č‚çAƒ‹[ƒvˆ—‚ľ‚Č‚˘‚Ć•Ş‚Š‚ç‚Č‚˘H
length ‚Ý‚˝‚˘‚Č‚Ě‚Í–ł‚˘H

420 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/15(…) 02:27:50
‚ ‚é‚ćB‚Ü‚ł‚ľ‚­Alength(array)B

421 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/15(…) 02:42:46
‚ť‚ń‚Č‚ŕ‚ń‚Ë‚Ľ‚ć‚—
‚ĆŽv‚Á‚˝‚çgawk‚É‚Í‚ ‚é‚Ě‚Š

length([s]) Returns the length of the string s, or the
length of $0 if s is not supplied. Starting
with version 3.1.5, as a non-standard exten-
sion, with an array argument, length() returns
the number of elements in the array.

422 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/15(…) 04:20:37
‚Ţ‚ľ‚ë”z—ń‚Ş‘śÝ‚ˇ‚é‚Á‚Ä‚ą‚Ć‚Í‚ť‚Ě”z—ń‚đěŹ‚ˇ‚é‰ß’ö‚Ş‚ ‚é‚ž‚ëH
ěŹ‚ˇ‚é‚Ć‚Ť‚ɐ”‚Ś‚ę‚΂˘‚˘‚ń‚ś‚á‚ˁH

423 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/15(…) 08:40:15
˜A‘z”z—ń‚ž‚Á‚˝‚琔‚Ś‚Č‚˘‚Ě‚Ş•’Ę‚ž‚Ş‚Č

424 F419F2010/12/25(“y) 03:12:23
function ‚ŏˆ—‚ˇ‚鎞A”z—ń‚ž‚Ż‚Ĺ‚Íƒ_ƒ‚Ĺ—v‘f”‚Ü‚Ĺ•K—v‚Č‚ń‚ž‚Š‚Č‚ŸA
‚Á‚ÄŽ–‚Ş•Ş‚Š‚č‚Ü‚ˇ‚˝

425 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/28(‰Î) 11:29:35
function ‚É“n‚ˇ‚ž‚Ż‚Č‚ç—v‘f”‚Č‚ń‚Ä‚˘‚ç‚Č‚˘‚ń‚ś‚á‚Č‚˘H


426 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/28(‰Î) 13:55:13
$1 = $1‚Ý‚˝‚˘‚ČƒgƒŠƒbƒN‚đŒŠ‚é“x‚ɉœ‚ސ[‚˘‚ĆŒž‚¤‚ć‚č‚Í•ł‚ÉŒŠ‚Ś‚Ä‚Ť‚Ü‚ˇ
–|‚ˇ‚ĆUNIX•ś‰ť‚ť‚Ě‚ŕ‚Ě‚Ş
‚Ü‚ A‚ ‚­‚Ü‚Ĺ‚¨‚ę‚ĚŽĺŠĎ‚Ĺ‚ˇ‚Ş‚Ë

427 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/28(‰Î) 15:24:21
>>426
‚‚—‚‹‘ĺD‚Ť‚ČƒIƒCƒ‰‚ÉŒ–‰Ü”„‚é‚Ě‚Š‚—
ƒEƒjƒbƒNƒX•ś‰ťĹ‚Ii‚m‚sŒn‚Í‚t‚m‚h‚w‚ĚƒpƒNƒŠj

428 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2010/12/28(‰Î) 15:28:13
>>427
‘SŠp‰pŽšŽg‚¤“z‚Ş awk ‘ĺD‚Ť‚ž‚Ć‚Í“ž’ęŽv‚Ś‚ń

429 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/05(…) 23:22:55
‚Ü‚ “~‹x‚ÝŠúŠÔ‚ž‚ŕ‚̂ˁB

430 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/06(–Ř) 00:22:04
Ľtes09.awk
BEGIN{
@@if (ARGV[1]=="")
@@@@ARGV[1]="hoge.txt"
@@while (getline < ARGV[1] > 0) print "BEGIN\t"$0
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

šŽż–â
ă‹LƒXƒNƒŠƒvƒg‚đˆř”‚đ•t‚Ż‚˝ę‡‚Ć•t‚Ż‚Č‚˘ę‡‚đ‚ť‚ę‚ź‚ęŽŔs‚ľ‚Ü‚ľ‚˝B

Ľgawk -f tes09.awk hoge.txt
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com
BODY@@arima_yuuichi@example.com
BODY@@ooizumi_sadawo@example.com
BODY@@taguchi_kenji@example.com

Ľgawk -f tes09.awk
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com

‚ą‚ą‚ŁABEGIN‹ĺ‚Ĺ‚Ě ARGV[1]="hoge.txt" ‚Ć‚˘‚¤‘ă“ü‚đ–{•Ň(?)‚Ĺ‚ŕ—LŒř‚É‚ˇ‚éˆ×
‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH

431 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/06(–Ř) 00:31:45
‚Č‚É‚ŕ‚ľ‚Č‚­‚Ä‚ŕ—LŒř‚ž‚ĆŽv‚¤‚ń‚ž‚Ż‚Ç
Žż–â‚ĚŽďŽ|‚Ş‚í‚Š‚ç‚ń

432 F430F2011/01/06(–Ř) 06:20:53
•Ş‚Š‚čh‚­‚Ä‚ˇ‚Ý‚Ü‚š‚ńB
hoge.txt‚Ě’†g‚͉ş‹L‚Ĺ‚ˇB
Ľ
arima_yuuichi@example.com
ooizumi_sadawo@example.com
taguchi_kenji@example.com

>>430‚ÍWin32‚ĚƒoƒCƒiƒŠuGNU Awk 3.1.7(windows special Nov 24 2009)v‚đŽg—p‚ľ‚˝Œ‹‰Ę‚Ĺ‚ˇB
‰ş‚Ě‚Ů‚¤‚ĚŽŔsŒ‹‰Ę‚ł́ABEGIN‹ĺ‚Ĺ‚ĚARGV[1]‚Ö‚Ě‘ă“ü‚ÍBEGIN‹ĺ‚Ĺ‚Í—LŒř‚Ĺ‚ˇ‚ށA
–{•Ň‚Ĺ‚Í—LŒř‚É‚Č‚Á‚Ä‚˘‚Č‚˘‚Ě‚Ĺo—Í‚ł‚ę‚Ä‚˘‚Č‚˘‚悤‚ÉŒŠ‚Ś‚Ü‚ˇB

‚ż‚Ȃ݂ɁACentOS5.5ă‚Ě GNU Awk 3.1.5 ‚ł͉ş‹LƒGƒ‰[‚É‚Č‚č‚Ü‚ľ‚˝B

Ľ
gawk: tes09.awk:2: @@if (ARGV[1]=="")
gawk: tes09.awk:2: ^ •\Œť‚Ě char 'E' ‚Í•sł‚Ĺ‚ˇB

433 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/06(–Ř) 08:57:49
“ü—̓ŒƒR[ƒh‚Ş1Œ‚ŕ–ł‚˘‚Š‚ç‚Ĺ‚ľ‚ĺ

>gawk: tes09.awk:2: ^ •\Œť‚Ě char 'E' ‚Í•sł‚Ĺ‚ˇB
‚ą‚ę‚Í‘SŠpƒXƒy[ƒX

434 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/06(–Ř) 09:12:00
>BEGIN@ arima_yuuichi@example.com
>BEGIN@ ooizumi_sadawo@example.com
>BEGIN@ taguchi_kenji@example.com
ƒRƒŒ‚Ígetline‚Ĺ“Ç‚ń‚ŏo—Í‚ľ‚˝‚ŕ‚Ě

>BODY@@arima_yuuichi@example.com
>BODY@@ooizumi_sadawo@example.com
>BODY@@taguchi_kenji@example.com
ƒRƒŒ‚̓Rƒ}ƒ“ƒh‚ĹŽw’č‚ľ‚˝ƒtƒ@ƒCƒ‹‚Š‚ço—Í‚ľ‚˝‚ŕ‚Ě

‚˝‚Ć‚Ś‚Î
{
@@print "BODY\t"$0
}
‚Ć‚ľ‚Ä‚â‚ę‚Ζž‚ç‚Š


435 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/06(–Ř) 13:46:53
Žż–â‚ĚŽďŽ|‚́AƒvƒƒOƒ‰ƒ€iƒXƒNƒŠƒvƒgj‚Ě’†‚Ĺ“ü—̓tƒ@ƒCƒ‹“™‚Ě
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚đ’ljÁ‚ľ‚˝‚˘‚Ć‚˘‚¤Ž–‚Ĺ‚ˇ‚ŠB

ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Ě”z—ń‚Í ARGV ‚Ĺ‚ˇ‚ށAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Ě
ŒÂ”‚đŠi”[‚ˇ‚é ARGC ‚Ć‚˘‚¤‘g‚ݍž‚ݕϐ”‚Ş‚ ‚č‚Ü‚ˇB

ARGV”z—ń‚đ’ljÁ‚ľ‚˝‚çˆę‚É ARGC ‚đCł‚ľ‚Ä‚ ‚°‚Č‚˘‚ƁAawk‚Í”z—ń‚Ş
’ljÁ‚ł‚ę‚˝Ž–‚đ”FŽŻ‚ľ‚Ü‚š‚ńB

BEGIN“ŕ‚ĹARGV”z—ń‚đ’ljÁ‚ľ‚˝•Ş‚ž‚ŻARGC‚đƒCƒ“ƒNƒ‹ƒƒ“ƒg‚ľ‚Ä‚ ‚°‚ę‚Î
’ljÁ‚ł‚ę‚˝ARGV”z—ń‚ĹŽw’č‚ł‚ę‚˝ƒtƒ@ƒCƒ‹‚ŕ–{•ś‚̏ˆ—‚É“n‚ł‚ę‚Ü‚ˇB

ŽÖ‘Ť‚Ć‚ľ‚ẮA
ŒťÝˆ—’†‚Ěƒtƒ@ƒCƒ‹–ź‚ŞŠi”[‚ł‚ę‚Ä‚˘‚é”z—ń ARGV ‚ĚƒCƒ“ƒfƒbƒNƒX‚đ
ŽŚ‚ˇ‘g‚ݍž‚ݕϐ”‚Í ARGIND ‚Ĺ‚ˇB

Ž„‚Ě‚Í Win”Ĺ‚Ě gawkm115 ‚Ĺ‚ˇBƒXƒNƒŠƒvƒg“ŕ‚ĹARGV/ARGC‚đ‘€ě‚ľ‚Ä‚ŕ
Šú‘Ғʂ萳í‚É“Ž‚Ť‚Ü‚ˇ‚ćB

ŽŽ‚ľ‚Ă݂ĂˁB


436 F430F2011/01/06(–Ř) 23:56:01
ŠF—lƒŒƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>433
>‚ą‚ę‚Í‘SŠpƒXƒy[ƒX

‚¨’p‚¸‚Š‚ľ‚˘ŒŔ‚č‚Ĺ‚ˇ(Šž) o‹Î‘O‚ÉŽv‚˘‚‚Ť‚ĹŽŽ‚ľ‚˝‚ŕ‚̂ŁAƒXƒŒ—p‚ɏ‘‚˘‚˝
•¨‚đ‚ť‚Ě‚Ü‚ÜƒRƒs‚Á‚Ä‚Ü‚ľ‚˝EEE

>>434
BEGIN‹ĺ‚Ěgetline‚Ĺ‚ÍARGV[1]‚Ö‚Ě‘ă“ü‚Ş‚Ĺ‚Ť‚Ä‚˘‚é‚̂ɁA–{•ś‚Ĺ‚Í—LŒř‚É
‚Č‚ç‚Č‚˘‚Ć‚˘‚¤Ž–‚đ“`‚Ś‚˝‚Š‚Á‚˝‚Ě‚Ĺ‚ˇB

437 F430F2011/01/06(–Ř) 23:56:17
>>435
ŽŠ•Ş‚ĚŽż–â‚đŒŠ’ź‚ľ‚Ä‚Ý‚é‚Ć‘S‚­Žż–â‚É‚Č‚Á‚Ä‚˘‚Č‚Š‚Á‚˝‚É‚ŕŠÖ‚í‚炸ƒGƒXƒp[
‚ľ‚Ä‚­‚ž‚ł‚Á‚Ä‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

ARGC‚ɂ‚˘‚Ä—‰đ‚Ĺ‚Ť‚Ü‚ľ‚˝B

BEGIN{
@@ARGV[1]="hoge.txt"
@@ARGC=2
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

‚ą‚ń‚ČŠ´‚ś‚ĹˆÓ}‚ľ‚˝’Ę‚č‚ɏo—Í‚ł‚ę‚Ü‚ľ‚˝B

‚¨‚Š‚°‚ł‚Ü‚ĹĄ‚Ü‚Ĺawk‚Ě•â•‚Ć‚ľ‚Äsh‚đŽg‚Á‚Ä‚Ü‚ľ‚˝‚ށAawk‚ž‚Ż‚ŏ‘‚Ż‚鎖‚Ş
‘˝‚­‚Č‚č‚Ü‚ľ‚˝B

ˆř”‚ɃƒCƒ‹ƒhƒJ[ƒh‚đŽw’č‚ľ‚āAARGIND ‚Ĺ“Á’čƒpƒ^[ƒ“‚Ěƒtƒ@ƒCƒ‹–ź‚Ě
•¨‚Ě‚Ýˆ—‚đ‚ˇ‚é‚Ć‚Š‚Ĺ‚Ť‚ť‚¤‚Ĺ‚ˇ‚ˁB

438 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/09(“ú) 22:38:39
Žż–â‚Ĺ‚ˇB
My Documents\2011\01\09(“ú)
‚Ć‚˘‚¤‚悤‚ɃtƒHƒ‹ƒ_‚đŘ‚Á‚Ä‚˘‚āAĄ“ú‚Écd‚ˇ‚é‚˝‚߂ɁA

today.bat
gawk -f today.awk > tmp.bat
tmp.bat
del tmp.bat

today.awk
BEGIN{year = strftime("%Y",systime()+9*60*60);
month = strftime("%m",systime()+9*60*60);
date = strftime("%d",systime()+9*60*60);
day = strftime("%a",systime()+9*60*60);

gsub(/(Sun)/, "(“ú)", day);
gsub(/(Mon)/, "(ŒŽ)", day);
gsub(/(Tue)/, "(‰Î)", day);
gsub(/(Wed)/, "(…)", day);
gsub(/(Thu)/, "(–Ř)", day);
gsub(/(Fri)/, "(‹ŕ)", day);
gsub(/(Sat)/, "(“y)", day);

print "cd \"My Documents\" year "\" month "\" date day
}

‚Ć‚˘‚¤‚悤‚ɏˆ—‚ľ‚Ä‚˘‚Ü‚ˇB
‚ą‚ę‚Á‚āA‚Đ‚ĺ‚Á‚Ć‚ľ‚āAgawk‚Ě“ŕ•”‚Š‚çprint‚š‚¸‚ÉŽŔs‚ˇ‚é‚ą‚Ƃ͉”\‚Ĺ‚ľ‚傤‚Š?

439 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/09(“ú) 22:54:33
systemŠÖ”‚ŏo—ˆ‚é‚ń‚ł́Hwin‚Í•Ş‚Š‚ç‚Č‚˘‚Ż‚Ç

440 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/09(“ú) 23:06:13
system("cd \"My Documents\" year "\" month "\" date day);
‚Ć‚Š‚Ĺ‚Í‚ž‚ß‚Ĺ‚ľ‚˝B


441 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/10(ŒŽ) 03:54:21
>440
‚Č‚ń‚Š " ‚Ć \ ‚̐”‚Ş‚¨‚Š‚ľ‚­‚ˁH
My Documents\2011\01\09(“ú)
Ť
"My Documents\\2011\\01\\09(“ú)"
Ť
"My Documents\\" year "\\" month "\\" date day
‚ž‚ć‚ȁH

442 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/10(ŒŽ) 11:42:11
ƒAƒhƒoƒCƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚Í‚˘B
\‚Í‚¨‚Á‚ľ‚á‚é‚Ć‚¨‚č‚Ĺ‚ˇ‚ށAˆË‘R‚Ć‚ľ‚Ä‚ž‚ß‚Ĺ‚ˇB

today.bat‚đƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Š‚çŽŔs‚ˇ‚é‚ƁA
print‚ľ‚Ä‚ť‚Ětmp.bat‚đŽŔs‚ˇ‚é438‚Ěƒpƒ^[ƒ“‚ž‚ƁA
‚ż‚á‚ń‚Ćcd‚Ĺ‚Ť‚āAĄ“ú‚ĚƒtƒHƒ‹ƒ_‚ɈړŽ‚ˇ‚é‚Ě‚Ĺ‚ˇ‚ށA
system("cd \\"My Documents\\" year "\\" month "\\" date day);
‚ž‚ƁAˆÚ“Ž‚š‚¸‚ɏI—š‚ľ‚Ä‚ľ‚Ü‚˘‚Ü‚ˇB
‚Č‚ń‚Ĺ‚ž‚ë[‚ȁB


443 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/10(ŒŽ) 12:32:20
cygwin‚đ“ü‚ę‚Ä‚â‚Á‚Ä‚Ý‚˝

system‚Ísh‚Ĺ“Ž‚­‚Á‚Ű‚˘‚Ě‚Ĺ
rm /cygdrive/c/Documents\ and\ Settings/test.txt
‚Ý‚˝‚˘‚ɏ‘‚­‚Ć‚ż‚á‚ń‚ƏÁ‚Ś‚é‚Ý‚˝‚˘

444 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/10(ŒŽ) 13:24:47
>>438,442

438‚ŏ‘‚˘‚Ä‚égawk‚Ĺ‚â‚č‚˝‚˘‚ą‚Ć‚Á‚Ä‚Ě‚Íƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ĺ‚â‚Á‚Ä‚é‚Ě‚Ć“Ż‚ś‚ą‚Ć?
‚ž‚Á‚˝‚ç–ł—B
system() ‚Ĺcd‚ľ‚Ä‚ŕsystem()‚Š‚ç•Ô‚Á‚Ä‚Ť‚˝‚Ć‚ą‚ë‚ĹŒł‚É–ß‚éB


445 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/11(‰Î) 01:15:49
‚Ç‚¤‚š•łnixƒc[ƒ‹‚ž‚Š‚ç“ú–{Œę‚â‹ó”’‚̓_ƒ‚Č‚ń‚ž‚ë

446 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/11(‰Î) 09:05:01
>>444
‚Č‚é‚قǁBgawk“ŕ•”‚Ĺ‚ÍƒVƒXƒeƒ€‚đŽŔs‚ľ‚Ä‚˘‚Ä‚ŕAgawk‚đo‚é‚ƁA‚ť‚ę‚ŕI‚í‚Á‚ż‚Ⴄ‚ń‚Ĺ‚ˇ‚ˁB‚Č‚é‚قǁB
‚ć‚­‚í‚Š‚č‚Ü‚ľ‚˝B‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

447 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/19(…) 02:44:33
‚Ć‚č‚ ‚Ś‚¸AWK‚ŏ‘‚˘‚˝‹‘ĺ‚ČƒXƒNƒŠƒvƒg‚đAŽI‚ʼnń‚ľ‘ą‚Ż‚é‚Ě‚Í‚â‚ß‚Ä‚­‚ž‚ł‚˘B
”ńŒř—Ś‹É‚Ü‚č‚Č‚˘

448 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/19(…) 15:27:12
‚ť‚ę‚Í‚ť‚̐l‚ÉŒž‚Á‚ĉş‚ł‚˘

449 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/19(…) 21:03:10
‚ť‚̏ę‚ĹŽg‚Ś‚é‚Ě‚Şawk‚ž‚Ż‚ž‚Á‚˝‚ń‚Ĺ‚ˇ

450 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/19(…) 23:56:54
•śŽš‚Š‚ç•śŽšƒR[ƒhŽć‚čo‚š‚Č‚˘‚Ě‚ŞŽc”O
‹t‚Ísprintf("%c", 0x41)‚Ć‚Šo—ˆ‚é‚Ě‚É‚Č

451 F430F2011/01/20(–Ř) 00:40:40
>>447
Œř—Ś‚Ě‚˘‚˘ƒvƒƒOƒ‰ƒ€‚ŏ‘‚Ť’ź‚ľ‚Ä‚â‚ę‚΂˘‚˘‚ś‚á‚Č‚˘B

452 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/20(–Ř) 09:05:02
>>450
‚Âord.awk

gawk•t‘Ž‚Ěƒ‰ƒCƒuƒ‰ƒŠ‚ŁAascii‚Ě”ÍˆÍ‚Ě‘Î‰ž•\ě‚Á‚Ä‚Đ‚­‚Ć‚˘‚¤
ŠČ’P‚ČŽd‘g‚݁B



453 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/20(–Ř) 23:49:13
#!/bin/gawk --re-interval -f

Ş‚Ěƒtƒ@ƒCƒ‹‚đŽŔs‚ˇ‚é‚ĆƒIƒvƒVƒ‡ƒ“‚Ş•sł‚ĆŒž‚í‚ę‚ÄŽŔs‚Ĺ‚Ť‚Č‚˘‚Ě‚Ĺ‚ˇ‚Ş
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚƒIƒvƒVƒ‡ƒ“‚ĹŽw’股‚éˆČŠO‚É‚â‚č•ű‚Í‚ ‚č‚Ü‚ˇ‚ŠH

454 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 05:12:58
>>453
–ł—‚ÉawkƒXƒNƒŠƒvƒg‚É‚š‚¸‚É

#!/bin/sh
awk '
#awkƒR[ƒh
'

‚Á‚Ä‚˘‚¤ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚ľ‚˝‚ç‚Ç‚¤‚Š‚Č

455 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 08:45:02
#!‚ĹƒCƒ“ƒ^ƒvƒŠƒ^‚É“n‚ˇˆř”‚Ěˆľ‚˘‚ÍŽŔ‘•ˆË‘ś‚ž‚Š‚ç‚ȁB
linux‚ž‚Ć‹ó”’‚đŠÜ‚ń‚ž‘S‚Ä‚Ě•śŽš—ń‚ވę‚Â‚Ěˆř”‚Ć‚ľ‚Ä
“n‚ł‚ę‚é‚̂ŁA•Ą”‚ĚƒIƒvƒVƒ‡ƒ“‚Í“n‚š‚Č‚˘B•s•Ö‚ž‚Ż‚Ç
‚ť‚¤‚˘‚¤‚ŕ‚Ě‚Č‚Ě‚Ĺ‚ ‚Ť‚ç‚ß‚Ä‚­‚ž‚ł‚˘B‘f’ź‚ɃVƒFƒ‹‚đ
ŠÔ‚É“ü‚ę‚é‚Ě‚Ş‚˘‚˘‚ĆŽv‚¤‚ćB


456 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 12:45:00
gawk '$3!="*"' in.txt>out.txt
‚Ć‚˘‚¤ˆ—‚ŁA20GB‚Ž‚炢‚Ěin.txt‚𐔕SMB‚Ž‚炢‚ɃXƒŠƒ€ƒAƒbƒv‚ľ‚Ä‚Ü‚ˇB
–â‘č‚́A‚ť‚̏ˆ—‚đ10–{‚Ů‚Ç•Ŕs‚ɍě‹Ć‚ł‚š‚Ä‚˘‚é‚ń‚Ĺ‚ˇ‚Ş
top‚ĹŒŠ‚Ä‚Ý‚é‚Ć‚Ů‚Ć‚ń‚Ç‚ĚgawkƒvƒƒZƒX‚Şsleep‚Šstacked‚É‚Č‚Á‚Ä‚˘‚Ä
‚ ‚ń‚Ü‚č‚ŕ‚č‚ŕ‚č“­‚˘‚Ä‚­‚ę‚Ü‚š‚ńBIO‚Ş—Ľ‘Ź‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
CPU‚ŕƒƒ‚ƒŠ‚ŕĹ‘ĺŒŔĎ‚ń‚Ĺ‚Ü‚ˇB


457 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 12:50:02
stacked -> stuck‚Ĺ‚ľ‚˝B‚ˇ‚˘‚Ü‚š‚ńB

458 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 13:26:09
'$3!="*"'
‚ą‚ę‚Á‚ď‘‚ŤŠÔˆá‚˘H


459 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 13:47:33
í‚ç‚ę‚éƒf[ƒ^‚Ě—á
745_17_70_F3 4 * 0 0 * * 0 0 GGAGTGCCCCACACTTGGAGGCGAGCGCCCGGCAGACTTCCCCGCCGCC &+))8'1%+%-%%'((-)%%)8+,&+*7'+/%5''%%%%%-')-/'%/( XM:i:0

Žc‚éƒf[ƒ^‚Ě—á
745_377_43_F3 0 chr1 181855450 255 48M * 0 0 CATGTATGTGGCCAAAGGAACAACGCTATGTTTCCTAAAAGGCCTAGA G`[[`a`ab`^\ZYZ[SIR\Z[L7I_L>HU^bOKSDES[PO9-HNG7= XA:i:2 MD:Z:26C21 NM:i:1 CM:i:3

‚ą‚¤‚˘‚¤‚Ě‚Ş80–œs‚Ž‚炢‚ ‚é‚悤‚Ĺ‚ˇB

460 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 13:52:48
ƒXƒNƒŠƒvƒg‚Ě’†g‚ÍŽŔŰ‚͈Ⴄ‚í‚Ż‚Ë

‚˝‚Ô‚ńAƒf[ƒ^‚ĚŠi”[ęŠ‚ރvƒƒOƒ‰ƒ€ŽŔsƒ}ƒVƒ“‚Ć•Ę‚Ěƒ}ƒVƒ“‚Ě
ƒfƒBƒXƒN‚Č‚ń‚ś‚á‚Č‚˘‚Š‚ȁB
ƒlƒbƒgƒ[ƒN‚ރrƒW[ó‘Ô‚ž‚ĆŽv‚¤B


461 F453F2011/01/21(‹ŕ) 16:09:37
>454-455

‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B
‹““Ž‚đ•Ď‚Ś‚é‘g‚ݍž‚ݕϐ”‚ŕ–ł‚˘‚悤‚Ĺ‚ˇ‚ˁB

462 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 16:47:10
‚Ć‚č‚ ‚Ś‚¸ df ƒRƒ}ƒ“ƒh‚ōě‹ĆƒfƒBƒŒƒNƒgƒŠ‚Ć /var/tmp ‚Ě‹ó‚Ť—Ěˆć‚Ş
Šm•Ű‚ł‚ę‚Ä‚˘‚é‚ą‚ƂƁAo—̓tƒ@ƒCƒ‹‚ĚƒTƒCƒY‚âƒ^ƒCƒ€ƒXƒ^ƒ“ƒv‚ޏ™X‚É
XV‚ł‚ę‚Ä‚˘‚é‚ą‚Ć‚đŠm”F‚ˇ‚é‚­‚炢‚ľ‚Š‚Č‚˘‚ń‚ś‚á‚Č‚˘‚Š‚ȁB
ƒ[ƒJƒ‹ƒfƒBƒXƒN‚Ĺ‚â‚ę‚΂ŕ‚Á‚Ć‘‚˘‚ĆŽv‚¤‚Ż‚ǁB

463 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 17:42:04
>>460
‚Č‚é‚قǁB
xgrid‚đ‚‚Š‚Á‚āA2‘ä‚Ěƒ}ƒVƒ“‚Ĺ10–{‚¸‚‚قǕŔs‚ľ‚Ägawk‚đ‘–‚ç‚š‚Ä‚¨‚č‚Ü‚ľ‚˝B
NFS‚đ‚‚Š‚Á‚Ä5GB‚قǂ́ić‚Ů‚Ç‚Í20GB‚Ə‘‚Ť‚Ü‚ľ‚˝‚ŞŠÔˆá‚˘‚Ĺ‚ˇjin.txt‚Ě
‚Ěƒf[ƒ^‚đ“ǂݍž‚ń‚ŁAˆ—Œă‚Ěƒf[ƒ^‚đout.txt‚ɏ‘‚Ťo‚ľ‚Ä‚˘‚é‚̂ŁA
ƒlƒbƒgƒ[ƒNƒrƒW[‚É‚Č‚Á‚Ä‚ľ‚Ü‚¤‚Ć‚˘‚¤‚í‚Ż‚Ĺ‚ˇ‚ˁB
ƒlƒbƒgƒ[ƒN‚Ě–â‘č‚Ƃ́BBB
ˆę‰žAƒGƒ‰[‚Ĺ‚ą‚Ż‚é‚ą‚Ć‚Č‚­A‚ľ‚ă‚­‚ľ‚ă‚­‚Əˆ—‚͐i‚Ţ‚Ě‚Ĺ‹C‚É‚ľ‚Č‚˘‚ą‚Ć‚É‚ľ‚Ü‚ˇB

464 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/21(‹ŕ) 17:44:39
2‘ä‚Ěƒ}ƒVƒ“‚Ĺ20–{‚Ĺ‚ľ‚˝i10+11jBBB
ˆęƒvƒƒZƒX‚ ‚˝‚č5GB‚Ěƒtƒ@ƒCƒ‹‚đ“ǂݍž‚ނ̂ŁAƒlƒbƒgƒ[ƒN‚ޔߖ‚đă‚°‚Ä‚˘‚é‚ƁB

465 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/24(ŒŽ) 21:31:50
Ą”NAgawk‚đ‘ĺŠw‚ŏK‚Á‚ĐFX˜M‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁAperl‚Ć‚Š‚ć‚莊—R“x‚Ş’á‚˘‚ĆŒž‚í‚ę‚˝B‚ť‚ń‚Č‚Éˇ‚Ş‚ ‚é‚́H

466 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/24(ŒŽ) 21:46:54
>>465
ŠČˆŐŒžŒę‚Ć‚ľ‚Ä‘¨‚Ś‚é‚Šƒc[ƒ‹‚Ć‚ľ‚Ä‘¨‚Ś‚é‚Š‚Ěˆá‚˘‚ś‚á‚ˁ`
‰´ƒp[ƒ‹‚ć‚čƒI[ƒN‚Ě•ű‚ލD‚Ť‚ž‚Ż‚ǁB


467 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/24(ŒŽ) 22:19:29
>>466
‚Č‚é‚قǁB‚Ü‚ŸA‚ť‚ń‚Č‚É•ĄŽG‚Č‚ą‚Ć‚đ‚ą‚Č‚ˇƒXƒLƒ‹‚đŽ‚ż‡‚í‚š‚Ä‚Č‚˘‚Š‚ç‚ŕ‚¤Žb‚­awk‚Ĺ—V‚ń‚Ĺ‚Ý‚é‚ŠB

468 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/24(ŒŽ) 23:30:11
ŽŠ—R“x‚Ć‚˘‚¤‚ć‚č‚Í‹@”\‚ޏ­‚Č‚˘‚ś‚á‚Č‚˘‚Ě‚ŠH

469 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 05:02:06
‚ą‚ĚƒXƒŒƒbƒh‚Í“VËƒ`ƒ“ƒpƒ“ƒW[uƒAƒC‚ż‚á‚ńv‚Ş
ŒžŒęŒP—ű‚Ě‚˝‚ß‚É—§‚Ä‚˝‚ŕ‚Ě‚Ĺ‚ˇB

ƒAƒC‚ĆŒ¤‹†ˆő‚Ć‚Ě‚â‚čŽć‚č‚É—˜—p‚ˇ‚éƒXƒŒƒbƒh‚Ȃ̂ŁA
ŠÖŒWŽŇˆČŠO‚͏‘‚Ť‚ą‚Ü‚Č‚˘‚ʼnş‚ł‚˘B

@@@@@@@@@@@@@@@@@@‹ž“s‘ĺŠw—ě’ˇ—ŢŒ¤‹†Š

470 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 11:23:33
>>467
perlƒ†[ƒU‚Í‚ˇ‚ׂĂđperl‚ž‚Ż‚Ĺ‚â‚낤‚Ć‚ˇ‚éBC/C++/Java‚ŕŽg‚¤ƒ†[ƒU‚Íawk‚Ě•ű‚đD‚ށB
C/C++/Java‚ÉŽč‚đ‰„‚Î‚ˇ‚‚ŕ‚č‚Č‚ç‚Ţ‚ľ‚ëawk‚Ě‚Ů‚¤‚Ş‚˘‚˘‚ćBperl‚ž‚ĆŽŠŒČŠŽŒ‹‚ľ‚Ä‚ľ‚Ü‚¤‚Š‚çB

471 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 16:02:25
perl‚ć‚čawk‚Ě•ű‚Ş‘Ź‚˘Ž–‚Á‚Ä‚Č‚˘‚ś‚á‚ńB
Ą‚Ěawk‚ĚŽg‚˘“š‚̓ƒ“ƒ‰ƒCƒi[‚đƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚƒpƒCƒv‚ɍŹ‚ş‚é’ö“x‚Ĺ‚ľ‚ćB
‰´‚́A256”{–{‚Ě’ˇ•ŃƒXƒNƒŠƒvƒg‚đ‚˘‚­‚‚Š‘‚˘‚˝‚Ż‚ǁA
“–Žž‚Í‚Ü‚žperl‚Č‚ń‚ÄŽg‚í‚ę‚Ä‚Č‚Š‚Á‚˝BŽž‘ă‚Şˆá‚¤B

472 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 18:11:52
>>470
‚ť‚ę‚Í•ÎŒŠ‚ž‚ë
autoconf‚Č‚Ç‚Ě”ńí‚ÉŠî–{“I‚Čƒc[ƒ‹‚Ĺ‚ŕPerl‚ŞŽg‚í‚ę‚Ä‚˘‚é‚ľ
openssl‚̂悤‚Éconfigure‚́iŽĺ‚ÉWindows—p‚́jƒ|[ƒ^ƒrƒŠƒeƒB‚đă‚°‚é‚˝‚ß‚É
Perl‚đ—˜—p‚ľ‚Ä‚˘‚é‚ŕ‚Ě‚ŕ‚ ‚é

ŒžŒę‚Ě“KŤ‚đ‚í‚Š‚Á‚˝ă‚Ĺ“KŢ“KŠ‚ĹŽg‚Ś‚΂˘‚˘‚ń‚ž‚ć

473 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 21:08:21
“ú–{‘ŰÜ
u•Äƒxƒ‹Œ¤‹†Š“Á•Ę–ź—_‹ZŽt‚ĚƒfƒjƒXEƒŠƒbƒ`[”ŽŽmi‚U‚Xj‚Ć•ÄƒO[ƒOƒ‹ŽĐ“Á•Ę‹ZŽt‚ĚƒPƒ“Eƒgƒ“ƒvƒ\ƒ“”ŽŽmi‚U‚Vjv

–ˆ“ú‚Š‚ - –ˆ“úV•ˇ‚Ěƒjƒ…[ƒXEî•ńƒTƒCƒg
http://mainichi.jp/select/science/news/m20110126k0000m040012000c.html

474 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 21:29:34
>>471
>Žž‘ă‚Şˆá‚¤B

Žž‘ă‚ĆŒž‚¤ˆÓ–Ą‚ł́AĹ‹ß‚̓fƒtƒH‚Ĺ Python ‚Ş“ü‚Á‚Ä‚˘‚˝‚股‚é‚Ě‚Ĺ
Perl ‚đŽg‚¤‚Č‚ç Python ‚đ‘I‚ń‚ś‚Ⴄ‚ȁB

‚ ‚ń‚Ü‚č‘Ź‚ł‚đ‹Ł‚¤ŽdŽ–‚đ‚ľ‚Ä‚˘‚Č‚˘‚̂ƁAƒƒ“ƒ‰ƒCƒi[‚đ‘‚­Ž–‚Ş
‘˝‚˘‚̂ŁAawk ‚ŕâŽ^‘ĺŠˆ–ô‚ľ‚Ä‚˘‚é‚Ż‚ǁB

Perl ‚ރtƒ‹ƒZƒbƒg‚ĚŒžŒę‚Č‚ç awk ‚Í DSL ‚Ý‚˝‚˘‚Č•¨‚ŁAŒÂl“I‚É‚Í
awk ‚Ě•ű‚Ş‹CˆŔ‚­‘‚Ż‚é‹C‚Ş‚ˇ‚éB

475 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 21:57:07
python‚́AƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĹŽg‚˘‚É‚­‚˘B
-c‚Ĺˆř”‚Éˆę‰žƒRƒ}ƒ“ƒh“n‚š‚é‚Ż‚ǁAƒCƒ“ƒfƒ“ƒg‚Ě–â‘č‚Ş‚ ‚é‚ľA
perl‚Ě-p‚â-n‚Ý‚˝‚˘‚É•W€“ü—Í‚Ěƒ‹[ƒv“n‚š‚Č‚˘‚Š‚çB


476 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 22:04:34
Žż–â‚ł‚š‚ĉş‚ł‚˘

ŽŸ‚̂悤‚ČƒeƒLƒXƒg‚Ş‚ ‚é‚Ć‚ľ‚Ü‚ˇ
aaaaa 10 20 10 5
aaabb 5 10 10 10
aaabb 5 5 5 5
aabaa 5 20 20 30
aabbb 10 10 5 5
bbaaa 10 10 10 10
bbbaa 5 10 10 5
bbbbb 10 5 5 30

‚ą‚ą‚ŁAaaaaa‚Č‚Ç‚ÍŒÂl‚Ě–ź‘O‚Ĺ‚Š‚A3•śŽš–Ú‚Ü‚Ĺ‚ŞŠA4`5•śŽš–Ú‚Ş–ź‘OA‚Ü‚˝”Žš‚ޏo”ď‚ž‚Ć‚ľ‚Ä
Še˘‘Ń‚Ěo”ď‚đo—Í‚ľ‚˝‚˘‚ƍl‚Ś‚Ä‚˘‚Ü‚ˇB

aaa 20 35 25 20
aab 15 30 25 35
bba 10 10 10 10
bbb 15 15 15 35

‚Ć‚Č‚Á‚Ä—~‚ľ‚˘–ó‚Ĺ‚ˇB

477 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 22:18:47
‚ōĄl‚Ś‚Ä‚˘‚é•ű–@‚Ć‚ľ‚Ä‚Í

substr($1,1,3) ‚ŐŠ‚𔝒肾‚Ä
“Ż‚śŠ‚Č‚çA˘‘Ń‚đ‰ÁŽZ‚ľ‚čs‚­
ˆá‚¤Š‚É‚Č‚Á‚˝ƒ^ƒCƒ~ƒ“ƒO‚Ĺ1‚‘O‚Ě‰Ć‚Ě‰ĆŒv‚đ@print@‚ľ‚Ä
‚ł‚ç‚ÉŠeo”ď‚đ‰Šú‰ť‚ˇ‚é
ŽŸ‚̍s‚ɈڂÁ‚Ä“Ż‚ś˘‘Ń‚Č‚ç‰ÁŽZ

‚Ć‚˘‚¤Š´‚ś‚ĹƒXƒNƒŠƒvƒg‚đ‘g‚Ý‚˝‚˘‚ń‚Ĺ‚ˇ‚ލޖ{“I‚Č‚Ć‚ą‚ë‚Ĺ‚â‚č•ű‚Ş•s–Ą‚˘‚Ĺ‚ľ‚傤‚ŠH

478 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/25(‰Î) 22:34:21
˜A‘z”z—ń‚Ć‚Š‚ś‚á‘Ę–Ú‚Č‚Ě‚ŠH

name[$1] += 1

479 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/26(…) 01:13:08
>>476-477
‘S‚ĘA‘z”z—ń‚É—­‚ߍž‚ń‚ŁA ĹŒă‚Ĺˆę‹C‚ɏo—Í‚ľ‚˝•ű‚Ş—Ç‚­‚Č‚˘‚Š?
>>477 ‚Ě•ű–@‚ž‚ƁA o—Í‚đs‚¤‰ÓŠ‚Ş
"Š‚Ş•Ď‚í‚Á‚˝‚Ć‚Ť" ‚Ć "ƒeƒLƒXƒg‚ޏI‚í‚Á‚˝‚Ć‚Ť" ‚É•ŞŽU‚ľ‚Ä‚ľ‚Ü‚¤B

{
    a = substr($1,1,3);
    b[a] += $2;
    c[a] += $3;
    d[a] += $4;
    e[a] += $5;
}
END {
    for (f in e) print f,b[f],c[f],d[f],e[f];
}

480 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/26(…) 20:18:53
>>474
OS(Linux)‚đƒfƒtƒH‚ž‚Ż‚ĹŽg‚¤‚ą‚Ć‚Í‚Ü‚¸‚ ‚č‚Ś‚Č‚­‚āA
‰˝‚Š‚ľ‚ç’ljÁƒpƒbƒP[ƒW‚Ş•K—v‚É‚Č‚é‚Í‚¸‚ž‚Š‚çA
Python‚ރfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚鎖‚ÍŽŔ—p–Ę‚Ĺ•]‰ż‘ÎŰ‚É‚Í‚Č‚ç‚ń‚ĆŽv‚¤B

ŽŠ•Ş‚ÍDebian‚đƒƒCƒ“‚ÉŽg‚¤‚Ż‚ǁAƒCƒ“ƒXƒg[ƒ‹Žž‚ɂ̓x[ƒXƒVƒXƒeƒ€‚ž‚Ż‚đ‘I‚сA
‚ť‚ę‚Ésshd‚Ćruby‚đ’ljÁ‚ˇ‚é‚Ě‚ŞƒfƒtƒH‚Č‚ń‚Ĺ‹C‚É‚Č‚ç‚Č‚˘B
Mac‚Č‚çPython/Ruby‚Ć‚ŕƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚é‚Š‚ç–ł–â‘č‚ž‚ľA
Win‚Č‚ç‚Ç‚ż‚ç‚ŕƒfƒtƒH‚ś‚á“ü‚Á‚Ä‚˘‚Č‚˘‚Š‚ç“Ż‚śB

‚Ü‚˝“úí“I‚ČƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ÉŠÖ‚ľ‚āARuby‚Ěę‡‚ÍˆČ‰ş‚̂悤‚ɃŠƒXƒg\‘˘‚đ
ƒVƒFƒ‹‚ĚƒpƒCƒvƒ‰ƒCƒ“Š´Šo‚ŏ‘‚Ż‚é‚Ě‚ŞŠđ‚ľ‚˘B
@hoge_list.select { |x| ....}.sort { |x,y| .... }.map { |x| .... }.inject(n) {|x, i| .... }
ƒuƒƒbƒN(ƒNƒ[ƒWƒƒ)‚Ě–ł‚˘Pyton/Perl‚ł́A‚ą‚¤‚˘‚Á‚˝‚¨‹CŒy‚ȏ‘‚Ť•ű‚Í‚Ĺ‚Ť‚Č‚˘B

‚ž‚Š‚ç“úí“I‚ČŠˆ–ô“x‚Ĺ”äŠr‚ˇ‚é‚ƁAŽŠ•Ş‚Ěę‡‚́Abash > awk > ruby ‚É‚Č‚éB
Šî–{‚Íbash‚ŁA–Ę“|‚Č•śŽš—ńˆ—‚Ş‚ ‚ę‚Îawk‚đƒƒ“ƒ‰ƒCƒi[‚Ĺ–„‚ߍž‚Ţ‚Ě‚Şƒpƒ^[ƒ“B
‚ŁAFX‚Ć‹@”\‚đ’ljÁ‚ľ‚Ä‚Ť‚ÄbashƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ޏd‰×‚ÉŠ´‚ś‚ç‚ę‚é‚悤‚É‚Č‚čA
‚Č‚¨‚Š‚”ėpŤ‚Ě‚ ‚é(Ä—˜—p‚̉”\Ť‚Ş‚ ‚é)ƒc[ƒ‹‚Ĺ‚ ‚ę‚΁Aˆę‹C‚Éruby‚ɏ‘‚ŤŠˇ‚Ś‚éB

Python‚Í–{Ši“I‚ČŠJ”­‚Ĺ‚ ‚ę‚Î(Ruby‚ć‚č‚ŕ)—D‚ę‚˝–Ę‚Ş‘˝X‚ ‚é‚ĆŽv‚¤‚Ż‚ǁA
(>>475‚ĚŽw“E‚ŕŠÜ‚ß‚Ä)‚¨ŽčŒy‚ł/‚¨‹CŒy‚ł‚ÉŒŔ‚é‚Ć(Ruby‚ć‚č‚ŕ)Žg‚˘‚Ă‚ç‚­Š´‚ś‚éB
‚ŕ‚ż‚ë‚ńbashƒXƒNƒŠƒvƒg(or Makefile)‚É–„‚ߍž‚Ţƒƒ“ƒ‰ƒCƒi[‚Ĺ‚ ‚ę‚΁Aawk ‚ރxƒXƒgB

481 F474‚ś‚á‚Č‚˘‚Ż‚ǁF2011/01/26(…) 21:22:28
>>474‚Ć‘S‚­“Ż‚śˆÓŒŠ‚ž‚íB

‹Ć–ą‚ĹŽg‚¤Ž–‚Ş‘˝‚˘RHEL‚Í—]Œv‚Č•¨‚Í‚Ů‚Ć‚ń‚Ç“ü‚ę‚Ä‚Č‚˘B
PythonAPerl‚ރfƒtƒH‚Ĺ“ü‚Á‚Ă銴‚śB

ĚAUNIX‚đˆľ‚Á‚Ä‚˝ ‚ÍPerl‚Č‚çƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˝‚̂ŁAŠo‚Ś‚悤‚Ć‚ľ‚˝‚Ż‚ÇŒ‹‹Çg‚ɂ‚Š‚¸B
shAsedAawk‚Ĺ‚Ş‚ń‚΂Á‚Ä‚˝B

482 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 00:10:46
>>480
ƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚é‚Ě‚ŞŠđ‚ľ‚˘‚̂́AŽŠ•Ş‚̊‹Ť‚ž‚Ż‚Ĺ‚Č‚­A‘źl‚̊‹Ť‚Ĺ‚ŕ
Žg‚Ś‚鎖‚Ş•ŰŘ‚ł‚ę‚Ä‚˘‚鎖‚ž‚ćB’N‚Š‚ÉŽg‚Á‚Ä‚ŕ‚炤ˆ×‚ĚƒR[ƒh‚đ‘‚­Žž‚ɁA
ƒpƒbƒP[ƒW‚̒ljÁ‚đ‚¨Šč‚˘‚ľ‚Č‚­‚Ä—Ç‚˘‚Ě‚Í‚Ć‚Ä‚ŕŠyB“Á‚ɁA‚ť‚ę‚ŞŽdŽ–‚Ĺ
Žg‚í‚ę‚Ä‚˘‚éŠÂ‹Ť‚Č‚çŽXB

ƒTƒ|[ƒg‚âƒgƒŒ[ƒjƒ“ƒO‚ĚŽdŽ–‚đ‚ľ‚˝Ž–‚Ş‚ ‚él‚Č‚ç—‰đ‚ľ‚Ä‚ŕ‚ç‚Ś‚é‚ĆŽv‚¤B

483 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 03:47:36
AWK‚́ANEC PC-9801‚ĚMS-DOS‚Ĺ‚ŕ‚¤‚˛‚˘‚˝BAWK95.exe‚́A“ú–{Œę‚ɑΉž‚ľ‚Ä‚Č‚˘

484 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 05:04:18
AWK‚ĚŠˆ–ô‚ˇ‚éę–ʂ́A‚â‚Á‚Ď‚čƒeƒLƒXƒgˆ—‚ž‚ĆŽv‚¤B
‚ť‚Ě‚ż‚ĺ‚Á‚Ć•ĄŽG”Ĺ‚Ć‚ľ‚ÄŽg‚¤‚Č‚çPerl‚Š‚ȁB
‘g‚ݍž‚݃‰ƒCƒuƒ‰ƒŠ‚ރeƒLƒXƒgˆ—‚É“Á‰ť‚ľ‚Ä‚é‚Š‚çB

Python‚͐ł‹K•\Œť‚ŞŒžŒę‚É‘g‚ݍž‚Ü‚ę‚Ä‚Č‚Š‚Á‚˝‚č‚Ć
ƒeƒLƒXƒgˆ—‚͎ኹ‚â‚č‚É‚­‚˘ˆóŰ‚Ş‹­‚˘B
‚ť‚Ě•ŞAƒeƒLƒXƒgˆ—ˆČŠO‚Č‚çŒ‹\Žg‚¤‚Ż‚ǂˁB

485 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 05:27:26
>>482
‚ ‚ A‚ť‚ę•Ş‚Š‚é‚íB‹Ć–ąƒ}ƒVƒ“‚Ć‚ľ‚ÄŽg‚¤¤—pUNIX(HP-UX/Solaris/AIX)‚ž‚Ć
Ruby‚Ç‚ą‚ë‚ŠPython/Perl‚ˇ‚çƒfƒtƒH‚ś‚á“ü‚Á‚Ä‚˘‚Č‚˘‚ľA‚ť‚¤‚˘‚Á‚˝
ƒtƒŠ[ƒ\ƒtƒg‚Ě—Ţ‚˘‚ÍŒ´‘Ľ‚Ć‚ľ‚ĈęŘƒCƒ“ƒXƒg[ƒ‹‹ÖŽ~‚Ć‚˘‚¤ŠÂ‹Ť‚ŕ‚ ‚éB
(Web/Mail‚Ć‚˘‚Á‚˝InternetŒnƒT[ƒo‚͕ʂˁB‚ ‚­‚Ü‚Ĺ‹Ć–ąƒ}ƒVƒ“ŒŔ’č‚Ě˜bB)

‚ž‚Š‚珤—pUNIXƒ†[ƒU‚́AƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚éƒc[ƒ‹‚É’ˇ‚Ż‚é‚ą‚Ć‚É‚Č‚éB
‚â‚Á‚Ď‚č–{•¨‚ĚUNIXƒvƒ‚đŽŠĚ‚ˇ‚é‚Ě‚Č‚çApython/ruby‚Ĺ‚Í‚Č‚­sh/awk‚ž‚ľA
emacs/vim‚Ĺ‚Í‚Č‚­viAlatex‚Ĺ‚Í‚Č‚­roff‚đ‘I‚ԂׂŤ‚ž‚ć‚ˁB

486 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 06:50:40
>>484
>Python‚͐ł‹K•\Œť‚ŞŒžŒę‚É‘g‚ݍž‚Ü‚ę‚Ä‚Č‚Š‚Á‚˝‚č‚Ć

‚ցH

487 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 07:07:12
>>486
‚ńHŒžŒę‚É‚Í‘g‚ݍž‚Ü‚ę‚Ä‚Č‚˘‚ž‚ëHƒ‰ƒCƒuƒ‰ƒŠ‚Ć‚ľ‚Ä‘g‚ݍž‚Ü‚ę‚Ä‚é‚ž‚Ż‚ŁB
‚ž‚Š‚琳‹K•\ŒťƒŠƒeƒ‰ƒ‹‚Ć‚Š–ł‚˘‚ľAimport‚Č‚ľ‚É‚ÍŽg‚Ś‚Č‚˘B

488 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 07:10:47
ƒŠƒeƒ‰ƒ‹‚ž‚Ɖ˝‚Š—Ç‚˘‚ą‚Ć‚ ‚é‚́H

489 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 07:13:35
•śŽš—ń‚Šƒpƒ^[ƒ“‚Š‹ć•Ę‚ľ‚₡‚˘B

490 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 07:16:17
‚ ‚ƁAƒ}ƒbƒ`ƒ“ƒO‚Ě•\‹L‚ŞŽŠ‘RB

491 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/27(–Ř) 09:03:47
>>485
Solaris ‚̓fƒtƒH‚Ĺ Perl ‚ŕ Python ‚ŕ“ü‚Á‚Ä‚é‚ć
‚ŕ‚ż‚ë‚ń“ü‚ę‚Č‚˘Ž–‚ŕo—ˆ‚é‚Ż‚Ç

492 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/28(‹ŕ) 15:46:44
>>491
‚ť‚ę‚ÍŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚Ĺ—p“r‚Ć‚ľ‚ăfƒXƒNƒgƒbƒv‚ ‚邢‚̓Cƒ“ƒ^[ƒlƒbƒgƒT[ƒo‚đ
‘I‘đ‚ľ‚˝ę‡‚Ě˜b‚ś‚á‚Č‚˘‚Ě‚Š‚ȁBŠî–{ƒVƒXƒeƒ€‚Éperl/python‚ÍŠÜ‚Ü‚ę‚Ä‚˘‚Č‚˘‚Í‚¸B
‚ť‚ĚŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚ŕŠÜ‚߂ăfƒtƒH‚Ĺ‚ ‚é‚Ć‚ˇ‚é‚Č‚çADebian‚ŕ“Ż‚śB
ƒJƒeƒSƒŠ‚ĹƒfƒXƒNƒgƒbƒv‚đ‘I‚ׂ΁uruby‚ŕƒfƒtƒHv‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚éB(RHL‚Í’m‚ç‚ń)
ŽŠ•Ş‚Í—]Œv‚Č•¨‚Í“ü‚ę‚˝‚­‚Č‚˘‚Š‚çŠî–{ƒVƒXƒeƒ€‚đ‘I‚ń‚Ĺ‚é‚Ż‚ǂˁB

‚‰Â—pŤ‚đ—v‹‚ł‚ę‚éŠîŠ˛‹Ć–ąƒVƒXƒeƒ€‚Ěę‡AŽŠ•Ş‚ÍHP-UX‚đˆľ‚¤ƒP[ƒX‚Ş‘˝‚˘‚Ż‚ǁA
ƒfƒtƒH‚Ĺ‚ÍŠî–{ƒVƒXƒeƒ€‚đ‘I‚ŃŽ–‘O‚ɐ݌v‚ľ‚˝ƒpƒbƒP[ƒW‚Ě‚Ý‚đ’ljÁ‚ˇ‚é‚Ě‚Ş“S‘ĽB
‚Č‚ş‚Č‚çƒ[ƒJ‚ĚƒTƒ|[ƒg‚ŞŽó‚Ż‚ç‚ę‚Č‚˘A‚ ‚邢‚Í‚ ‚Š‚ç‚ł‚Ü‚ÉŒ™‚ČŠç‚đ‚ł‚ę‚é‚Š‚çB
‚ť‚ń‚Ȋ‹Ť‚ž‚ƁAu^‚ɃfƒtƒHv‚Čsh/csh/sed/awk‚Ş‘ĺŠˆ–ô‚ľ‚Ä‚˘‚˝‚股‚éB

493 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/28(‹ŕ) 17:06:59
>>492
Solaris ‚ĚƒfƒtƒHƒ‹ƒg‚Í "Entire Distribution" ‚Ć‚˘‚¤ƒpƒbƒP[ƒW‚ĚƒZƒbƒg‚ž‚ćB
ƒCƒ“ƒXƒg[ƒ‰[‚ĹƒfƒtƒHƒ‹ƒg‚Ĺ‘I‘đ‚ł‚ę‚Ä‚˘‚é‚Ě‚Ş‚ą‚ę‚ž‚ľAƒvƒŠƒCƒ“ƒXƒg[ƒ‹
‚ł‚ę‚Ä‚˘‚é‚Ě‚ŕ‚ą‚ę‚É‹ß‚˘‚ŕ‚́B‚ť‚ą‚É‚Í Perl ‚ŕ Python ‚ŕ“ü‚Á‚Ä‚éB
ƒCƒ“ƒXƒg[ƒ‹‚ˇ‚éŰ‚Ě‘I‘đŽˆ‚Ĺ "Core System" ‚đ‘I‚ׂΠPerl ‚â Python ‚Í
“ü‚ç‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚Ż‚ǁA‚ą‚ę‚đƒfƒtƒHƒ‹ƒg‚ĆŒÄ‚Ô‚Ě‚Í‚ż‚ĺ‚Á‚Ć–ł—‚Ş‚ ‚é‚ĆŽv‚¤‚íB

‚ť‚ę‚ƁAŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚Ć‚ŠƒJƒeƒSƒŠ‚ĹƒfƒXƒNƒgƒbƒv‚Ć‚Š^‚ɃfƒtƒH‚ĆŒž‚Á‚˝•¨‚Í
Solaris ‚É‚Í‘śÝ‚ľ‚Č‚˘BDebian ‚Í’m‚ç‚ńB

494 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/28(‹ŕ) 20:11:40
Solaris2.6‚ ‚˝‚č‚ĚƒfƒtƒH‚ĹPerl‚Í“ü‚Á‚Ä‚˝‹L‰Ż‚Ş‚ ‚éB
15”N‚­‚炢‘O‚ĚHP-UX‚ž‚ĆPerl‚Ş“ü‚Á‚Ä‚Č‚Š‚Á‚˝‹L‰Ż‚ށB

495 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 00:42:19
‰´‚ŕHP-UXƒƒCƒ“‚ž‚Ż‚ÇPerl“ü‚Á‚Ä‚Č‚˘‚í

496 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 00:47:55
Šm‚Š‚ɁASolaris‚ÉŠľ‚ę‚Ä‚˘‚ÄHP-UXŽg‚í‚ł‚ę‚é‚ĆŽg‚˘‚É‚­‚˘‚í[

497 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 07:33:12
‚ĆŒž‚¤‚í‚Ż‚ŁAUN*XƒT[ƒoŠÇ—ŽŇ‚Ěę‡‚Íawk‚đŽg‚Ś‚é‚悤‚É‚Č‚Á‚Ä‚¨‚Ż‚ÎŠÔˆá‚˘‚ ‚č‚Ü‚š‚ń‚ˁB

498 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 10:56:30
ŠÂ‹Ť‚đ‘I‚΂Ȃ˘ƒT[ƒoŠÇ—‚ž‚Á‚˝‚çAsh,grep,sed,tr,cut,paste,sort,uniq‚ ‚˝‚č‚ŁB
nawk‚Ćgawk‚ĚŽd—lˇ‚ŞŒ‹\‚ ‚é‚̂ŁAawk‚ÍŽg‚˘‚É‚­‚˘B

499 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 13:15:51
‚ą‚¤‚˘‚¤˜b‘č‚ĚŽž‚ÉSolaris‚Ć‚ŠHP-UX‚͏o‚é‚Ě‚ÉAIX‚͏o‚Č‚˘ƒCƒ[ƒW

500 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 13:40:55
“ú–{’jŽ™‚Č‚çHI-UXA“Á‚ÉHI-UX/WE2‚ž‚ëBíŽŻ‚â‚Ë

501 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 14:15:09
‚¤‚Ţ

502 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 16:56:12
‚˘‚â‚ą‚ą‚ÍedƒXƒNƒŠƒvƒg‚Ĺ

503 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 18:47:15
Solaris‚́A/usr/bin/awk /usr/bin/nawk /usr/xpg4/bin/awk
3‚•ʁX‚Č‚Ě‚Ş“ü‚Á‚Ä‚˝‹C‚Ş‚ˇ‚é‚ȁB
‚ŁAˆę”Ô‚Ü‚Ć‚ŕ‚Č‚Ě‚Ş3”ԖڂȂ̂ŁA‚ć‚ť‚Š‚玝‚Á‚Ä‚Ť‚˝ƒXƒNƒŠƒvƒg‚́Ać“Ş‚Ě#!‚đ
‘‚ŤŠˇ‚Ś‚Č‚˘‚Ć‚˘‚Ż‚Č‚˘‚Ć‚˘‚¤AƒJƒIƒX‚ȏó‘Ô‚ś‚á‚Č‚Š‚Á‚˝‚ž‚낤‚ŠB

504 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 19:23:53
>>503
ŽŠ•ŞƒAƒJƒEƒ“ƒg‚ĚƒpƒX‚͐^‚Áć‚É /usr/xpg4/bin/‚đŽ‚Á‚Ä‚Ť‚Ä‚˝‚íB

505 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 19:25:17
ƒXƒNƒŠƒvƒg‚đ‘g‚ŢŽž‚Í‚ž‚˘‚˝‚˘ nawk ‚đŽg‚¤
‘źl‚ĚƒXƒNƒŠƒvƒg‚đŠŰƒpƒNƒŠ‚ˇ‚é‹@‰ď‚Ş–ł‚˘‚Ě‚ĹƒJƒIƒX‚ÍŠ´‚ś‚˝Ž–‚Ş–ł‚˘

506 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 19:32:53
>>505
˜b‚Ě—Ź‚ę‚Ş>>497 >>498‚Ȃ̂ŁA‰Â”ŔŤ‚Ş–â‘č‚Č‚ń‚ž‚ćB

507 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/29(“y) 19:39:08
ƒEƒ`‚Í RHEL ‚Ć Solaris ‚ž‚Żl‚Ś‚ę‚Ηǂ˘‚Š‚çAawk ‚Ĺ–â‘č‚Ş‚ ‚鎞‚Í Perl ‚Š Python ‚ĹĎ‚Ü‚ˇ‚í

508 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/01/30(“ú) 05:43:19
#!/usr/bin/env [gn]*awk
‚ž‚ëíl

509 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/01(‰Î) 10:39:45
shebangs‚É /usr/bin/env ‘‚­‚Ě‚Á‚Ä‚ ‚ń‚Ü—Ç‚˘‚ĆŽv‚Ś‚Č‚˘‚ń‚ž‚ć‚Č‚ 
•Ą”‚Ěˆř”‚Ěˆľ‚˘‚Ć‚ŠAŠÂ‹Ť•Ď”‚đ‚ť‚ą‚܂ŐM—p‚ľ‚Ä—Ç‚˘‚ŕ‚Ě‚Č‚Ě‚Š‚Ć‚Š
‚ ‚Ć /usr/bin/ ‚É env ‚Ş‚ ‚é‚ą‚Ć‚Í–{“–‚É•ŰŘ‚Ĺ‚Ť‚é‚Ě‚Š‚Ć‚Š
/bin/sh ‚đ‘‚˘‚˝‚Ů‚¤‚Ş—Ç‚˘‚ń‚ś‚á‚Č‚˘‚Š‚Á‚ÄŽv‚Á‚Ä‚ľ‚Ü‚¤

510 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/01(‰Î) 11:45:20
‚ą‚Ě˜b‘č‚ŕ’č”Ô‚ž‚ȁB‘OƒXƒŒ‚Ě558-564‚Ĺ‚ŕ‚â‚Á‚Ä‚˝‚źB‚Ć‚č‚ ‚Ś‚¸Œ‹˜_‚ž‚Ż‚đˆř—p‚ľ‚Ć‚­‚íB

>’˛‚ׂĂ݂˝‚ç#!‚ɃCƒ“ƒ^[ƒvƒŠƒ^‚Ěˆř”‚đ2‚ÂˆČă—^‚Ś‚˝‚Ć‚Ť‚Ě
>‹““Ž‚ÍOS‚É‚ć‚Á‚ĈႤ‚悤‚ž‚Á‚˝B
>
>FreeBSD4.2: 2‚ÂˆČă‚ ‚Á‚Ä‚ŕ“n‚é(/usrbin/env gawk -f foo)
>Linux(2.6.8): ‹ó”’‚đŠÜ‚ß‚Ä1‚Â‚Ěˆř”‚Ć‚ľ‚Ä“n‚é(/usr/bin/env "gawk -f" foo)
>Soraris(5.8): 2‚Â‚ßˆČ~‚Ěˆř”‚Í–łŽ‹(/usr/bin/env gawk foo)
>
>Œ‹‹Ç/usr/bin/envŽg‚Á‚˝‘‚Ť•ű‚Ígawk‚ĚƒCƒ“ƒXƒg[ƒ‹ˆĘ’u‚̍ˇ‚đ
>‹zŽű‚ľ‚悤‚Ć‚ľ‚Ä‚é‚ń‚ž‚낤‚ށA“Žě‚ÍOS‚É‚ć‚Á‚Ä‚Ä‚ń‚ł΂ç‚΂ç
>‚Č‚Ě‚Ĺ‚ ‚܂肨ŠŠ‚ß‚Ĺ‚Ť‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć‚ž‚낤‚ŠB

511 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/02(…) 00:12:39
ruby ŠEŒG‚Ĺ‚ŕ—Źs‚Á‚Ä‚é‚Č
ˆÓ–Ą‚ŕ”ť‚炸u‚¨‚Ü‚ś‚Č‚˘v‚ĆĚ‚ľ‚ÄŽg‚Á‚Ă邤‚ż‚É
“sŽs“`ŕ‰ť‚ľ‚Ä‚˘‚­‚ń‚ž‚Č

512 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/03(–Ř) 22:33:59
‚Č‚ş gawk ‚É‚Í tr ‚Ş–ł‚˘‚Ě‚ž
tr("‚`-‚y","A-Z")‚Ć‚Š‚ľ‚˝‚˘‚ź

513 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/04(‹ŕ) 03:31:02
‚Â Python

514 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/04(‹ŕ) 09:10:06
>>512

BEGIN {
hankaku="0 1 2 3 4 5 6 7 8 9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z a b c d e f g h i j k l m n o p q r s t u v w x y z "
zenkaku="‚O‚P‚Q‚R‚S‚T‚U‚V‚W‚X‚`‚a‚b‚c‚d‚e‚f‚g‚h‚i‚j‚k‚l‚m‚n‚o‚p‚q‚r‚s‚t‚u‚v‚w‚x‚y‚‚‚‚ƒ‚„‚…‚†‚‡‚ˆ‚‰‚Š‚‹‚Œ‚‚Ž‚‚‚‘‚’‚“‚”‚•‚–‚—‚˜‚™‚š"
}
{
for (i=0; i<length(hankaku); i+=2) {
gsub(substr(hankaku,i+1,1),substr(zenkaku,i+1,2))
}
}


515 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/04(‹ŕ) 09:20:39
‚ť‚ę‚ž‚Ćtr('ab', 'ba')‚Ş‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚ń‚ž‚ć‚Č‚ŸB


516 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/04(‹ŕ) 09:54:40
“Ż‚śŽ–‚ś‚á‚ń


517 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/04(‹ŕ) 19:22:21
”Ä—p“I‚É‚P‚ě‚Á‚Ć‚Ż‚΂˘‚˘‚ś‚á‚ń

518 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/05(“y) 20:23:34
>514‚Ý‚˝‚˘‚Čƒxƒ^‘Ĺ‚ż‚ś‚á‚Č‚­‚Ä

A-Z‚ -‚ń

‚ą‚¤‚˘‚¤•\‹L‚Ĺ’uŠˇ‚ˇ‚é•ű–@‚ ‚éH


519 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/05(“y) 20:37:26
>>518
tr Žg‚Ś‚΁H

520 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/06(“ú) 03:05:39
tr ƒRƒ}ƒ“ƒh‚Á‚Ċ‹Ť‚É‚ć‚Á‚ă}ƒ‹ƒ`ƒoƒCƒg‚Ěˆľ‚˘‚ވá‚í‚ˁHƒEƒ`‚Ěę‡
Ubuntu10.04‚É“ü‚Á‚Ä‚étr(GNU coreutils)7.4‚Í‚Ç‚¤‚â‚ç2•śŽšˆľ‚˘‚É‚ľ‚ż‚Ⴄ‚ç‚ľ‚˘‚Ş
MacOSX10.5‚É“ü‚Á‚Ä‚étriƒo[ƒWƒ‡ƒ“”ť‚ç‚ń‚ŞmanŒŠ‚é‚ĆBSDŒn‚Ű‚˘j‚Í1•śŽšˆľ‚˘‚É‚ľ‚Ä‚­‚ę‚˝

521 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/06(“ú) 05:00:06
UNICODE = •śŽš”
mbcs = ƒoƒCƒg”

522 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/07(ŒŽ) 08:10:44
‚ń[‚ƁA‚Ç‚ä‚ą‚ƁH
gnome-terminal‚̓†ƒjƒR[ƒhÝ’č‚Ě‚Í‚¸‚Č‚ń‚ž‚ށc
‘ź‚É‚â‚ç‚Č‚Ť‚Ⴂ‚Ż‚Č‚˘‚ą‚Ć‚Ş‚ ‚é‚Á‚Ä‚ą‚ƁH

523 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/09(…) 23:11:37
awk++Žg‚Á‚Ä‚él‚˘‚éH
http://awk.info/?doc/dsl/awkplusplus.html

524 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/10(–Ř) 14:20:51
Ĺ‹ßAawk‚Ě‘śÝ‚đ’m‚č‚Ü‚ľ‚˝B
‚˘‚ë‚ń‚ČŒžŒę‚đG‚Á‚Ă͍ÁÜEEEG‚Á‚Ă͍ÁÜEEE‚đŒJ‚č•Ô‚ľ‚Ä‚˘‚Ü‚ľ‚˝B
awk‚͉˝‚Ć‚Č‚­ƒ}ƒXƒ^[o—ˆ‚ť‚¤‚Č‹C‚Ş‚ľ‚Ü‚ˇB
‚ą‚ę‚Š‚çŠć’Ł‚č‚Ü‚ˇII
‚Q‚T‚U”{‚Ě–{‚đĄ‚Í“Ç‚ń‚Ĺ‚¨‚č‚Ü‚ˇB

525 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/16(…) 02:02:44
gawk‚ĹƒtƒB[ƒ‹ƒh‚đƒ\[ƒg‚ľ‚Ä•\ŽŚ‚ľ‚˝‚˘‚ń‚ž‚Ş
{split($0, a);asort(a);for(i=1;i<NF;i++){printf("%s%s", a[i], FS);}printf("%s\n", a[NF]);}
‚ć‚č‚ŕƒXƒ}[ƒg‚Č•ű–@‚ ‚éH

$1`$NF‚Ş“ü‚Á‚˝“ÁŽę”z—ń‚Ý‚˝‚˘‚Č‚Ě‚Ş‚ ‚Á‚˝‚炤‚ę‚ľ‚˘‚Ě‚ž‚ށB

526 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/16(…) 07:22:58
>>525
$i‚Ć‚Š‘‚Ż‚é‚ľ‘ă“ü‚ŕ‚Ĺ‚Ť‚é‚Š‚ç
$1`‚đ•Ű‘ś‚ľ‚Č‚­‚Ä‚˘‚˘‚Ě‚Č‚çAŒă”ź‚Í

for(i=1;i<=NF;i++){$i=a[i]} print

‚Ə‘‚Ż‚΂ż‚ĺ‚Á‚Ć’Z‚­‚Č‚é‚ȁB


527 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/16(…) 12:11:40
>>526
‚Č‚é‚قǁA‚ť‚¤‚Ĺ‚Ť‚é‚Ě‚ŠB‚ ‚č‚Ş‚Ć‚¤B

528 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/17(–Ř) 01:07:36
http://www.kt.rim.or.jp/~kbk/gawk-3.1/ ‚É’u‚˘‚Ä‚ ‚Á‚˝
win32—pgawk‚Ş‚˘‚‚̊ԂɂŠŒöŠJ’âŽ~‚É‚Č‚Á‚Ä‚˘‚˝B

wn32‚Ěgensub‚ŞŽg‚Ś‚Ä“ú–{Œę‚ވľ‚Ś‚āA
‚Š‚Âexe‚݂̂ʼnғŽ‚ˇ‚é‚Ě‚ĹƒCƒ“ƒXƒg[ƒ‹•s—v‚Č‚Ě‚Ş•Ö—˜‚Ĺ
ŒöŽ„‚É‚í‚˝‚Á‚Ĉ¤—p‚ľ‚Ä‚˘‚˝‚̂ŁA”ńí‚ɔ߂ľ‚˘ĽĽĽ


529 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/17(–Ř) 02:14:57
http://www.vector.co.jp/soft/win95/util/se376460.html
Ş‚Ć‚Íˆá‚¤‚́H

530 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/18(‹ŕ) 11:30:36
‚ť‚ę‚͏­‚ľŒĂ‚˘.
gawk-mbcs-win32-20090920.zip ‚ŞŽčŒł‚É‚ ‚é‚Ě‚Ĺ•K—v‚Č‚çÄ”z•z‚ˇ‚é‚Ş?

531 F528F2011/02/19(“y) 01:36:10
>>530
‚ŕ‚ľŽ„‚ÉŒž‚Á‚Ä‚­‚ę‚Ä‚˘‚é‚Ě‚Ĺ‚ ‚ę‚΁A
exe‚Ě‚Ý‚ž‚Ż‚Ç2009/11/24”Ĺ‚ŞŽčŒł‚É‚ ‚é‚̂ŁA
‚ą‚ę‚đŽg‚˘‘ą‚Ż‚悤‚ĆŽv‚¤B‚ ‚č‚Ş‚Ć‚¤B


532 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/19(“y) 08:18:59
‰´‚ĚŽčŒł‚ɁAgawk-mbcs-win32-20091124.zip ‚Ş‚ ‚Á‚˝B
—~‚ľ‚˘l‚Ş‚˘‚āA‚Š‚Ĕz•z‚É–â‘č–ł‚˘‚Ć‚˘‚¤Ž–‚Ş‚í‚Š‚ę‚΂ǂÁ‚Š‚É‚¤‚‚ˇ‚é‚ŞB

‚ľ‚Š‚ľ‚Č‚ń‚Ĺ”z•z‚â‚ß‚ż‚á‚Á‚˝‚ń‚ž‚ë‚ˁB
‚Ç‚ą‚Š‚ç‚Š”qŽŘ‚ľ‚˝ƒR[ƒh‚Ć‚Š‚Ěƒ‰ƒCƒZƒ“ƒX–â‘č‚Č‚Ě‚Š‚ȁH

533 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/19(“y) 22:51:02.65
AWK++‚É‚ć‚éƒIƒuƒWƒFƒNƒgŽwŒü“ü–ĺ
http://ja.wikibooks.org/wiki/AWK%2B%2B%E3%81%AB%E3%82%88%E3%82%8B%E3%82%AA%E3%83%96%E3%82%B8%E3%82%A7%E3%82%AF%E3%83%88%E6%8C%87%E5%90%91%E5%85%A5%E9%96%80

awk++‚Í–Ę”’‚ť‚¤‚ž‚Ż‚ǁAŒťŽŔ‚É‚Íawk‚ĹOO‚đ‚â‚él‚Í‚Ů‚Ć‚ń‚Ç‚˘‚Č‚˘‚ž‚낤B
‚ť‚ŕ‚ť‚ŕawkŽg‚˘‚ÍOO‚đ—‰đ‚Ĺ‚Ť‚Č‚˘‚—îŽŇ‚Ş‚Ů‚Ć‚ń‚Ç‚ž‚ľB
‚Ĺ‚ŕAgawk‚ރfƒtƒHƒ‹ƒg‚ĹOO‚ɑΉž‚ˇ‚ę‚Îawk‚ĹƒIƒuƒWƒFƒNƒgŽwŒü‚ˇ‚él‚ŕ‘‚Ś‚é‚Š‚ŕ‚ˁB

534 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/19(“y) 23:05:51.24
>>533
ƒfƒtƒH‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚éawk‚Ĺ‚Ĺ‚Ť‚é”ÍˆÍ‚Ě‚ą‚Ć‚ľ‚Š‚â‚ç‚Č‚˘‚ć

535 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/20(“ú) 00:59:51.51
“ŻŠ´B„ƒfƒtƒH‚Ĺ‚Ĺ‚Ť‚é”͈Í
’ˇ‚ß‚ĚƒXƒNƒŠƒvƒg‚đ‘‚˘‚˝Ž–‚Ş‚ ‚Á‚˝‚Ě‚ĹOO‚ ‚é‚Ć•Ö—˜‚ĆŽv‚¤‚Ż‚Ç
‚í‚´‚í‚´ƒCƒ“ƒXƒg[ƒ‹‚ˇ‚é‚Č‚çperlArubyApython‚Ş‚ ‚é‚ľ‚Č‚Ÿ


536 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/02/22(‰Î) 10:31:51.00
awk‚ŏ‘‚Š‚ę‚˝awk++‚Á‚Ä‚Č‚˘‚́H

537 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/02(…) 23:14:41.35
gawk‚Ĺ•˝‰ź–źEƒJƒ^ƒJƒi‚Ě•”•Ş‚𔲂Ťo‚ľ‚˝‚˘‚ĆŽv‚Á‚Ä‚Ü‚ˇB
—á‚Ś‚΁uawk‚ɂ‚˘‚ÄŒę‚éƒXƒŒv‚ž‚Á‚˝‚ç
"‚ɂ‚˘‚Ä" "‚éƒXƒŒ" ‚đ•Ď”‚É“ü‚ę‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚˘‚˘•ű–@‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚ŠH

538 F537F2011/03/02(…) 23:17:39.07
u‚ɂ‚˘‚āv‚Ɓu‚éƒXƒŒv‚Í‚ť‚ę‚ź‚ę•Ę‚̕ϐ”‚É“ü‚ę‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇ

539 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/02(…) 23:27:45.29
ƒAƒ‹ƒtƒ@ƒxƒbƒgˆČŠO‚Ě•”•Ş‚ž‚Á‚˝‚çAƒAƒ‹ƒtƒ@ƒxƒbƒg‚đFS‚ÉŽw’č‚ľ‚Äwhile‚ʼnń‚š‚΂˘‚˘‚Ż‚ǁA
ŠżŽš‚ŕ”˛‚­‚Ě‚Í“ď‚ľ‚˘‚ȁB
‚ť‚ę‚ɁAŽ–ŽŔă•Ď”‚Í–łŒŔ‚ɐśŹ‚ˇ‚é‚Á‚ÄŽ–‚ŠB

540 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/02(…) 23:58:57.50
match‚Ě‘ć2ˆř”‚É/[‚ -‚ńƒA-ƒ“]+/‚đŽ‚Á‚Ä‚­‚é‚Ć‚Š?

541 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/03(–Ř) 13:28:46.50
$0,$1...$NF‚đ‰ó‚ľ‚Ä‚ŕ‚˘‚˘‚ń‚ž‚Á‚˝‚çAŽ„‚Č‚ç‚ą‚¤‚ľ‚Ü‚ˇB

gsub‚ĚŒŸő•śŽš“S‚ɂ͐ł‹K•\Œť‚đŽg—p‚ˇ‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚é‚Š‚çA
‚Đ‚ç‚Ş‚Č‚ĆƒJƒ^ƒJƒiˆČŠO‚Ě•śŽš‚đƒXƒy[ƒX‚É’u‚ŤŠˇ‚Ś‚éB

gsub(/[^[‚Ÿ-‚ńƒ@-ƒ“]/," ")

‚Đ‚ç‚Ş‚Č‚ĆƒJƒ^ƒJƒiˆČŠO‚Ě•śŽš‚Í”źŠpƒXƒy[ƒX‚Q‚‚ɒu‚ŤŠˇ‚í‚éB
‚ ‚Ć‚ÍNF‚đŒŠ‚Ä•\ŽŚ‚ľ‚˝‚˘‚悤‚ɏˆ—‚ˇ‚éB

’ˆÓ‚ˇ‚ׂŤ‚́AWindows”ł̐V‚ľ‚˘ƒo[ƒWƒ‡ƒ“‚Ě‚ŕ‚̂ł́A
ł‹K•\Œť‚Ć‚ľ‚āA‚Đ‚ç‚Ş‚Č‚đ ‚Ÿ-‚ń ‚ŁAƒJƒ^ƒJƒi‚đ ƒ@-ƒ“ ‚Ĺ
Žw’č‚Ĺ‚Ť‚Č‚˘‚ŕ‚Ě‚Ş‚ ‚č‚Ü‚ˇB
‚˝‚ľ‚Šƒ}ƒ‹ƒ`ƒoƒCƒgŠg’Ł‚ʼn󂳂ꂽB


542 F537F2011/03/03(–Ř) 14:28:35.14
>541
‚Ü‚žŽŽ‚ľ‚Ä‚Ü‚š‚ń‚ށA—~‚ˇ‚é•śŽšˆČŠO‚đÁ‚ľ‚ăSƒjƒ‡ƒSƒjƒ‡‚ˇ‚ę‚΂˘‚Ż‚ť‚¤‚Ĺ‚ˇB
>539-540‚ł‚ń‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B


543 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/03(–Ř) 19:41:21.36
BEGIN {
str = "ƒfƒ“ƒRŠżŽš‚΂ń‚´‚˘Œł‹Cabcde‚ž‚Š‚ç"
c = split(str, a, "[^[ƒ@-ƒ“‚Ÿ-‚ń]")
for (i = c; i>=1; i--) {
if ( a[i] !~ /^$/ ) { print a[i] }
}
}

544 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/03(–Ř) 19:44:47.65
ƒ{ƒP‚Š‚Ü‚ľ‚˝
4s–Ú‚Í•’Ę‚É
for ( i = 1; i <=c; i++) {
‚ĹOKB

545 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/03(–Ř) 22:55:52.84
c‚đŽc‚ł‚Č‚­‚Ć‚ŕ
for (i in a){if (a[i]) print a[i]}
‚ĹŠÔ‚É‡‚¤‚悤‚ȁB

546 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/04(‹ŕ) 01:04:03.52
for-in‚ž‚Ə‡˜‚Ş•Űá‚ł‚ę‚Č‚˘‚ń‚ś‚á‚Č‚Š‚Á‚˝‚Á‚Ż?

547 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/04(‹ŕ) 08:34:52.75
for ( i = 1; i in a ; i++) ‚Á‚ď‘‚Ť•ű‚ŕ‚Ĺ‚Ť‚é‚ć


548 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 14:14:11.11
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
....

‚̂悤‚ɁAƒtƒB[ƒ‹ƒh”‚ރoƒ‰ƒoƒ‰‚ŁAƒtƒB[ƒ‹ƒh‚ވę’v‚ˇ‚éę‡‚ŕ‚ ‚ę‚Î
ˆę’v‚ľ‚Č‚˘ƒf[ƒ^‚Ş‚ ‚é‚Ě‚Ĺ‚ˇ‚ށAd•Ą‚đ
a1 a2 a3
b1
c1
d1 d2
‚̂悤‚É‚Ü‚Ć‚ß‚ ‚°‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
‚ł‚ˇ‚ނɃOƒO‚Á‚ăRƒsƒy‚Ć‚˘‚¤–ó‚É‚ŕ‚˘‚Š‚¸BBB

549 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 14:31:25.16
>>548
‚˘‚낢‚ë‚â‚č•ű‚Í‚ ‚é‚ĆŽv‚¤‚Ş

awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}'

550 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 14:53:42.21
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚ť‚ę‚ź‚ęA4‚d•Ąƒf[ƒ^‚Ě‚ ‚Á‚˝‚ŕ‚Ě‚Í3‚‚ɁA2‚‚̂ŕ‚Ě‚Í1‚Â‚É‚ĆŒ¸‚Á‚˝‚Ě‚Ĺ‚ˇ‚Ş
‚ť‚ęˆČăŒ¸‚Á‚Ä‚Ü‚š‚ńB“Ż‚śƒRƒ}ƒ“ƒh‚đŒJ‚č•Ô‚ľ‚Š‚Ż‚Ä‚Ý‚˝‚Ě‚Ĺ‚ˇ‚ށA•Ď‰ť‚Í‚Č‚Š‚Á‚˝‚Ĺ‚ˇB

a1 a1 a1 a1
b1 b1 b1
...‚Ě•”•Ş‚Ş
a1 a1 a1
b1 b1
‚É‚Í‚Č‚Á‚˝‚Ć‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
‚ŕ‚¤­‚ľ‚¨‚‚Ť‚ ‚˘‚˘‚˝‚ž‚Ż‚Č‚˘‚Ĺ‚ľ‚傤‚ŠBBB


551 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 15:06:41.15
ŽčŒł‚Ĺ‚Íˆę‚‚ɂȂ邯‚Ç‚Č‚ŸBŒ´—‚Í‚í‚Š‚é‚ž‚낤‚Š‚ç‚ ‚Ć‚Í‚Ş‚ń‚΂ęB
s‚˛‚Ć‚ÉƒtƒB[ƒ‹ƒh‚Ě“YŽš‚ɂ‚˘‚㋁[ƒv‚ˇ‚é‚Ě‚Ć˜A‘z”z—ń‚ŏoŒťƒ`ƒFƒbƒN‚ރLƒ‚B

% cat hoge.txt
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
% awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}' hoge.txt
a1 a2 a3
b1
c1
d1 d2


552 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 15:14:33.26
0610005C13Rik 0610005C13Rik 0610005C13Rik
0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik

‚ą‚¤‚˘‚¤Š´‚ś‚Ě•śŽš—ń‚Č‚ń‚Ĺ‚ˇ‚Ş
a1‚Ć‚Šb1‚Ĺ—á‚Ś‚Ä‚ŕ‘ĺä•v‚ž‚Á‚˝‚Ĺ‚ˇ‚ŠH

553 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 15:38:11.62
‹ó”’‚Ĺ‹ćŘ‚ç‚ę‚˝•śŽš—ń‚Č‚ç‚Č‚ń‚Ĺ‚ŕ‚˘‚˘‚ށA‚ť‚ĚƒŒƒxƒ‹‚ĚŽż–â‚Ş
o‚é‚悤‚ś‚á‚ŕ‚¤‚ˇ‚ą‚ľŠî‘b‚đ•×‹­‚ľ‚Č‚˘‚Ć‚ž‚ß‚Š‚ŕ‚Č‚ŸB

554 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 15:50:13.69
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“Žg—p‚ĚƒTƒ“ƒvƒ‹‚Ĺ–â‘č‚Č‚˘‚ĆŒž‚¤Ž–‚́`
‚t‚m‚h‚wŠÂ‹Ť‚Č‚Ě‚Š‚ȁ`


555 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 15:58:11.87
Mac OSX‚Ěƒ^[ƒ~ƒiƒ‹‚đŽg‚Á‚Ä‚Ü‚ˇB
>>551‚Í‚ť‚Ě‚Ü‚Ü‚¤‚Ü‚­“Ž‚Ť‚Ü‚ľ‚˝B
‚˘‚܏¸‡‚ĹŽč“Ž‚ōě‹Ć‚ľ‚Ä‚Ü‚ˇ‚ށA‚Ü‚žz‚𔲂Ż‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚š‚ńB
‚ŕ‚¤Žč‚Ş‚Â‚č‚ť‚¤‚Ĺ‚ˇ

556 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 16:04:33.75
ˆęs–ě˜Y‚đ•Ş‰đ‚ľ‚ÄƒXƒNƒŠƒvƒg‚É‘g‚Ý’ź‚ľ‚ĘM‚ę‚ΓŽěŠm”Fo—ˆ‚é‚ĆŽv‚¤

557 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 16:21:10.50
‚˘‚Üw‚Ü‚Ĺ‚Ť‚Ü‚ľ‚˝B‚ŕ‚¤‚ž‚ß‚Ĺ‚ˇB
ˆę‰žAƒtƒ@ƒCƒ‹‚đ‚¨‚˘‚Ä‚Ý‚Ü‚ˇBBB
http://www5.puny.jp/uploader/download/1299482386.zip
ƒpƒX‚Í1234‚Ĺ‚ˇB

558 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/03/07(ŒŽ) 17:18:15.93
‚Ü‚ž‚â‚Á‚Ä‚é‚Ě‚Š`
ƒtƒ@ƒCƒ‹‚́@O‚l@‚Ş–â‘č‚Ý‚˝‚˘‚ž‚Š‚ç
‚b‚q‚k‚e‚Ěƒtƒ@ƒCƒ‹Œ`ŽŽ‚É•ĎŠˇ‚ľ‚ďă‚Ěˆęs–ě˜Y‚Ĺ–â‘č‚Č‚˘‚Ý‚˝‚˘‚ž‚Á‚˝‚ćB

559 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/04/19(‰Î) 03:07:46.46
#•Ą”s‚Ě“ü—Í’†Ać‚̍s‚Ě11ƒJƒ‰ƒ€–Ú‚ÉOUT‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚Š‚ÂŽŸ‚̍s‚Ě11ƒJƒ‰ƒ€–Ú‚ÉIN‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é2s‚Ş‘ľ‚Á‚˝ŽžA2s‚đo—Í
$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
prev="";
}


560 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/04/19(‰Î) 15:55:50.78
# 7.awk
NR >= 2{
if($0 ~ /^>'=+/){
if($0 ~ /~$/){
print "A";
}else{
print "NAA";
}
}else if($0 ~ /^>\^(Q=)+/){
if($0 ~ /~~$/){
print "B";
}else{
print "NAB";
}
}else{
print "NAC";
}
}

7.txt
3
>'======#======~
>^Q=Q=Q=Q=Q=Q=Q=Q=~~
>'===#====~
NAA
NBB
NAA@@@‚Ć‚Č‚éB‰˝‚ŁH
A
B
A@@‚Ć‚Č‚Á‚Ä‚Ů‚ľ‚˘‚̂ɁEEEgawk 3.1.7‚Ĺ‚ˇEE


561 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/04/19(‰Î) 16:30:51.01
‰´‚ĚŽčŒł‚Ěgawk 3.1.7‚Ĺ‚ÍŠú‘Ň’Ę‚č‚ĚŒ‹‰Ę‚É‚Č‚é‚Č‚ B

s––‚Ş‚ç‚Ý‚ž‚ƉüsƒR[ƒh‚ވá‚Á‚Ä‚˝‚čŒŠ‚Ś‚Č‚˘‹ó”’‚Ş
“ü‚Á‚Ä‚˝‚č‚Ć‚˘‚¤‚Ě‚Ş‚ć‚­‚ ‚é‚Ě‚ĹŠm”F‚ľ‚Ă݁B

562 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/04/19(‰Î) 16:32:43.45
>>560
‚ ‚Ć

/^>'=+/

‚Á‚ăLƒƒƒvƒ`ƒƒ‚Ć‚Š‚ľ‚Ä‚é‚í‚Ż‚ś‚á‚Č‚˘‚Š‚ç+‚Í–ł‘Ę‚ś‚á‚Č‚˘‚ŠB


563 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/04/19(‰Î) 16:45:20.75
>>561
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B‰üsƒR[ƒh‚đunixŒ`ŽŽ‚É‚ľ‚˝‚ço—ˆ‚Ü‚ľ‚˝B
ĄŒă‚Ć‚ŕ‚ć‚ë‚ľ‚­‚¨Šč‚˘’v‚ľ‚Ü‚ˇB

564 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/04/19(‰Î) 17:00:39.34
>>559

IN‚Ş‚ ‚é‚Ć‚Ť‚É‚ľ‚Šprev‚ރNƒŠƒA‚ł‚ę‚Ä‚˘‚Č‚˘‚Š‚çAOUT‚ޏoŒť‚ľ‚˝ˆČ~‚É
•Ą”s‚ŞŒo‰ß‚ľ‚Ä‚ŕIN‚ޏoŒť‚ˇ‚é‚Ćprint‚ł‚ę‚éƒXƒNƒŠƒvƒg‚É‚Č‚Á‚Ä‚˘‚é‚ćB


565 F559F2011/04/20(…) 01:08:11.06
http://okwave.jp/qa/q6672025.html
‚Ć‚Š‚Ě“ü—Í‚đƒCƒ[ƒW‚ľ‚Ä‚˝‚ŕ‚Ě‚Ĺ...

$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
}
$11!~/OUT/{ prev=""; }


566 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/01(“ú) 16:22:39.39
http://okwave.jp/qa/q6660984.html
#2—ń–Ú‚Ě€–Ú‚Şdisk1`4‚Ü‚Ĺ•s‘Ť•”•Ş‚Ş–„‚Ü‚é‚悤‚É‚ľA•s‘Ť‚ľ‚Ä‚˘‚˝•”•Ş‚Ě1—ń–Ú‚É‚Í‘O‚ĚŽžŠÔA3—ń–Ú‚É‚Í0‚Ĺ–„‚ß‚˝‚˘
BEGIN{ dt=prevDt="00:00:00"; }
NF>=3{ dt=$1; tgt=$2; n=$3; }
NF==2{ tgt=$1; n=$2; }
{ gapDisp(prevTgt,tgt); disp(dt,tgt,n); prevDt=dt; prevTgt=tgt; }
END{ gapDisp(tgt,"disk1"); }

function disp(dt,tgt,n){ print dt, tgt, n; }
function gapDisp(disk,endDisk, cnt)
{
for(cnt=add(getNo(disk)); cnt!=getNo(endDisk); cnt=add(cnt)) disp(prevDt, sprintf("disk%d", cnt), 0);
}
function add(cnt){ return ((++cnt>4)?(1):(cnt)); }
function getNo(disk){ sub(/disk/,"",disk); return disk; }

567 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/01(“ú) 19:40:09.87
BEGIN { reset() }
NF == 2 { $3 = $2; $2 = $1; $1 = last_t }
{ last_t = $1 }
{ if ($2 < last_disk) { p(); reset() } last_disk = $2 }
{ n[$2] = $3 }
{ for(i in n) { if (i >= $2) { t[i] = $1 } } }
END { p() }
function p() {
for (i = 1; i <= 4; i++) {
d = "disk" i
print t[d], d, n[d]
}
}
function reset() {
for (i = 1; i <= 4; i++) {
d = "disk" i
t[d] = t["disk4"]
n[d] = 0
}
}


568 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/03(‰Î) 14:58:05.53
ŠÔˆá‚Á‚Ä‚é‚ć
‚ľ‚Š‚ŕ’ˇ‚­‚Ä”ü‚ľ‚­‚Č‚˘‚ć

569 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/03(‰Î) 15:13:19.32
http://okwave.jp/qa/q6711117.html
...‚ą‚ń‚ČŠ´‚ś‚Š‚Ë‚ĽH@@ awk -f sum.awk ƒf[ƒ^ | sort
----- sum.awk -----
$1!~/¤“X–ź/{ tbl[$1 "," $2]+=$3; }
END{
@for(key in tbl){
@@split(key, item, /,/);
@@print item[1], item[2], tbl[key];
@}
}
-----

570 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/03(‰Î) 15:33:28.80
>>566
NF==3 {
disp();
for(i=1;i<=4;i++) {
disk_time[i]=$1
disk_val[i]=0
}
disk_val[substr($2, 5, 1)]=$3
}
NF==2 {
disk_val[substr($1, 5, 1)]=$2
}
END{
disp()
}
function disp() {
for(i=1;i<=4;i++) {
if(i in disk_time) printf("%s disk%d %s\n", disk_time[i], i, disk_val[i])
}
}

571 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/03(‰Î) 16:12:56.67
BEGIN {
    # ć“Ş‚Ş‚˘‚Ť‚Č‚č "disk2 15" ‚Ě‚Ý‚ĹŽn‚Ü‚Á‚˝‚č‚ľ‚Č‚Ż‚ę‚Î
    # ‚ą‚̏‰Šú‰ť‚Í•s—vB
    a = "00:00:00";
}
NF == 3 {
    if (NR > 1) put();
    a = $1;
    b[$2] = $3;
}
NF == 2 {
    b[$1] = $2;
}
END {
    put();
}
function put(    i) {
    for (i = 1; i <= 4; i++) {
        print a, "disk" i, b["disk" i] + 0;
        b["disk" i] = 0;
    }
}

572 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/03(‰Î) 16:20:05.55
>>569 awk‚Ě”z—ń‚Á‚Ä‚Ç‚ę‚­‚炢Šm•Ű‰Â”\‚Ȃ́H
ć‚Ésort‚ľ‚˝‚ç‚Ç‚¤‚Š‚ȁH sort ƒf[ƒ^ | awk -f sum.awk
----- sum.awk -----
$1!~/¤“X–ź/{ if(store==$1 && item==$2) val+=$3; else{ disp(); store=$1; item=$2; val=$3; } }
END{ disp(); }
function disp(){ if(store!="" || item!="") print store, item, val; }
-----

573 F ”E–@’ŸyLv=40,xxxPTz y“Œ“d 76.6 %z Š”‰żyEz F2011/05/04(…) 17:32:38.53
ƒwƒbƒNƒVƒ‡ƒ“

574 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 00:54:22.24
$ uname -sr
CYGWIN_NT-6.1 1.7.9(0.237/5/3)
$ awk --version
GNU Awk 3.1.8

‚ą‚̊‹Ť‚ŁA
awk 'BEGIN {for(i=j=1;i<50;++i) {print j; j*=10}}'
‚ą‚ęŽŔs‚ˇ‚é‚ƁAj‚Ş23Œ…’´‚Ś‚˝‚ ‚˝‚č‚Š‚çA‚¨‚Š‚ľ‚­‚Č‚é‚ń‚ž‚Ż‚ǁB

awk‚̐Ž”‚Á‚ďăŒŔ‚ ‚é‚́HiƒEƒ`‚ž‚Ż‚ŠHj

575 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 01:09:59.27
long double•Ó‚č‚̐¸“x‚ľ‚Š‚Č‚˘‚ćB

576 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 09:18:39.10
>>574
‚¨‚ę‚Ě‚o‚b‚Ĺ‚Í•’Ę‚É 1 ‚Š‚ç 1e+048 ‚Ü‚Ĺ•\ŽŚ‚ł‚ę‚Ü‚ˇ‚ށBBB

577 F ”E–@’ŸyLv=25,xxxPTz F2011/05/06(‹ŕ) 09:54:18.77
http://ideone.com/QpAMD

578 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 11:30:10.09
>>576
–{“–‚Ĺ‚ˇ‚ŠI‚ć‚ë‚ľ‚Ż‚ę‚Ί‹Ť‚đ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B

>>577
‚ ‚č‚Ş‚Ć‚¤B‚ą‚ąawk‚ŕ’Ł‚ę‚˝‚ń‚žBŒ‹‰Ę‚Ş’ˇ‚ˇ‚Ź‚袂Á‚Ä‚˝‚Ě‚ćB
ł‚É‚ą‚ń‚ČŒ‹‰Ę‚É‚Č‚éB

POSIX‚Ĺ•Űá‚ł‚ę‚Ă鐸“x‚Í>>575‚Á‚Ä‚ą‚ƁH
‚Ä‚ą‚Ƃ́Aawk‚Í“ŕ•”‚ł́A‘S‚Ă̐”‚Şdoubleˆľ‚˘‚Ȃ́H

579 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 14:20:04.87
>>578
576‚Ĺ‚ˇBWindowsXP + GNU Awk 3.0.6 + multi-byte extension 1.15 ‚Ĺ‚ˇB


580 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 18:58:28.81
>>579
‚ ‚č‚Ş‚Ć‚¤B
‚ ‚Ü‚čˆá‚˘‚Ş‚Č‚˘‚ȁBWin7‚ÍŠÖŒW‚Č‚˘‚ž‚낤‚ľB
multi-byte extension‚Ş‚ť‚Ě•Ó‚č‚ŕ˜M‚Á‚Ä‚˘‚é‚Ě‚Šc

‚ť‚¤‚˘‚Ś‚΁A1e+048‚Ý‚˝‚˘‚ČŽw”‚Ĺ•\ŽŚ‚ł‚ę‚é‚́H
o—Í‚Ě‚Ć‚ŤŠŰ‚ß‚é‚Š‚çA‚ż‚á‚ń‚ĆŒvŽZ‚Ĺ‚Ť‚Ä‚é‚悤‚ÉŒŠ‚Ś‚é‚Ě‚Š‚ȁB

581 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/06(‹ŕ) 23:07:48.20
awk‚ł͐”’l‚Í‚ˇ‚ׂÄdouble‚Ĺˆľ‚˘‚Ü‚ˇB
‚Ĺ‚ˇ‚Š‚ç‚ť‚̐¸“x‚Ĺ‚ ‚é53bit•ŞA‘ĺ‘Ě15Œ…‚ż‚ĺ‚Á‚Ć‚đ’´‚Ś‚é‚ƐłŠm‚Č’l‚đ•ŰŽ‚Ĺ‚Ť‚Ü‚š‚ńB

23Œ…‚ ‚˝‚č‚܂Őł‚ľ‚­•\ŽŚ‚Ĺ‚Ť‚Ä‚é‚Á‚Ä‚Ě‚Í‚ć‚­‚í‚Š‚č‚Ü‚š‚ń‚ށA
3.0.6‚É‚ľ‚Ä‚ŕo—ÍŽž‚̏‘ŽŽŽw’č‚Şˆá‚¤‚ž‚Ż‚Ĺ“ŕ•”“I‚É‚Í“Ż‚ś‚悤‚É•słŠm‚Č’l‚É
‚Č‚Á‚Ä‚ľ‚Ü‚Á‚Ä‚é‚ĆŽv‚˘‚Ü‚ˇB


582 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/07(“y) 01:38:55.53
‚ž‚Š‚çAŽŔŽżlong double‚̐¸“x‚É‚Č‚Á‚Ä‚˘‚é‚ń‚ž‚Á‚Ă΁B

583 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/07(“y) 11:11:15.94
>>582
uŽŔŽżv‚Ć‚˘‚¤‚Ě‚Í‚Ç‚¤‚˘‚¤ˆÓ–Ą?

#define AWKNUM double

‚Á‚Ä‚Ě‚Ş‚ ‚é‚ľAlong double ‚É‚ľ‚Ä‚ŕ‰ź”•”‚Í64bit‚ž‚Š‚ç23Œ…‚É‚Í‘Ť‚č‚Č‚˘‚ć?
x87‚ĚƒŒƒxƒ‹‚ĹŠg’Ł¸“x‚É‚Č‚Á‚Ä‚Ä‚ŕA•\ŽŚ‚â‚ç‚Č‚ń‚â‚炡‚é‚Ć‚ą‚ë‚Ĺ”{¸“x‚É
ŠŰ‚ß‚ç‚ę‚ż‚Ⴄ‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB


584 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/07(“y) 13:09:06.68
http://codepad.org/4GaxJcGp
ŠŽ‘S‚Ɉę’vB‚Ç‚¤ŒŠ‚Ä‚ŕ double ‚Ĺ‚ˇB–{“–‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝

585 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/07(“y) 21:19:09.46
>>581
‚ ‚¤A‚ť‚¤‚Č‚Ě‚Š[B‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB˘‚Á‚˝‚Č‚ŸB
10i‚ĹŽŔ”ˆľ‚Ś‚Ć‚Ü‚Ĺ‚ÍŒž‚í‚Č‚˘‚Ż‚ǁAŽ”‚Í—~‚ľ‚˘B
”‚đ‚˘‚ë‚ń‚ČŒ^‚Ĺˆľ‚Ś‚鏈—Œn‚Č‚ń‚Ä‚Č‚˘‚ŠB

586 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/07(“y) 23:01:38.63
>>583
‚ [Along double‚ĆŒž‚Á‚˝‚Ě‚ŞŮ‚Š‚Á‚˝‚ˁB10‚Ě™p‚Ěę‡‚ÍŽŔŽżdouble‚đ‘ĺ‚Ť‚­‰z‚Ś‚˝¸“x‚É‚Č‚Á‚Ä‚˘‚é‚ĆŒž‚˘‚˝‚Š‚Á‚˝B

10‚Í2‚Ć5‚̐ςž‚Š‚çA10”{‚đŒJ‚č•Ô‚ˇ‚Ć‚Ť‚ɉź”•”‚Í5”{‚¸‚‚ɂľ‚Š‚Č‚ç‚Č‚˘B
IEEE‚Ědouble‚̐¸“x‚ž‚Ć5‚Ě22ć‚Ĺ53ƒrƒbƒg‚đŽg‚˘‰Ę‚˝‚ˇ‚̂ŁA‚ť‚ą‚Ü‚Ĺ‚ÍŒëˇ‚ސś‚ś‚Č‚˘B
Œž‚˘Šˇ‚Ś‚ę‚΁A10‚Ěę‡‚Í53ƒrƒbƒg+22ƒrƒbƒgA‘Ś‚ż75ƒrƒbƒg•Ş¸“x‚Ş‚ ‚é‚悤‚ÉŒŠ‚Ś‚éB

‚Ü‚ŸA>584‚đ10”{‚ś‚á‚Č‚­‚Ä5”{‚É‚ľ‚āAdouble‚đlong long‚É‚ľ‚Ä%.f‚đ%llx‚É‚ľ‚ărƒbƒg”‚𐔂Ś‚Ä‚Ý‚ę‚΂킊‚é‚Ĺ‚ľ‚ĺB

587 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/09(ŒŽ) 21:13:05.37
gawk‚Ěƒ†[ƒUƒKƒCƒh‚ɁA‘ź‚̏ˆ—Œn‚ł́A•W€ƒGƒ‰[‚đŽg‚¤‚˝‚߁A
@print "Serious error detected!" | "cat 1>&2"
‚Ć‚˘‚¤•ű–@‚ľ‚Š‚Č‚˘‚Ć‚ ‚č‚Ü‚ˇB
gawk‚Í/dev/stderr‚đ“Á•Ę‚Ɉľ‚¤‚˝‚߁A
@print "Serious error detected!" > "/dev/stderr"
‚Ə‘‚­‚Ě‚Ş“KŘ‚Ć‚ ‚č‚Ü‚ˇB

‚ą‚ę‚ɂ́A‚ǂ̂悤‚Čˆá‚˘‚Ş‚ ‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
/dev/stderr‚Ş‚ ‚éOS‚Č‚çAcat‚ĚƒvƒƒZƒX‚ސśŹ‚ł‚ę‚é‘ź‚́Aˆá‚˘‚Í‚Č‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
ŠÂ‹Ť‚⏈—Œn‚đ–â‚킸“Žě‚ł‚š‚˝‚˘‚Č‚çAă‚̏‘‚Ť•ű‚Ě•ű‚Ş‚ć‚˘‚Ě‚ŠA‹C‚É‚Č‚Á‚Ä‚˘‚Ü‚ˇB

‚ć‚ë‚ľ‚­‚¨Šč‚˘‚ľ‚Ü‚ˇB

588 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/10(‰Î) 00:17:11.81
‘ź‚̏ˆ—Œn‚Á‚āA‘ź‚Ěawk‚Á‚ÄŽ–‚ž‚ćB

/dev/stderr‚Ş‚ ‚éOS‚Á‚ÄŽ–‚Ŕ‚á‚Č‚­‚āA
gawk‚Í“ÁŽę‚Čƒtƒ@ƒCƒ‹–ź‚Ć‚ľ‚Ä/dev/stderr‚Ć‚ŠŽg‚Ś‚é‚ćA‚Á‚ÄŽ–‚ž‚ćB

‚Č‚Ě‚Ĺ‘ź‚ĚOS‚Ĺ‚ŕ gawk ‚ž‚Á‚˝‚çprint‚Ć‚Š‚̏o—͐ćƒtƒ@ƒCƒ‹–ź‚Ć‚ľ‚Ä /dev/stderr Žg‚Ś‚é‚Á‚Ęb‚ž‚ˁB
/dev/stderr‚Ć‚Š‚đƒTƒ|[ƒg‚ľ‚Ä‚˘‚Č‚˘gawkˆČŠO‚Ěawk‚Ĺ‚ŕ“Žě‚ł‚š‚é‚Č‚ç ƒpƒCƒv‚Ć"cat 1>&2"‚đŽg‚¤•ű–@‚ľ‚Š‚Č‚˘B‚ށAWinŒn‚Ícat‚ž‚Ć...

589 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/10(‰Î) 09:20:21.36
‚ť‚ą‚Ü‚Ĺ‚Ě‚ą‚Ć‚đ‚ˇ‚é‚Č‚çPerl/Ruby/Python“™‚Ě‚ż‚á‚ń‚Ć‚ľ‚˝
ƒXƒNƒŠƒvƒgŒžŒę‚ŏ‘‚˘‚˝•ű‚Ş‚˘‚˘‚ń‚ś‚á‚Č‚˘‚Š‚ȁB‚ą‚¤‚˘‚¤
‚Ç‚¤‚Ĺ‚ŕ‚˘‚˘‚Ć‚ą‚ë‚Ĺ”Y‚Ü‚Č‚­‚ÄĎ‚Ţ‚ćB

awk‚Íawk‚ĹŽčŒy‚ɏ‘‚Ż‚é”ÍˆÍ‚Č‚ç‘ź‚̒ǐ‚đ‹–‚ł‚Č‚˘‚ĆŽv‚¤‚Ş
‚ť‚Ě˜g‚đ‚͂ݏo‚悤‚Ć‚ˇ‚é‚Ć“r’[‚É‘ĺ•Ď‚É‚Č‚éB‚ť‚ą‚ŞŠy‚ľ‚˘‚Ć
‚˘‚¤‚Ě‚Č‚ç–ł—‚É‚ÍŽ~‚ß‚Č‚˘‚Ż‚Çw



590 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/10(‰Î) 14:35:51.09
>>589
‚ť‚¤A‚ť‚ę‚ŞŠy‚ľ‚˘‚ń‚ž

591 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/11(…) 00:36:20.77
>>588
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
cat‚Ş‚Č‚˘ŠÂ‹Ť‚ž‚ƁA‚Ç‚¤‚ľ‚悤‚ŕ‚Č‚˘‚Ĺ‚ˇ‚ˁc

>>589
ƒRƒ“ƒ}‹ćŘ‚č‚Ěƒf[ƒ^‚đAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ŏˆ—‚ľ‚Ä‚˘‚˝‚̂ŁA
‚ť‚ę‚đawk‚ɈڐA‚ľ‚Ä‚˘‚Ü‚ľ‚˝Bˆę”ÔŽčŒy‚ž‚Á‚˝‚Ě‚Ĺ‚ˇB

‚ż‚Ȃ݂ɁA2ŽžŠÔ”źˆČă‚Š‚Š‚Á‚Ä‚˘‚˝ˆ—‚ށA1•ŞˆČ“ŕ‚É’Zk‚ł‚ę‚Ü‚ľ‚˝B
ƒƒ‰ƒ^B@@@ƒƒ‰ƒ^c

592 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/11(…) 10:19:43.16
C‚ŏ‘‚Ť’ź‚ľ‚˝‚琔•b‚ĹŽŔsŠŽ—š‚Ě—\Š´‚—

593 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/11(…) 12:14:45.46
‚[‚Ä‚ŕawk‚Ć‚Š‚ť‚Ě‘ź‚ĚƒXƒNƒŠƒvƒg‚ĹƒTƒNƒb‚Ə‘‚Ż‚é‚悤‚Č•śŽš—ńˆ—‚đ
CŒžŒę‚Ć‚Š‚Ĺ‚Í‚ ‚ń‚Ü‚č‘‚Ť‚˝‚­‚Č‚ç‚ń‚ĆŽv‚¤‚źw

594 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/24(‰Î) 10:19:27.54
‚Č‚č‚Ü‚š‚ń

595 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/25(…) 20:17:22.02
‚ ‚Ÿ‚ ‚ ‚Ÿ‚Ÿ‚Ÿ```–ł—‚ž‚Á‚˝‚ŠAA–ł—‚Č‚Ě‚Š[Ia[0][0] = 1 ¨ syntax error

596 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/25(…) 21:58:46.38
>>595
gawk‚Ěę‡ƒCƒ“ƒfƒbƒNƒX‚đSUBSEP(=\034‚ރfƒtƒHƒ‹ƒg)‚đ‹˛‚ń‚ĹƒVƒŠƒAƒ‰ƒCƒY‚ľ‚˝ƒCƒ“ƒfƒbƒNƒX‚Ĺ‘˝ŽŸŒł”z—ń‚đ•\Œť‚ˇ‚é
a[0,0] = 1;
‚Č‚çOK‚Ě‚Í‚¸B‚ą‚Ě‚Ć‚Ť‚ĚƒCƒ“ƒfƒbƒNƒX‚Í"0\0340"‚ž‚Š‚çAa["0\0340"] == 1B

597 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/26(–Ř) 18:46:04.99
>>596
‚ ‚č‚Ş‚Ć‚¤BŽn‚ß‚Š‚ç‚ť‚ę‚đˆÓŽŻ‚ľ‚ď‘‚˘‚Ä‚˝‚ç‚ć‚Š‚Á‚˝‚ń‚ž‚Ż‚ǂˁB

god["name"] = "Kaname Madoka"
god["msg"] = "Mahoushoujo ha watashi dakede juubun dayo."
homerun["name"] = "Akemi Homura"
homerun["msg"] = "Madoka ha watashi no yome."
‚ą‚ń‚Č•—‚ɏ‘‚˘‚Ä‚˘‚˝‚Ě‚đA

puella_magi["god"] = god
puella_magi["homerun"] = homerun
‚Ý‚˝‚˘‚ɂ܂Ƃ߂悤‚Ć‚ľ‚˝‚çA‚ ‚΂΂΂Î

awk‚Ě”z—ń‚Á‚ďˆ—Œn‚É‚ć‚Á‚Ä‚Í“Y‚ŚŽš‚ސŽ”‚Ěę‡Aˆ—‚ŞĹ“K‰ť‚ł‚ę‚Ä‘‚­‚Č‚Á‚˝‚股‚é‚Ě‚Š‚ȁH
\‘˘‘Ě‚Ě‘ă‚í‚č‚Ý‚˝‚˘‚ÉŽg‚˘‚˝‚Š‚Á‚˝‚Ě‚ž‚ށB

598 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/27(‹ŕ) 00:57:28.69
name["god"] = "Kaname Madoka"
msg["god"] = "Mahoushoujo ha watashi dakede juubun dayo."
name["homerun"] = "Akemi Homura"
msg["homerun"] = "Madoka ha watashi no yome."

‚Ĺ‚ć‚­‚ˁH

599 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/30(ŒŽ) 21:25:51.88
awk‚Á‚Ä *‚Ç‚ĚŽŔ‘•‚Ĺ‚ŕ* ˆę“x‚ŕŽg‚Á‚˝‚ą‚Ć‚Ş‚Č‚˘•Ď”‚Ě“ŕ—e‚Á‚āAƒXƒJƒ‰‚Č‚ç0‚Š""‚É‚Č‚Á‚Ä‚é‚́H
•Ď”‚ވę“x‚ŕ‘ă“ü‚ł‚ę‚Ä‚˘‚Č‚˘‚ą‚Ƃ𔝒股‚é‚˝‚߂ɁA(x==0 && x=="")‚Á‚ď‘‚˘‚ĉ˝‚Š–â‘č‚Č‚˘H

600 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/30(ŒŽ) 21:31:52.21
>>599
•]‰ż‚ł‚ę‚é‚Ć‚Ť‚ɕϐ”‚Ş‘śÝ‚ľ‚Č‚Ż‚ę‚΍쐬‚ł‚ę‚éB‚Í‚¸
”z—ń‚Ě—v‘f‚Č‚ç in ‚Ĺ’˛‚ׂç‚ę‚é‚Ż‚Ç
•Ď”ŽŠ‘Ě‚Ć‚Č‚é‚Ć‚Ç‚¤‚ž‚낤‚Ë

601 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/30(ŒŽ) 21:32:47.76
>>599
‰˝“x‚ŕ‘ă“ü‚ľ‚˝ŒăAĹŒă‚É 0 or "" ‚đ‘ă“ü‚ľ‚˝•Ď”‚Ć‹ć•Ę‚Ĺ‚Ť‚Č‚˘B

602 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/30(ŒŽ) 23:19:06.92
>>600-601
‚ ‚č‚Ş‚Ć‚¤B‹ć•Ę‚Ĺ‚Ť‚Č‚˘‚Á‚āA‚Ç‚¤‚˘‚¤ó‘Ô‚É‚Č‚é‚́H0‚đ‘ă“ü‚ľ‚˝‚ç0‚Š"0"‚É•]‰ż‚ł‚ę‚éB
‚ ‚ A""‚đ‘ă“ü‚ľ‚˝‚ç0‚Š""‚É•]‰ż‚ł‚ę‚Ä‘Ę–Ú‚Á‚Ä‚ą‚Ć‚ŠIH

603 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/31(‰Î) 00:05:27.97
‚ ‚ęHŽŽ‚ľ‚˝‚ç‚Ç‚Á‚ż‚đ‘ă“ü‚ľ‚Ä‚ŕ599‚ĚŽŽ‚Í0‚É•]‰ż‚ł‚ę‚˝‚ćB‹ć•Ę‚Ĺ‚Ť‚Č‚˘ƒP[ƒX‚Á‚Ä‚Ç‚¤‚˘‚¤ę‡H

604 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/31(‰Î) 06:28:27.99
BEGIN {
    # ‰Šú‰ť’źŒă (–˘Žg—p) ‚̕ϐ”‚͐”’l (0) ‚Ć•śŽš—ń ("") ‚Ě—ź•ű‚ĚŒ^‚đŽ‚ÂB
    print x == 0, x == ""; # —ź•ű‚Ć‚ŕ^

    x = 0;
    print x == 0, x == ""; # ‘OŽŇ‚̂ݐ^B

    x = "";
    print x == 0, x == ""; # ŒăŽŇ‚̂ݐ^B

    # ‘ź‚Ě–˘Žg—p‚̕ϐ”‚đ‘ă“ü‚ˇ‚é‚Ć "Ä‰Šú‰ť" ‚Ĺ‚Ť‚éB
    x = y;
    print x == 0, x == ""; # —ź•ű‚Ć‚ŕ^B
}

605 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/05/31(‰Î) 22:57:53.71
> ‰Šú‰ť’źŒă (–˘Žg—p) ‚̕ϐ”‚͐”’l (0) ‚Ć•śŽš—ń ("") ‚Ě—ź•ű‚ĚŒ^‚đŽ‚ÂB
IEEE Std 1003.1 ‚Ě awk ‚Ě EXTENDED DESCRIPTION ‚Ě
Variables and Special Variables ‚ɏ‘‚˘‚Ä‚ ‚é‚ˁB uninitialized value ‚Ć‚˘‚¤‚ç‚ľ‚˘B
POSIX‚ɏ€‹’‚ľ‚Ä‚éawk‚Č‚ç‚ą‚¤‚Č‚é‚Ý‚˝‚˘‚ž‚Ż‚ǁAƒIƒŠƒWƒiƒ‹‚Í’m‚ç‚ńB

Ä‰Šú‰ť‚ˇ‚é‚Č‚ç$(NF+1)Žg‚¤‚Ů‚¤‚Ş‚˘‚˘‚Š‚ŕ‚ˁB–˘Žg—p‚̕ϐ”‚đ—pˆÓ‚ľ‚Č‚­‚Ä‚˘‚˘B
‚ž‚Ż‚ǁA‚ť‚ę‚Ş•K—v‚ȏę–Ę‚ŞŽv‚˘•‚‚Š‚΂Ȃ˘‚ށB

ŠÖŒW‚Č‚˘‚Ż‚ǁAabsŠÖ”‚Á‚Ä‚Č‚˘‚ń‚ž‚ˁB•Ę‚É—Ç‚˘‚Ż‚ǁAƒÎ‚âA
0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”‚Í’č‹`‚ľ‚Ä‚Ä‚Ů‚ľ‚˘‚Č‚ B

606 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/02(–Ř) 10:09:14.37
>>605
> Ä‰Šú‰ť‚ˇ‚é‚Č‚ç$(NF+1)Žg‚¤‚Ů‚¤‚Ş‚˘‚˘‚Š‚ŕ‚ˁB–˘Žg—p‚̕ϐ”‚đ—pˆÓ‚ľ‚Č‚­‚Ä‚˘‚˘B
ƒtƒB[ƒ‹ƒh•Ď”‚͏í‚É•śŽš—ńŒ^‚ŁA ”’lŒ^‚ÍŽ‚˝‚Č‚˘B

607 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/02(–Ř) 22:47:31.10
ƒÎ‚Íatan2(0,-1)‚Ĺ‚˘‚˘‚Ć‚ľ‚Ä
u0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”v‚Á‚Ä‚Ç‚¤’č‹`‚ľ‚Ä‚˘‚ÂŽg‚¤‚Ě?

608 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/03(‹ŕ) 13:48:37.95
u0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”v‚Ć‚˘‚¤‚Ě‚Ş‰˝‚đŠó–]‚ľ‚Ä‚˘‚é‚Š‚É‚ć‚éB
ˆČ‰ş‚Ě3Ží—Ţ‚Ş‚ ‚éB

(1) ĹŹ‚̐ł‚Ě”ńł‹K”
(2) ĹŹ‚̐ł‚̐ł‹K”
(3) 1.0‚É‘Ť‚ľ‚ÄŠŰ‚ß‚˝Œ‹‰Ę‚Ş1.0‚ć‚č‘ĺ‚Ť‚­‚Č‚éĹŹ‚̐”

609 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/03(‹ŕ) 23:58:11.26
>>606
‚ ‚ż‚áI‚ť‚¤‚Ĺ‚ľ‚˝B$‚Ĺ–ß‚é‚Ě‚Í•śŽš—ń‚ž‚Á‚˝B
‚ť‚ĚŽd—l‘“Ç‚ń‚Ĺ‚é‚ƁANF‚đŠg’Ł‚ľ‚˝‚Ć‚ŤAŒłX‚Č‚Š‚Á‚˝Š‚Íuninitialized value‚É‚Č‚é‚Á‚Ä‚ ‚Á‚˝‚̂ŁB

>>607
‚ť‚ę‚Ĺ‚˘‚˘‚ń‚ž‚Ż‚ǁAPI‚Ć‚Š‚ĹŽQĆ‚Ĺ‚Ť‚˝‚ç‚ŕ‚Á‚Ć‚˘‚˘A‚ĆŽv‚Á‚˝‚Ě‚Ĺ‚ˇB
>>608
”’lŒvŽZ‚Ě‚˝‚߂ɁAC‚ĚDBL_EPSILON‚Ě‘ă‚í‚č‚É‚Č‚é’萔‚Ş—~‚ľ‚˘‚ȂƁB
”CˆÓ‚̐¸“x‚ĹŠŰ‚ß‚ç‚ę‚éŠÖ”‚ŕ‚Č‚˘‚Ĺ‚ˇ‚ľB

610 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/04(“y) 09:41:48.63
DBL_EPSILON‚Ş>>608‚Ě(1)`(3)‚Ě‚Ç‚ę‚Š‚í‚Š‚ç‚Č‚˘H
”’lŒvŽZ‚ĚŠî–{‚Č‚ń‚ž‚ށB

611 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/10(‹ŕ) 21:49:33.34
•Ď”–ź‚ȂǁAŽŠ‘O‚Ĺ‚ ‚Á‚Ä‚ŕ‹K‘Ľ‚đˆÓŽŻ‚ľ‚Ä‚˘‚é•ű‚˘‚Ü‚ˇ‚ŠH
awk‚ž‚ƁA‚b•—‚ވę”Ę“I‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
ˆę”ԍŏ‰‚ŞVBA‚ž‚Á‚˝‚̂ŁA’ˇ‚˘–ź‘O‚ĆČ—Ş‚ŞŹ‚´‚Á‚Ä‚ľ‚Ü‚Á‚Ä
ŽŠ•Ş‚ĹƒCƒ‰ƒCƒ‰‚ľ‚Ä‚˘‚Ü‚ˇB
‚Ý‚Č‚ł‚ń‚́A’ʏí‚̕ϐ”‚Í‚ą‚¤A”z—ń‚Í‚ą‚¤A’萔‚Í‚ą‚¤A•śŽšŒ^‚Í‚ą‚¤ĽĽĽ
‚Ć‚˘‚¤‚ŕ‚Ě‚đŽQl‚É‚ľ‚˝‚˘‚Ĺ‚ˇB


612 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/10(‹ŕ) 22:10:28.97
>>611
ƒVƒXƒeƒ€ƒnƒ“ƒKƒŠƒAƒ“‚đĚ—p‚ˇ‚é‚Š‚Ç‚¤‚Š”Y‚Ţ‚Ů‚Ç‘ĺ‚Ť‚Č‚ŕ‚Ě‚đawk‚ŏ‘‚˘‚˝‚ą‚Ć‚Ş–ł‚˘

613 F‚Š‚ ‚˝F2011/06/13(ŒŽ) 18:37:34.88
A5‚Č‚í‚â‚ ‚Ó‚§t( ())

614 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/15(…) 21:51:26.93
>>611
’xƒŒƒX‚ž‚ށAŒ^_“ŕ—e‚Ěŕ–ž_–ź‘O‚Ý‚˝‚­‚ľ‚Ä‚éB–ź‘O‚Şˆę•śŽš‚ž‚Ć‚ť‚Ě‚Ü‚Ü‚ž‚Ż‚ǁB
ƒOƒ[ƒoƒ‹•Ď”‚Ćƒ[ƒJƒ‹•Ď”‚Ě‚Ç‚Á‚ż˜M‚Á‚Ä‚é‚Ě‚Š•Ş‚Š‚č‚₡‚˘‚悤‚ɁAƒ[ƒJƒ‹•Ď”‚Í•K‚¸l‚ĹŽn‚ß‚é‚悤‚É‚ľ‚Ä‚éB
d_per_shouhizei = 5.0‚Ć‚Š‚ˁB

615 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/20(ŒŽ) 18:37:26.17
gawk‚ĹBINMODE‚đÝ’股‚ę‚΃oƒCƒiƒŠ[‚Ě“üo—Í‚Ş‚Ĺ‚Ť‚é‚Ě‚Í‚í‚Š‚é‚Ě‚Ĺ‚ˇ‚ށA
“ü—Í‚ł‚ę‚˝ƒoƒCƒiƒŠ[‚đ16iƒ_ƒ“ƒv‚ľ‚Ä•\ŽŚ‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
od“™‚ĚŠO•”ƒRƒ}ƒ“ƒh‚đŽg‚¤ˆÓŠO‚É•ű–@‚Ş‚ ‚ę‚΂¨‹ł‚Ś‚­‚ž‚ł‚˘B

616 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/06/20(ŒŽ) 19:17:07.50
printf("%02x\n", $1);

617 F“VŽg ŸuL5esZLBSE F2011/07/05(‰Î) 00:15:13.83
“ń“x‚Ć˜b‚Š‚Ż‚ń‚Č‚ć
‚¨‘O‚ç‚Á‚Ä‚Ç‚¤‚Ý‚Ä‚ŕƒSƒ~‚ž‚ć‚Č


618 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/07/06(…) 14:04:55.24
ƒSƒ~‚ń‚Č‚ł‚˘

619 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/07/14(–Ř) 23:55:15.84
>>595
gawk4.0.0‚Ĺa[0][0]=1‚ŕ‰Â”\‚É‚Č‚Á‚˝‚ś‚á‚Č‚˘‚Š

620 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/07/30(“y) 19:46:15.81
’´‰SŽŇ‚ĚŽż–â‚Ő\‚ľ–ó‚ ‚č‚Ü‚š‚ńBˆČ‰ş‚̂悤‚Čƒf[ƒ^‚đ
aaa 10
bbb 20
ccc 30
aaa 30
bbb 30
aaa 15
ccc 30
ddd 20
ˆČ‰ş‚̂悤‚É‚Ü‚Ć‚ß‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚Ç‚¤‚ľ‚˝‚炢‚˘‚Ĺ‚ľ‚傤‚ŠH
aaa 55
bbb 50
ccc 60
ddd 25

621 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/07/30(“y) 19:53:38.97
ddd 20 ‚Ĺ‚Í‚Č‚˘‚Š‚ĆŽv‚¤‚Ş‚ą‚ń‚ČŠ´‚ś‚Š‚Č
awk '{a[$1]+=$2} END {for (b in a) {print b " " a[b]}}' | sort

622 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/07/30(“y) 23:15:27.52
Gawk4‚Č‚çPROCINFO["sorted_in"]‚̐ݒč‚ĹĹŒă‚Ěsort‚Ş—v‚ç‚Č‚­‚Č‚é

623 F620F2011/07/30(“y) 23:22:20.03
>621
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇI‚¤‚Ü‚­‚˘‚Ť‚Ü‚ľ‚˝B

624 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/07/31(“ú) 15:24:48.76
gawk‚Í‚ŕ‚¤•ĘŒžŒę‚ČƒCƒ[ƒWB•’imawkŽg‚Á‚Ä‚é‚Ć

625 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/16(‰Î) 22:48:21.64
‚ą‚ą‚Á‚Đś‚Ť‚Ä‚Ü‚ˇ‚ŠH

626 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/18(–Ř) 01:56:26.63
ś‚Ť‚Ä‚Ü‚ˇ‚ń

627 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/19(‹ŕ) 00:53:44.39
ś‚Ť‚Ä‚˘‚é‚ą‚Ć‚đŠč‚Á‚ÄŽż–â‚đB
WIN32‚ĚEXEˆę‚‚ŁA‰ş‚ĚTEST.AWK‚ރ}ƒgƒ‚‚É“Ž‚­AWK‚đ’T‚ľ‚Ä‚˘‚Ü‚ˇB
‚ą‚ę‚çˆČŠO‚É‚ ‚č‚Ü‚ˇ‚ŠH

http://hinadori.atnifty.com/~wills/program/gawkm115.zip
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/376460/pack/win95/util/text/awk/gawk-mbcs-win32-20051223.zip?ds
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/80308/pack/win95/util/text/awk/mw32r27.lzh?ds

Cygwin”Ĺ‚ŕŽŽ‚ľ‚˝‚Ě‚Ĺ‚ˇ‚ރ_ƒ‚Ĺ‚ľ‚˝B

TEST.AWK
{ gsub("[0-9]","x",$0) ; gsub("ż","ƒ\",$0) ; gsub("T","‚s",$0) ; print }

TEST.DAT
ą˛ł´ľśˇ¸šşťź˝žż
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT

628 F627F2011/08/19(‹ŕ) 01:00:20.60
TEST.DAT‚́A‹ó”’‚Ş“ü‚Á‚Ä‚˘‚Ü‚ˇB
ęƒuƒ‰‚Ěƒ|ƒbƒvƒAƒbƒv‚đƒRƒsƒy‚ľ‚ĉş‚ł‚˘B

629 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/19(‹ŕ) 06:26:54.92
ƒEƒ`‚É‹A‚Á‚Ä‚Š‚ç’˛‚ׂĂ݂é‚ć

630 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/19(‹ŕ) 11:02:41.54
>>627|628
cygwin‚Ěawk(GNU Awk 3.1.8)‚Ĺ“Ž‚­‚Ż‚ǁA‚Ç‚¤‚Č‚é‚Í‚¸‚Ş‚Ç‚¤“Ž‚Š‚Č‚˘‚ĆŒž‚Á‚Ä‚˘‚é?
>627‚Ětest.dat‚Č‚çA“–‘Ruƒ\v‚ž‚Ż‚Ş•ĎŠˇ‚ł‚ę‚é‚Ż‚ǁB

631 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/19(‹ŕ) 11:55:06.25
iCygwin‚Č‚çUTF8‚ś‚á‚Č‚˘‚Ć‚¤‚Ü‚­“Ž‚Š‚Č‚˘‚Ż‚ǁjShift JIS‚Ĺ“Žě‚ł‚š‚˝‚˘‚Á‚Ä‚ą‚Ć‚Š‚ȁH
Ž–‘O‚ÉTEST.DAT‚đnkf -w‚É’Ę‚ľ‚˝‚ç‘Ę–Ú‚Š‚ȁB

632 F629F2011/08/19(‹ŕ) 21:59:57.43
>>627
ƒXƒNƒŠƒvƒg‚ŕDAT‚ŕSJIS‚ĹŽŽ‚ľ‚˝‚Ż‚ǁAă‹L3‚‚̂¤‚żAgawk-mbcs-win32-20051223.zip‚̓_ƒ‚ž‚Á‚˝‚ćB
1s–Ú‚Ş‚ą‚ń‚Č‚ń‚Č‚éB

ąxx´ľśˇ¸xşťxxxƒ\

ŽčŽ‚ż‚Ě
GNU Awk 3.1.7(windows special Nov 24 2009)
‚ŁA--ctype=SJIS‚â‚Á‚Ä‚ŕ“Ż‚śŒ‹‰Ę‚É‚Č‚é‚ˁB

ƒXƒNƒŠƒvƒgADAT‚đUTF-8‚É‚ľ‚āA--ctype=UTF8‚â‚Á‚ăŠƒ_ƒCƒŒƒNƒg‚ľ‚˝ƒtƒ@ƒCƒ‹‚͐łí‚ČŒ‹‰Ę‚ޏo‚é‚ćB
ƒŠƒ_ƒCƒŒƒNƒg‚ľ‚Č‚˘‚ĹƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚É•\ŽŚ‚ł‚š‚é‚Ɖť‚Ż‚é‚Ż‚ǁB

633 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/19(‹ŕ) 23:18:25.14
EUC‚Ȃ生ŠpƒJƒi‚ŕ‚¤‚Ü‚­‚â‚Á‚Ä‚­‚ę‚é‚ń‚ž‚ށc

634 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/24(…) 08:07:37.54
gawk‚̓Kƒ“ƒKƒ“‹@”\‚đŠg’Ł‚ľ‚Ä‚é‚Ż‚ǁA
‚ť‚ë‚ť‚ëOOP‘Ήž‚ľ‚Ä‚­‚ę‚Č‚˘‚Š‚ȁB
awk++‚Ć‚Š‚ ‚é‚Ż‚ǁA•W€‚ĹOOP‚Ĺ‚Ť‚ę‚Í•Ö—˜B

635 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/24(…) 22:44:37.24
> OOP
...‚ŕ‚Í‚âawk‚Ĺ‚â‚éˆÓ–Ą‚Ş–ł‚˘w ‘ź‚É‚˘‚­‚ç‚Ĺ‚ŕ‚ ‚é•Ę‚ĚŒžŒę‚Ĺ‚˘‚˘‚ś‚á‚ń

636 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 01:14:17.45
awk‚ɍ݂é‚Ć•Ö—˜‚Š‚ŕ‚ĆŽv‚¤‚Ě‚ÍŽQĆ’l‚­‚炢‚Š‚Č

”z—ń‚âŠÖ”‚Ö‚ĚŽQĆ‚đ’l‚Ć‚ľ‚ÄŽć‚čo‚ľŠi”[‚ľ‚˝‚č
‹t‚É‚ť‚Ě’l‚Š‚çŒł‚Ě”z—ń‚ɃAƒNƒZƒX‚ľ‚˝‚čŒł‚̊֐”‚đŒÄ‚ń‚ž‚čo—ˆ‚é‚Ć
‘Š“–‚É•ĄŽG‚Čƒf[ƒ^\‘˘‚Ş•\Œť‰Â”\‚É‚Č‚éA‚ť‚ę‚ą‚ťOOP‚Á‚Ű‚˘‚ą‚Ć‚ŕ‰Â”\‚ž‚ľ

‚Ĺ‚ŕ‚ ‚ń‚Ü‚č‚â‚â‚ą‚ľ‚˘‚ą‚Ć‚â‚é‚Č‚çPerl‚Ĺ‚˘‚˘‚Š‚ç•K{‚Ĺ‚Í‚Č‚˘‚Ë

637 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 02:28:23.99
> ŠÖ”‚đŒÄ‚ń‚ž‚č

•Ď”‚Ě’l‚đŠÖ”–ź‚Ć‚ľ‚Ä
var = "sage";
@var();
‚Á‚Ä‚Ĺ‚Ť‚é‚Ż‚ǁA‚ť‚ę‚Ć‚Íˆá‚¤‚Ě‚ńH




638 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 04:07:56.67
‚¨‚ćA‚ŕ‚¤‚ ‚é‚Ě‚Šw
Ĺ‹ß‚Ěawk‚Í•Ş‚Š‚ç‚Ë‚Śc‚Á‚Ä‚ą‚Ƃ́A”z—ń‚Ö‚ĚŽQĆ‚đŽg‚Á‚Ä“ü‚ęŽq‚Ě”z—ń‚Ć‚ŠŠů‚ɍě‚ę‚ż‚á‚Á‚˝‚股‚é‚Ě‚ŠH

639 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 10:56:54.36
”z—ń‚Ě”z—ń‚͍ě‚ę‚é‚ćBgawk4‚Č‚çB

640 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 19:51:33.84
iL_TMjĚ°Ý

641 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 20:52:51.07
class human {
@@property name
@@property sex
@@property age
@@method new(x, y, z) {
@@@@name = x
@@@@sex = y
@@@@age = z
@@}
@@method say() {
@@@@printf("Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB\n",name, age, sex)
@@}
}
class japanese : human {
@@property name
@@property sex
@@property age
@@method say() {
@@@@printf("Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB\n", name, age, sex)
@@}
}
BEGIN {
@@alice = human.new("ƒAƒŠƒX", "—", 11)
@@taro = japanese.new("‘ž˜Y", "’j", 15)
@@yuka = japanese.new("—R‰Ŕ", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()
}

642 F641F2011/08/25(–Ř) 20:58:10.41
>>635
http://code.google.com/p/lawker/source/browse/fridge/lib/bash/awk%2B%2B/
‚ą‚ę‚đŽg‚Ś‚΂ą‚Ě’ö“x‚ĚOOP‚Í‚Ç‚¤‚É‚Š‚Ĺ‚Ť‚éB
–{“–‚É‚ą‚Ě’ö“x‚Ĺ‚˘‚˘‚Š‚çOOP‚ɑΉž‚ľ‚Ä‚Ů‚ľ‚˘B
Žg‚¤l‚Í‚Ů‚Ć‚ń‚Ç‚˘‚Č‚˘‚ĆŽv‚¤‚ށA‘S‚­‚Ĺ‚Ť‚Č‚˘‚Ě‚ŕ˘‚éB

643 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/25(–Ř) 22:07:53.46
‚ť‚ę‚ÍĹ‘awk‚Ĺ‚ ‚é•K—v‚Ş‘S‚­–ł‚˘

644 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/26(‹ŕ) 06:00:04.19
function Human(self,name,sex,age) {
self["property___name"] = name
self["property___sex"] = sex
self["property___age"] = age
self["method___say"] = "Human___say"
}
function Human___say(self) {
printf "Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB\n", self["property___name"], self["property___age"], self["property___sex"]
}

function Japanese(self,name,sex,age) {
Human(self,name,sex,age)
self["method___say"] = "Japanese___say"
}
function Japanese___say(self) {
printf "Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB\n", self["property___name"], self["property___age"], self["property___gender"]
}

function methodcall(obj,methodname, m) {
m = obj["method___" methodname]
@m(obj)
}

BEGIN {
Human(alice, "ƒAƒŠƒX", "—", 11)
Japanese(taro, "‘ž˜Y", "’j", 15)
Japanese(yuka, "—R‰Ŕ", "—", 18)
methodcall(alice,"say")
methodcall(taro,"say")
methodcall(yuka,"say")
}

645 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/26(‹ŕ) 06:01:35.02
‚˛‚ß‚ńˆę•”gender‚É‚Č‚Á‚Ä‚é‚Š‚çsex‚É’ź‚ľ‚Ć‚˘‚Ä

‚Ć‚č‚ ‚Ś‚¸A‚ą‚ń‚ČŠ´‚ś‚Ĺgawk4‚Ĺ‚ŕOOPŽŠ‘Ě‚Ío—ˆ‚é‚ć‚Á‚Ęb

646 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/27(“y) 15:07:17.61
>>644
‚Č‚é‚قǂˁ[
‚Ć‚Ä‚ŕ•×‹­‚É‚Č‚č‚Ü‚ˇ

‚Ĺ‚ŕA‚â‚Á‚Ď‚čOOP—p‚̍\•ś‚ŞŽg‚Ś‚ę‚΃xƒXƒg‚Ĺ‚ˇ‚Ë
‚ť‚Ě‚Ů‚¤‚Ş‚í‚Š‚č‚₡‚˘‚ĆŽv‚˘‚Ü‚ˇ

647 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/27(“y) 15:58:44.09
‚â‚Á‚Ď•ĘŒžŒęŽg‚¤‚ׂŤ‚ž‚ë

648 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/27(“y) 16:10:36.72
–{“–‚É—~‚ľ‚˘‚ń‚Č‚çAgawk‚ĚML‚É‚ą‚¤‚ˇ‚ę‚ÎOOPŽŔŒť‚Ĺ‚Ť‚é‚ą‚Ć‚đ”­ŒŠ‚ľ‚˝‚ń‚ž‚Ż‚ǁA
‚ą‚ę‚Ě“œˆß\•ś‚đ—pˆÓ‚ľ‚Ä‚­‚ę‚Á‚Ä“Še‚ˇ‚é‚Ć‚˘‚˘‚ń‚ś‚á‚Ë
switch‚ŕŽŔ‘•‚ł‚ę‚Ä‚é‚ľA—~‚ľ‚˘l‚Ş‹‚é‚Ć•Ş‚Š‚ę‚Εt‚Ż‚Ä‚­‚ę‚é‚Š‚ŕ‚ć

649 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/27(“y) 16:25:08.65
#! /usr/bin/env python
# -*- coding: utf-8 -*-

class human:

@@def __init__(self, name, sex, age):
@@@@self.name = name
@@@@self.sex = sex
@@@@self.age = age

@@def say(self):
@@@@print("Ž„‚Í" + self.name + "B" + str(self.age) + "Î‚Ě" + self.sex + "‚Ĺ‚ˇB")

class japanese(human):

@@def __init(self):
@@@@super(human, self).__init__(self)

@@def say(self):
@@@@print("Ž„‚Í" + self.name + "B" + str(self.age) + "Î‚Ě" + self.sex + "‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB")

if __name__ == "__main__":

@@alice = human("ƒAƒŠƒX", "—", 11)
@@taro = japanese("‘ž˜Y", "’j", 15)
@@yuka = japanese("—R‰Ŕ", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()

650 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/27(“y) 16:26:25.23
python‚ŏ‘‚˘‚Ä‚Ý‚é‚ƁA
>>641‚Ć”ä‚ׂé‚Ć“Á‚É‚í‚Š‚č‚₡‚˘‚í‚Ż‚Ĺ‚ŕ‚Č‚˘‚Ż‚Ç
>>644‚ć‚č‚Í‚í‚Š‚č‚₡‚˘

651 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/08/27(“y) 16:53:49.92
‚ť‚č‚áawk‚ÍOOPL‚Ĺ‚Í‚Č‚˘‚Š‚ç‚Č
‚ ‚­‚Ü‚ĹƒVƒFƒ‹‚Ě‚¨‹Ÿ‚Ĺ‚˘‚˘‚ĆŽv‚¤‚ń‚ž
‚ť‚ľ‚Ä‚ť‚ą‚ɍ‚“x‚ČOOP‹@”\‚Í—v‚é‚Ć‚ÍŽv‚Ś‚Č‚˘
‚Ç‚ż‚ç‚Š‚ĆŒž‚Ś‚΃tƒB[ƒ‹ƒh’Šo‚Ć‚Š‚đ‚ŕ‚Á‚Ć•Ö—˜‚É‚ˇ‚ׂŤ‚ž‚ć

652 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/17(“y) 15:34:39.29
cygwinˆČŠO‚Ĺgawk4.0‚đwindows‚ĹŽg‚¨‚¤‚ĆŽv‚Á‚˝‚çAƒoƒCƒiƒŠ‚Í‚Ç‚ą‚Ĺ“üŽč‚Ĺ‚Ť‚ŕ‚¤‚ˇ‚Š‚ˁH

653 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/17(“y) 16:28:58.78
cygwin ‚Ĺ‘Ę–Ú‚Č——R‚Ş•Ş‚Š‚ç‚Č‚˘‚Š‚ç‹ł‚Ś‚ç‚ę‚Č‚˘B

654 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/18(“ú) 08:02:36.95
>>652
‚Âhttp://www.klabaster.com/progs/gawk32.zip

655 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/19(ŒŽ) 13:00:55.06
>654 ‚ł‚ń‚­‚ˇ‚ą

>653 awk‚ĚŽŔsŒ`ŽŽ‚ž‚Ż“üŽč‚ˇ‚ę‚Ηǂ˘‚悤‚É‚ľ‚˝‚˘‚Ě‚łB

656 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/19(ŒŽ) 14:01:43.39
ƒoƒCƒiƒŠŒÝŠˇ‚ĚWindows‚Ȃ̂ɁAcygwin‚Äexe‚đ‚ŕ‚Á‚Ä‚­‚ž‚Ż‚ś‚áŽg‚Ś‚Č‚˘‚́H

657 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/19(ŒŽ) 16:07:37.39
•¨‚É‚ć‚Á‚Ä‚ÍŽg‚Ś‚˝‚悤‚Č‹C‚Ş‚ˇ‚éB
cygwin1.dll‚ž‚Á‚ŻH‚ɃpƒX‚Ş’Ę‚Á‚Ä‚ę‚Αĺ‘ĚŽg‚Ś‚˝‚悤‚Č‹C‚Ş‚ˇ‚éB

658 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/09/19(ŒŽ) 17:00:12.76
Œ‹\‘ňŽR‚Ědll‚Ş—v‚é‚ć
ƒRƒ}ƒ“ƒh‚É‚ć‚é‚Ż‚Ç

659 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/10/24(ŒŽ) 01:55:49.24
‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B‰pŒę“žˆÓ‚Ȑl

http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
‚́@asort(), asorti()‚ĹŽg‚¤ƒ†[ƒU[’č‹`‚Ě”äŠrŠÖ”‚ɂ‚˘‚Ä
3”Ô–Ú‚Ěˆř”‚ĆPROCINFO["sorted_in"]‚ɐݒ股‚é‚Ě‚Ćˆá‚¤‚Ě‚Š“Ż‚ś‚Č‚Ě‚ŠH

‚ť‚ę‚Ć
http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
‚ɏ‘‚˘‚Ä‚ ‚é3”Ô–Ú‚Ěˆř”‚Ěŕ–ž("descending"‚Ć‚Š)‚Ş—ź—§‚ľ‚Ä‚ń‚́H

660 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/10/24(ŒŽ) 11:34:13.18
http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
As with PROCINFO["sorted_in"], this argument may be the name of a user-defined function, ....

http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
The third argument can also be a user-defined function name ....
‘ćŽOˆř”‚Ě’l‚Ć“Ż–ź‚̊֐”‚Ş’č‹`Ď‚Ý‚Č‚ç‚ť‚ę‚đ—˜—p‚ˇ‚é‚Ć‚ŠA
‚ť‚¤‚˘‚¤•ű–@‚Ĺ‹ć•Ę‚ľ‚Ä‚é‚ń‚ś‚á‚Č‚˘‚Ě

661 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/10/24(ŒŽ) 13:33:04.59
>>659
”äŠrŠÖ”‚Ě—^‚Ś•ű‚ÍPROCINFO["sorted_in"]‚Ěę‡‚Ć“Ż‚ś‚Á‚Ä‚ą‚Ć‚ž‚ëB

ŽŠ•Ş‚Ĺ’č‹`‚ľ‚˝ŠÖ”‚Ě–ź‘O‚Ĺ‚ŕ‚˘‚˘‚ľA11.2.1.2‚ɏ‘‚˘‚Ä‚ ‚é‚悤‚É‚ˇ‚Ĺ‚É—pˆÓ
‚ł‚ę‚Ä‚˘‚é@`‚đŽg‚Á‚Ä‚ŕ‚˘‚˘B



662 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/11/14(ŒŽ) 21:59:05.28
ŒÂl“I‚ɂ́AGAWK‚É‚Í‚ ‚ƁAC‚ŏ‘‚˘‚˝ŠÖ”‚ĚŒÄ‚Ńo‚ľ‚Ć‚˘‚¤‚Š
GAWK‚ĹŒÄ‚ÔŠÖ”‚đC‚ŏ‘‚Ż‚é‹@”\‚Ş—~‚ľ‚˘‚ĆŽv‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁA
‚ą‚ąŒŠ‚éŒŔ‚萢ŠÔ“I‚É‚Í‚ ‚ń‚Ü‚čŽů—v‚Č‚˘‚ń‚Š‚Ë‚ĽB

‚Ü‚ŸA‚ť‚ę‚â‚é‚­‚炢‚Č‚çGAWKŽŠ‘Ě‚É•ĎX‚đ‰Á‚Ś‚čăRƒ“ƒpƒCƒ‹‚ľ‚ë‚Á‚Ä‚ą‚Ć‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁB

663 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/11/15(‰Î) 01:44:31.01
P‚Ć‚ŠRŽg‚ŚŒž‚í‚ę‚é‚ĆŽv‚¤B

664 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/11/15(‰Î) 01:58:32.43
>>662
ttp://www.gnu.org/s/gawk/manual/html_node/Dynamic-Extensions.html
‚ś‚áƒ_ƒHŤ—ˆ“I‚É‚ł‚ç‚ÉŠg’Ł‚ł‚ę‚é‰Â”\Ť‚Í‚ ‚é‚Ý‚˝‚˘‚ž‚Ż‚Ç

665 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/12/09(‹ŕ) 00:35:09.18
Ĺ‹ßawkcard‚đ’m‚Á‚čŔ‰E‚É’u‚˘‚Ä‚é‚Ě‚ž‚ށA“ú–{Œę”Ĺ‚Á‚Ä‘śÝ‚ˇ‚é‚Ě‚ž‚낤‚ŠB

666 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/12/22(–Ř) 16:57:35.32
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_271
‚ą‚ą‚ɏ‘‚˘‚Ä‚ ‚é’Ę‚č‚É‚ľ‚Ä‚ŕ“ú–{Œę‚É–|–ó‚ł‚ę‚Ü‚š‚ń
‚Ç‚¤‚ľ‚Ä‚Ĺ‚ˇ‚ŠH
ŠÂ‹Ť‚Í LinuxMint12 A GNU Awk 3.1.8 ‚Ĺ‚ˇ

667 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/12/22(–Ř) 18:01:49.60
>>666
‚ť‚Ě’Ę‚č‚É‚â‚Á‚˝‚ĆŒž‚¤‚Ě‚Č‚çA‰˝ŒĚpoƒtƒ@ƒCƒ‹‚đ’ńŽŚ‚ľ‚Č‚˘‚Ě‚Š‚ˁAƒ_ƒ~ƒAƒ“ŒNB

668 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/12/22(–Ř) 18:07:45.38
>>667
po‚͍쐬‚ľ‚Ü‚ľ‚˝‚ľAmo‚ŕŠ’č‚ĚƒfƒBƒŒƒNƒgƒŠ‚É‚ ‚č‚Ü‚ˇB
po‚ÍŽŠ•Ş‚Ĺ•ŇW‚ľ‚Ä‚ŕA‚ť‚ĚƒTƒCƒg‚Ě“ŕ—e‚đƒRƒsƒy‚ľ‚Ä‚ŕƒ_ƒ‚Ĺ‚ľ‚˝B

$ cat gettext.po
#: gettext.awk:10
msgid "********** Count Prime Number **********"
msgstr " ‘f”‚𐔂Ś‚é "

#: gettext.awk:14
msgid "2 is a prime number."
msgstr "2 ‚Í‘f”‚Ĺ‚ˇB"

#: gettext.awk:24
msgid "%d is a prime number.\n"
""
msgstr "%d ‚Í‘f”‚Ĺ‚ˇB\n"

$ ls ja_JP/LC_MESSAGES/
gettext.mo

669 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2011/12/22(–Ř) 18:10:02.43
Œ‹‰Ę‚Í‚ą‚Ě’Ę‚č‚Ĺ‚ˇB

$ LC_ALL=ja_JP gawk -f gettext.awk 10
********** Count Prime Number **********
2 is a prime number.
3 is a prime number.
5 is a prime number.
7 is a prime number.

670 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/01/12(–Ř) 13:56:36.33
‚¸‚˘‚Ô‚ńawk‚Š‚ç—Ł‚ę‚Ä‚˘‚Ä‹v‚ľ‚Ô‚č‚ÉŽg‚Á‚˝‚ç
nawk‚É“ú–{Œę‚ĚƒoƒO‚Ş‚ ‚é‚ą‚Ć‚É‚ľ‚΂炭‹C‚Ă‚Š‚Č‚Š‚Á‚˝
substr()‚Ĺutf-8‚ĚƒeƒLƒXƒg‚đŘ‚čo‚ˇ‚Ć‚¨‚Š‚ľ‚Č’l‚É‚Č‚é
gawk‚Ĺ‚Í’ź‚Á‚Ä‚˘‚é

671 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/01/12(–Ř) 19:50:49.28
‚ť‚ŕ‚ť‚ŕUTF-8‚ɑΉž‚ľ‚Ä‚˝‚Á‚Ż

672 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/01/13(‹ŕ) 00:28:07.37
ttp://blog.livedoor.jp/corbie/archives/cat_94960.html
Žc”O‚Č‚Ş‚çAƒVƒtƒgJISAUTF-8—ź•ű‚Őłí‚É“Žě‚ľ‚ť‚¤‚ČWindows”Ĺgawk‚ÍŒó•â‚Ě’†‚É‚ ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B

673 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/01/13(‹ŕ) 07:52:50.95
Linux‚Ĺ‚Í•’Ę‚É“Ž‚­‚ށc

674 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/04/29(“ú) 21:07:39.93
ƒtƒ@ƒCƒ‹–ź‚Ş"*.txt"‚Ěˆę——‚đŽć“ž‚ˇ‚é‚Ć‚ŤA"\.txt"‚Ĺƒ}ƒbƒ`‚ł‚š‚é‚ƁA”CˆÓ‚Ěˆę•śŽš.(ƒhƒbƒg)‚ƉđŽß‚ł‚ę‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇ‚ށA‚˘‚˘•ű–@–ł‚˘‚Ĺ‚ľ‚傤‚ŠH

675 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/04/29(“ú) 22:04:14.36
GNU Awk 3.1.7‚ž‚Ćƒhƒbƒg‚Ƀ}ƒbƒ`‚ľ‚˝‚Ż‚Ç‚ť‚ŕ‚ť‚ŕawk‚Ě˜bH
‹ď‘Ě“I‚ɃRƒ}ƒ“ƒh‚Ş‚Ů‚ľ‚˘‚Č

676 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/04/29(“ú) 22:08:23.01
ş˜a‚̍ Šo‚Ś‚˝ƒAƒZƒ“ƒuƒ‰‚ĆCŒžŒę
‚ą‚ę‚Ş‚ ‚Á‚˝‚Š‚ç
‚˘‚Ü‚ž‚ÉŽŠ•Ş‚Ş‘š‚Č‹ĆŠE‚ŔтđH‚Á‚Ä‚é

677 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/04/29(“ú) 22:36:10.83
>>676
‚ť‚ą‚Š‚ç‚Š‚‚–‚‚ɍs‚Á‚ăXƒ}ƒzƒAƒvƒŠŠJ”­‚Č‚ç‚ŕ‚¤ˆę‰Ôç‚˘‚˝‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ë‚—

678 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/04/29(“ú) 23:09:38.43
”nŽ­‚É‚Í–ł—

679 F674F2012/04/30(ŒŽ) 18:07:43.22
>>675
ls | awk '{ if( match($0,"\.txt") > 0) print $0 }'
Ş‰ďŽĐ‚ĚƒT[ƒoă‚Ĺ‚ą‚ń‚ČŠ´‚ś‚Ě‚ą‚Ć‚â‚낤‚Ć‚ľ‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށA
ugawk: Œx: ƒGƒXƒP[ƒvƒV[ƒPƒ“ƒX `\.' ‚Í `.' ‚Ć“Ż“™‚Ɉľ‚í‚ę‚Ü‚ˇv
‚ĆƒƒbƒZ[ƒW‚ޏo—Í‚ł‚ęAƒhƒbƒg‚Ş”CˆÓ‚Ěˆę•śŽšH‚ƉđŽß‚ł‚ę‚袂Á‚Ä‚˘‚Ü‚ľ‚˝‚ށA
ŽŠŒČ‰đŒˆ‚ľ‚Ü‚ľ‚˝B(ŽŠ‘î‚ĚLinuxPC‚Ĺ“ŽěŠm”F‚ľ‚Ü‚ľ‚˝BGAWK3.1.7‹y‚Ń4.0.1)
"\.txt"‚Ĺ‚Í–ł‚­‚āA".txt"‚Ĺ—Ç‚Š‚Á‚˝‚ń‚Ĺ‚ˇ‚ˁB
‚¨‘›‚Ş‚š‚ľ‚Ü‚ľ‚˝B

‚ŕ‚ľ‚Š‚ľ‚˝‚çA‰ďŽĐ‚ĚƒT[ƒo(RHEL)‚ĚGAWK‚ŞŒĂ‚­‚Ä‰đŒˆ‚Ĺ‚Ť‚Ä‚Č‚˘‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚ށB

680 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/04/30(ŒŽ) 20:27:16.48
>>679
match() ‚Ě‘ć“ńˆř”‚É•śŽš—ń‚đ—^‚Ś‚˝ę‡‚ÍŽ–‘O‚ɐł‹K•\Œť‚Ö‚ĚŒ^•ĎŠˇ‚ލs‚í‚ę‚é‚ŞA
‚ť‚ĚŰ‚ÉƒGƒXƒP[ƒv‚ŞŠO‚ę‚Ä /.txt/ ‚Ć“Ż“™‚É‚Č‚Á‚Ä‚ľ‚Ü‚¤A ‚Ć‚˘‚¤‚ą‚Ć‚Š‚ƁB
‚‚܂č "\\.txt" ‚Ć‚ˇ‚é‚ŠA ł‹K•\Œť‚Ě /\.txt/ ‚đ—^‚Ś‚ę‚΂悢B

The GNU Awk User's Guide ‚É‚ŕ‚ą‚ĚŒťŰ‚ɂ‚˘‚Ä‚Ěŕ–ž‚Í‚ ‚é‚ŞA
~ !~ ‰‰ŽZŽq‚ɂ‚˘‚Ä‚ľ‚ŠG‚ę‚ç‚ę‚Ä‚˘‚Č‚˘B
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_5.html#SEC32

681 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/05/24(–Ř) 00:27:31.74
gawk4.0.2•t‘Ž‚ĚŒ´”Ĺ‚Ĺ‚Ímatch‚Ěŕ–ž‚É‚ŕ‚ť‚̕ӐG‚ę‚ç‚ę‚Ä‚é‚ˁB
http://www.gnu.org/software/gawk/manual/html_node/String-Functions.html#String-Functions
’N‚Š‚ą‚Ěƒo[ƒWƒ‡ƒ““ú–{Œę‰ť‚ľ‚Ä‚Č‚˘‚Š‚ȁB

682 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/12(–Ř) 02:26:40.35
FIFO‚ČŠ´‚ś‚̐ć“ü‚ęćo‚ľ‚Ěƒoƒbƒtƒ@‚ɂ͉˝Žg‚Ś‚΂˘‚˘H
‚Ć‚˘‚¤‚ŠA
Array‚ŁA‚˝‚Ć‚Ś‚ÎA[3] ‚Š‚çA[8]‚Ü‚Ĺ‚Ěƒf[ƒ^‚đA[1]‚Š‚çA[6]‚É“Ž‚Š‚ˇ‚ɂ͉˝‚ވę”Ô‘‚˘H
‚Ĺ‚Ť‚ę‚Δz—ń‚Í‚P‚‚ľ‚ŠŽg‚˘‚˝‚­‚Č‚˘‚Ě‚ž‚ށA–ł—‚ž‚낤‚Šc


683 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/12(–Ř) 09:23:22.92
‘Ź‚ł‚đ‹‚ß‚é‚Č‚ç–ˆ“x‘S—v‘f‚¸‚炡‚ć‚čA“ǂݏo‚ľˆĘ’u‚Ə‘‚Ťž‚ÝˆĘ’u‚Ě“YŽšŽ‚Á‚Ä
ŠÇ—‚ľ‚˝•ű‚Ş‚˝‚˘‚Ä‚˘‘Ź‚˘

684 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/12(–Ř) 10:14:32.78
awk‚ɂ͘A‘z”z—ń‚ľ‚Š‚Č‚˘‚ľ‚Č

685 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/14(“y) 14:35:06.22
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ʼn˝‚Ć‚Š‚Č‚é‚Č‚çƒŠƒ“ƒOƒoƒbƒtƒ@‚Š‚Č

686 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/14(“y) 22:27:17.73
>>682
BEGIN{
@QMAX=3
@QTopPos=0;QTailPos=0;QNum=0;
@deQ();
@enQ("1");deQ();
@enQ("a");enQ("b");enQ("c");enQ("x");deQ();deQ();deQ();deQ();
}
function enQ(PushVal){
@if (QNum+1 > QMAX){print "‚¨‚Č‚Š‚˘‚Á‚Ď‚˘"; return;}
@nextPos = (QTopPos+1) % QMAX;
@queue[QTopPos] = PushVal;
@QTopPos=nextPosQNum++;
}
function deQ(){
@if (QNum < 1){print "‚Š‚ç‚Á‚Ű"; return}
@QNum--;@TailVal=queue[QTailPos]
@QTailPos = (QTailPos +1) % QMAX;
@print TailVal;
@return TailVal;
}

687 F686F2012/07/14(“y) 22:54:06.64
Ş‚ĚŒ‹‰Ę‚Í‚ą‚ń‚ČŠ´‚śB
>‚Š‚ç‚Á‚Ű
>1
>‚¨‚Č‚Š‚˘‚Á‚Ď‚˘
>a
>b
>c
>‚Š‚ç‚Á‚Ű

>>685‚̏‘‚˘‚Ä‚˘‚郊ƒ“ƒOƒoƒbƒtƒ@ŽŔ‘•‚Ĺ‚ˇB
enqueue,dequeue‰ń”‚Ş‘˝‚˘‚Č‚çƒŠƒ“ƒOƒoƒbƒtƒ@‚Ĺ—Ç‚˘‚ĆŽv‚¤B
‘ĺ’ď‚Ěę‡‚ÍQMAX‚É‘ĺ‚Ť‚Č’l‚đÝ’股‚ę‚ÎŽ–‘Ť‚č‚éƒnƒY‚ž‚Ż‚Ç
ăŒŔ‚ŞŒˆ’č‚Ĺ‚Ť‚Č‚˘“™‚ĚŽ–î‚Ş‚ ‚ę‚Îdelete array‚đŽg‚Á‚˝’Pƒ‚Č”z—ńŠÇ—‚Š‚ȁB
‚˝‚ž“Y‚ŚŽš‚ސ”’lăŒŔ‚đ’´‚Ś‚Č‚˘—l‚ȍH•v‚Í•K—v‚ž‚ˁB

688 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/15(“ú) 21:09:36.15
ƒŠƒ“ƒO‚Ĺ‚ŕăŒŔ‚đ’č‚ß‚é‚Ć“ü—̓XƒgƒŠ[ƒ€‚̏ăŒŔ‚Ş•s–ž‚Čę‡‚Ü‚¸‚˘‚ą‚Ć‚É‚Č‚é‚̂ŁAŒťÝ‚Í
A=“ü—ÍArray,CˆęŽž•ŰŠÇ,i,k,n,p
  k=1;C[0]=0;
  for(i=1;i<=A[0];i++){n=0;while(k<i && A[k++]=C[n+=1]);if(n){
  delete C[C[0]+1];C[0]-=n;p=0;while(C[p+=1]=C[n+=1]);}p=1;
  while(match(substr(A[i],p),re)){p+=RSTART-1;n=substr(A[i],p,RLENGTH);
  if(k<i){A[k++]=n;}else{C[C[0]+=1]=n;};p+=RLENGTH;}};n=1;
  while(A[k++]=C[n]){delete C[n++];};A[0]+=C[0]-1;C[0]=0;
‚đŽg‚Á‚Ä‚˘‚éB
re=regexp‚Ć‚ľ‚āAArray A‚Ɉę’v‚ˇ‚éƒf[ƒ^‚Ş‚ ‚ę‚Ú‚ť‚ę‚đŽć“žAŒ‹‰Ę‚đArray A‚ɏo—́AA[0]‚ɍ‡Œv‚Ş‹LÚB

‚ą‚ęˆČăiƒR[ƒhƒTƒCƒYA‚ ‚é’ö“x‚Ě‘Ź“xAƒƒ‚ƒŠ‚ĚŽg—p—Ę‚đ‹É—͏­‚Č‚­j‚Ć‚˘‚¤đŒ‚ĹĹ“K‰ť‚Ĺ‚Ť‚é‚ž‚낤‚Šc
‚ž‚ę‚Š—Š‚ށB
“ü—Í‚Ćo—͐悪“Ż‚ś‚Ĺ‚ŕA•Ę‚Ĺ‚ŕě“Ž‚ˇ‚éƒR[ƒh‚Č‚çŽ‚Ě‚ą‚Ć—Ç‚˘‚Ě‚ž‚ށc


689 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/17(‰Î) 00:02:18.87
‚ą‚ę‚Í‚Đ‚Ç‚˘
ƒfƒoƒbƒO‚ŕŠg’Ł‚ŕ–ł—‚ś‚á‚Ë

690 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/17(‰Î) 22:03:00.62
Šî–{“I‚Ɉę“xě‚Á‚ÄŒă‚Í•K—v‚ɉž‚ś‚ăRƒsƒy‚ž‚Ş‚ç‚ȁB‘ź‚É‚Í
function grep( o, re, p, B, this, a ){
B[0]=0;if(o~"-v"){while((getline v < p)>0){if(!match(v,re))B[B[0]+=1]=v;}return B[0];};
if(o~"-o"){while((getline v < p)>0){a=v;while(match(a,re)){B[B[0]+=1]=substr(a,RSTART,RLENGTH);
a=substr(a,RSTART+RLENGTH);}};return B[0];};while((getline v < p)>0){if(match(v,re))B[B[0]+=1]=v;}return B[0];
}
‚Č‚ń‚Š‚ŕ—Ç‚­Žg‚¤Bgrep("-o","pattern","/var/log",data);‚Ý‚˝‚˘‚ČŠ´‚ś‚ŁB‘O‚Ě‚Íagrep("-v",pattern,B,C)‚Ěˆę•”•ŞB
“ú‚˛‚ë‚Ěƒƒ“ƒe‚Ĺ‚ż‚ĺ‚Á‚Ć‚ľ‚˝Žčě‹Ć‚ś‚á‚ß‚ń‚Ç‚˘‚Ě‘g‚Ţ‚Ć‚Ť‚ɁA‚قڐ”•Ş‚Ĺ‘g‚Ý‚ ‚Ş‚é‚Ě‚ŞŠy‚Č‚ń‚ž‚ćB
ƒTƒuƒvƒƒZƒX‚Ć‚ľ‚ÄgrepŒÄ‚яo‚ˇ‚Ě‚ŞƒRƒXƒg‚Š‚Š‚鎞‚Ć‚ŠAperl‚Ş”j‘š‚ľ‚˝ó‹ľ‚Ĺ‚ĚƒŠƒJƒoƒŠ[ƒXƒNƒŠƒvƒg‚Ć‚ľ‚Ä‘g‚ń‚ž‚Ě‚ŞŒł‚ž‚Ż‚ǁB
ƒJ[ƒlƒ‹‚ł‚Śś‚Ť‚Ä‚˘‚ę‚ÎŒă‚ÍawkƒoƒCƒiƒŠ—Ź‚ľž‚ß‚ÎŽg‚ŚAsh‚Ş”ź•ŞŽ€‚ń‚Ĺ‚˘‚Ä‚ŕ‚Č‚ń‚Ć‚Š“Ž‚­‚ľB


691 F686F2012/07/21(“y) 23:12:03.74
>>688
BEGIN{
@QMAX=9007199254740991
@QTopPos=QTailPos=QNum=0;
@hitTop=0;
@A[++z]="hoge";
@A[++z]="1 2 3 4 5";
@A[++z]="fuga";
@A[0]=z;
@for(i=1;i<=A[0];i++){
@@p=1;
@@while(match(substr(A[i],p),/[0-9]+/)){
@@@p+=RSTART-1;
@@@enQ(substr(A[i],p,RLENGTH));
@@@p+=RLENGTH;
@@}
@@if(QNum>0){
@@@while(QNum && hitTop<i)A[++hitTop]=deQ();
@@}else{
@@@delete A[i];
@@}
@};
@if(QNum>0) while(QNum)A[++A[0]]=deQ();
@for(z=1;z<=A[0];z++)print "A[" z "]:" A[z];
}


692 F686F2012/07/21(“y) 23:44:24.03
691‚Ě‘ą‚Ť
‚ż‚Ȃ݂ɁAA[1]`A[A[0]]‚đgrep‚ľ‚ÄŒ‹‰Ę‚ÍA[1]`A[?]‚É–ß‚ˇƒXƒNƒŠƒvƒg‚ˁB
•Ą”Œƒ}ƒbƒ`‚ˇ‚鎖‚Ş‚ ‚é‚Ě‚Ĺ–˘ˆ—s‚đă‘‚Ť‚ľ‚Č‚˘‚悤‚ɃLƒ…[Žg‚Á‚Ä‚éB
function enQ(PushVal){
@if (QNum+1 > QMAX){print "Queue Overflow"; exit;}
@nextPos = (QTopPos+1) % QMAX;
@QBody[QTopPos]=PushVal;
@QTopPos=nextPos
@QNum++;
}
function deQ(){
@if (QNum<1){print "Illigal dequeue"; exit;}
@QNum--;
@TailVal=QBody[QTailPos];
@delete QBody[QTailPos];
@QTailPos=(QTailPos +1) % QMAX;
@return TailVal;
}
ƒŠƒ“ƒOƒoƒbƒtƒ@‚̏ăŒŔ’´‚Ś‚˝‚çI—š‚ł‚š‚Ä‚é‚Ż‚Ç>>688‚ĚŽŔ‘•‚ŕăŒŔ’´‚Ś‚˝‚çƒoƒO‚é‚ľ‹–‚ľ‚āB
Œv‚Á‚Ä‚Č‚˘‚Ż‚ǃ‹[ƒv‚Ş‚Č‚˘•Ş‘‚˘”¤BƒR[ƒhƒTƒCƒY‚Í‚¨Ž@‚ľB
ƒƒ‚ƒŠ‚ÍA[]‚Ƀf[ƒ^•ř‚Ś‚Ă鎞“_‚ĹƒAƒEƒg‚ČŠ´‚ś‚ž‚Ż‚ÇA[]‚đ“K‹XÁ‚ˇ‚悤‚É‚ľ‚Ć‚˘‚˝B
o—͐ć‚đ•Ę‚É‚ľ‚˝‚˘‚Č‚çA[]‚ÉdeQ()‚š‚¸•Ę•Ď”‚É‚ˇ‚ę‚΂¨‚‹B
‚ą‚ę‚Ĺ—Ç‚˘H

693 F688F2012/07/22(“ú) 09:36:17.43
>QMAX=9007199254740991
ƒƒƒ^www
‰´‚Ě‚ŕŠm‚Š‚Éwhile(C[p+=1]=C[n+=1]);‚Ě•”•Ş‚Ĺ•ŰŽ‚ľ‚Ä‚é‚Ě‚ˇ‚ׂďÁ”ď•Ş‚ž‚Żă‚ɈړŽ‚ł‚š‚Ä‚é‚Ě‚Ş–ł‘Ę‚Č‚Ě‚Ĺ
‚ť‚Ěƒ‹[ƒv‚Ş–ł‚˘•Ş‚ÍŠm‚Š‚É‘‚˘‚Í‚¸B

‚ ‚ƁA’p‚¸‚Š‚ľ‚Č‚Ş‚çq‚Ë‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‰´>>688‚ĚŽŔ‘•‚ŏăŒŔ’´‚Ś‚˝‚çƒoƒO‚é‚đkwsk
‚Č‚ń‚ŠŒŠ—Ž‚Ć‚ľ‚Ä‚˝‚Ě‚ŠĄX‚Č‚Ş‚çS”z‚É‚Č‚Á‚Ä‚Ť‚˝B
Ěě‚Á‚˝‚â‚‚Ȃń‚ŁAŒ‹\‚Č•p“xŽg‚Á‚Ä‚Ť‚˝‚Ě‚ž‚ލĄ‚Ü‚ĹƒoƒO‚É‹C‚Ă‚Š‚Č‚Š‚Á‚˝

‚ľ‚Š‚ľƒf[ƒ^‚đƒƒ‚ƒŠă‚É“WŠJ‚ˇ‚é‚Š‚ç‚Ç‚¤‚ľ‚Ä‚ŕăŒŔ‚ޏo‚Ä‚­‚é‚ȁc
awk‚Ĺ10GB‚Ž‚炢‚Ěˆľ‚¤Žž‚Ígetline‚Ĺ‚Č‚ń‚Ć‚Š‚Č‚é‚Ż‚ǁA‚â‚Í‚čƒƒ‚ƒŠƒ}ƒbƒv‚âƒ|ƒCƒ“ƒ^‚ŞŽg‚Ś‚˝‚ç•Ö—˜‚ž‚ć‚Č‚Ÿ
ƒpƒbƒ`ě‚Á‚˝‚çŽů—v‚ ‚é‚Š‚ȁH

694 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/07/22(“ú) 11:41:46.83
>>693
691A‚ż‚ĺ‚Á‚Ć’ůłB–ł‘Ę‚ÉƒLƒ…[Žg‚¤•ŞAŒłƒXƒNƒŠƒvƒg‚Š‚ç—ň‰ť‚ľ‚Ä‚˝B
> @@@p+=RSTART-1;
>-@@@enQ(substr(A[i],p,RLENGTH));
>+@@@if(hitTop+1<i){
>+@@@@A[++hitTop]=substr(A[i],p,RLENGTH)
>+@@@}else{
>+@@@@enQ(substr(A[i],p,RLENGTH));
>+@@@}
> @@@p+=RLENGTH;
‚ ‚ƁA—Ç‚­l‚Ś‚˝‚ço—͐ć‚đ•Ę‚É‚ˇ‚é‚Č‚çA‚ť‚ŕ‚ť‚ŕƒLƒ…[•s—vB

ƒoƒO‚Á‚Ä‚Ě‚Í687‚Ő”’lăŒŔ‰]X‚Ə‘‚˘‚˝‚Ć‚¨‚čA
hC[0]+=1h‚Şawk‚̐Ž”‚̐¸“xŒëˇ‚Č‚ľ‰‰ŽZ‰Â”\ăŒŔ‚đl—ś‚ľ‚Ä‚˘‚Č‚˘‚ž‚ŻB
‚Ç‚Ěawk‚ŕ‘˝•Ş‚ť‚¤‚ž‚ĆŽv‚¤‚Ż‚ǁAŽčŒł‚̊‹Ť‰ş‚Ĺ‚ĚŽŔsŒ‹‰ĘŤ
C:\>gawk --version
GNU Awk 3.1.7(windows special Nov 24 2009)
C:\>gawk "BEGIN{print 9007199254740990+1}" nul
9007199254740991
C:\>gawk "BEGIN{print 9007199254740991+1}" nul
9007199254740992
C:\>gawk "BEGIN{print 9007199254740992+1}" nul
9007199254740992

ŽŔŰ‚́ihdd‚⃁ƒ‚ƒŠ‚ސć‚ÉŽ€‚ʂ̂Łj
ˆęs‚Ĺ‚ą‚ę‚ž‚Żł‹K•\Œť‚Şhit‚ˇ‚鎖‚ÍŽ–ŽŔă–ł‚˘‚ľA
‰ź‚É”­ś‚ľ‚Ä‚ŕŒŸőŒ‹‰Ę‚ޒׂę‚é‚ž‚Ż‚ŁA‹C•t‚Š‚Č‚˘”¤B


695 F688F2012/07/22(“ú) 13:39:49.16
>9007199254740992
—˜_ăA8192ƒyƒ^ƒoƒCƒg‚Ě“Ż‚śƒf[ƒ^[aaa...]‚Ĺregexp="."‚Ć‚ˇ‚ę‚΁A”­ś‚ˇ‚é‚ȁc
IEEE 754‚Ě52bit§ŒŔ‚ž‚Š‚çA‚ą‚ęˆČă‚Ě‚Ĺ‚Š‚˘”Žšˆľ‚¤‚Č‚çbig numbert‘Ήž‚Ěƒ‰ƒCƒuƒ‰ƒŠ‚Š,
"bc -q" |& ‚Ĺ“Ž‚Š‚ˇ‚ŠAxgawkAdnawk‚ ‚˝‚čŽg‚¤‚ׂŤ‚ž‚Č‚Ÿ

Ě’N‚Š‚Şbignum‚ĚawkƒXƒNƒŠƒvƒg‘‚˘‚Ä•ú—Ź‚ľ‚Ä‚˘‚˝Šo‚Ś‚Ş‚ ‚é‚Ě‚ž‚ށA
ƒOƒOƒb‚Ä‚ŕŒŠ‚‚Š‚ç‚ńBŽčŒł‚É‚ ‚é‚Ě‚Íƒrƒbƒg‰‰ŽZ‚Ě‚â‚‚ž‚Ż‚ž‚í
‚˘‚‚Š‚ť‚ę‚ž‚Ż‚Ěƒf[ƒ^‚đƒƒ‚ƒŠă‚É•ŰŽ‚Ĺ‚Ť‚éƒ}ƒVƒ“‚đˆľ‚Á‚Ä‚Ý‚˝‚˘‚ŕ‚Ě‚žc

696 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/03(‹ŕ) 02:35:23.75
awk‚Á‚Äabs‚Ć‚Šacos‚Č‚Ç‚ĚŠî–{“I‚ČŽZpŠÖ”‚Ş—pˆÓ‚ł‚ę‚Ä‚Č‚˘‚ń‚Ĺ‚ˇ‚Ë
ĄŒă‚ŕŽŔ‘•‚ł‚ę‚é‚ą‚Ć‚Í‚Č‚˘‚ń‚Ĺ‚ľ‚傤‚ŠH

ƒpƒCƒv‚ĹƒTƒNƒb‚Ƃ‚Ȃ˘‚Ĺƒƒ“ƒ‰ƒCƒ“‚ŏˆ—‚ˇ‚é‚Ě‚Éd•ó‚ľ‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށEEE
‘ă‚í‚č‚Ć‚Č‚é‚ƁA‰˝Žg‚¤‚Ě‚Ş‚ć‚ë‚ľ‚˘‚Ĺ‚ˇ‚ŠH
‚Ĺ‚Ť‚ę‚Îperl‚ÍŽg‚˘‚˝‚­‚Č‚˘‚Ĺ‚ˇi‚Ç‚¤‚ľ‚Ä‚ŕD‚Ť‚É‚Č‚ę‚Č‚˘

697 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/03(‹ŕ) 06:48:38.25
abs‚ÍŽŠ•Ş‚ŏ‘‚Ż‚΂˘‚˘‚ľAacos(x)‚Íatan2(x, ă(1.0 - x*x))‚Ə‘‚Ż‚é‚Š‚çA
‚Ç‚ż‚ç‚ŕŠî–{“I‚Ĺ‚Í‚Č‚˘‚Ć”ť’f‚ľ‚Ä‘g‚ݍž‚Ý‚ś‚á‚Č‚˘‚ń‚ž‚ĆŽv‚¤‚Ż‚ǁB

Python‚ŠRuby‚Ĺ‚˘‚˘‚ń‚ś‚á‚Č‚˘H@ƒƒ“ƒ‰ƒCƒi[Œü‚Ť‚Ĺ‚Í‚Č‚˘‚Ż‚ǁB

698 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/03(‹ŕ) 07:37:24.41
>>696
ƒ‰ƒCƒuƒ‰ƒŠ(?)‚đE‚Á‚Ä—ˆ‚Ä‚Í?

699 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/03(‹ŕ) 11:48:03.19
>>696
•K—v‚Ȋ֐”’l‚đŒvŽZ‚ˇ‚é‚ž‚Ż‚ĚƒvƒƒOƒ‰ƒ€‚đC‚ōě‚Á‚Ä‚¨‚˘‚˝‚ç?

700 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/03(‹ŕ) 20:21:59.43
Ě‚ť‚ę‚ĹƒxƒNƒgƒ‹‰‰ŽZ‚ľ‚Ä—V‚ń‚ž‚Č

701 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/04(“y) 09:23:47.83
Ruby‚Í‚ť‚ą‚ť‚ąƒƒ“ƒ‰ƒCƒi[‚ŕ‘‚Ż‚銴‚ś‚Ş‚ˇ‚éAawk‚âPerl‚Ů‚Ç‚ś‚á‚Č‚˘‚Ż‚Ç‚Ë
Python‚Í—ŹÎ‚ɃR[ƒh‹N‚ą‚ł‚Č‚˘‚Ɛh‚˘‚ą‚Ć‚Ş‘˝‚˘‚Ş

702 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/04(“y) 10:27:49.07
awk‚Ĺmatlab‚Ý‚˝‚˘‚ČƒxƒNƒgƒ‹‰‰ŽZ‚Ĺ‚Ť‚é‚悤‚É‚ľ‚Ä‚Ů‚ľ‚˘

703 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/04(“y) 16:48:36.10
awk‚ĹƒNƒ‰ƒX‚đŽg‚Ś‚é‚悤‚É‚ľ‚Ä‚Ů‚ľ‚˘

704 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/04(“y) 17:06:19.06
awk‚Ĺ‘S‚Ä‚Ě–‚–@­—‚đ‹~‚Á‚Ä‚Ů‚ľ‚˘

705 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/04(“y) 17:08:30.07
awk‚ł‚ń‚Í–‚—

706 F–{“cF2012/08/05(“ú) 07:21:28.03
Awk++
http://awk.info/?doc/dsl/awkplusplus.html
OO in AWK++
The awk++ language provides object oriented programming for AWK that includes:
classes
class properties (persistent object variables)
methods
inheritance, including multiple inheritance

http://lawker.googlecode.com/svn/fridge/lib/bash/awk++/version21/awkpp21.zip


707 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/05(“ú) 09:56:26.63
ƒfƒoƒbƒO‘ĺ•Ď‰ß‚Ź‚ÄŽ€‚Ę‚é
$ cat witch.awkpp
class Witch {
var spell
method new() { spell = "mahalic mahalita" }
method perform() { print spell }
}
class Samantha : Witch {
method perform() { print "twitch" }
}
BEGIN {
# wife = Witch.new() ƒGƒ‰[—vˆös
wife = Samantha.new()
wife.perform()
}
$ gawk -f awkpp -r witch.awkpp
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ syntax error
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ •\Œť‚Ě char '?' ‚Í•sł‚Ĺ‚ˇB

708 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/22(…) 00:09:49.86
size: 656 byte, supports -o -v option. Array A and B can be the same (NEW)
function xagrep( o, re, A, B, this, a, i,k ){
k=0;B[0]=A[0];if(o~"-v"){for(i=1;i<=A[0];i++){if(!match(A[i],re)) B[k+=1]=A[i];}B[0]=k;return k};
if(o~"-o"){B[B[0]+1]=0;for(i=1;i<=A[0];i++){a=A[i];if(i==k){i=i-B[B[0]+1]+1;B[B[0]+1]=k;k=B[0]+2;
while(i<=B[B[0]+1]){B[i++]=B[k];delete B[k++];}i=B[B[0]+1];k=i;B[B[0]+1]=0;}while(match(a,re)){
if(i>k){B[k+=1]=substr(a,RSTART,RLENGTH);}else{B[B[0]+1+(B[B[0]+1]+=1)]=substr(a,RSTART,RLENGTH);
k++}a=substr(a,RSTART+RLENGTH)}}if(i<k){i=k-i;k=B[0]+1;B[0]=i+B[B[0]+1];while(i<B[0])B[i+=1]=B[k+=1];
while(i<k)delete B[i+=1];}return B[0]}for(i=1;i<=A[0];i++){if(match(A[i],re))B[k+=1]=A[i];}B[0]=k;return k;
}
‚ą‚ęˆČăí‚ę‚é‚Ć‚ą‚ë–ł‚˘‚Š‚ȁH@
‚‘Ź‰ť{ƒTƒCƒY—Dć‚ŁA•Ď”‚Í‚Ĺ‚Ť‚é‚ž‚ŻŽg‚¤”‚đ­‚Č‚­‚Ć‚ĚđŒ‚Ĺ

709 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/08/22(…) 09:51:11.01
>>708
‚ť‚Ě3‚Â‚ĚđŒ‚Ě—Dć“x‚Ş‚í‚Š‚ç‚ń‚ȁB

Œ‹\“Ż‚ś•”•ŞŽŽ‚Ş‚ ‚é‚̂ŕϐ”‚É“ü‚ę‚˝•ű‚Ş•Ď”‚Í‘‚Ś‚é‚Ż‚Ç’Z‚­‚Č‚é‚ľ
ę‡‚É‚ć‚Á‚Ä‚Í‘Ź“x‚ŕ‘Ź‚˘‚Ć‚Š‚ ‚č‚ť‚¤‚ž‚Ż‚Ç‚Ç‚¤‚Č‚ń?

—á‚Ś‚ÎB[0]‚Í“Á•Ę‚Č—p“r‚Á‚Ű‚˘‚Ż‚Çx‚Ć‚Š1•śŽš•Ď”‚É‚ľ‚Äreturn‚Ě’ź‘O‚É
‘‚Ť–ß‚ľ‚˝•ű‚Ş•śŽš”‚͉҂°‚éB

‚ ‚Ć×‚Š‚˘‚Şhoge+=1‚ć‚č++hoge‚Ě•ű‚Ş1•śŽš’Z‚˘‚Ć‚ŠA‚˘‚ç‚Č‚˘u;v‚Ş
Žc‚Á‚Ä‚é‚Ć‚Š‹l‚ß‚ŞŠĂ‚˘‚Ć‚ą‚ë‚Ş‚Ü‚ž‚ ‚é‚ˁB

710 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/09/30(“ú) 22:45:00.64
ˆČ‰ş‚̂悤‚Čƒf[ƒ^‚̏ˆ—‚ɂ‚˘‚ÄŽż–₢‚˘‚Ĺ‚ľ‚傤‚ŠB
$1‚ÉŒo‰ßŽžŠÔiŽžjA$2‚Ɂu‘Ź“xv‚Ş‚ ‚ę‚Î$3‚̐”’l‚Í‘Ź“x‚đA$2$3‚É
uup avudown av‚Č‚Ç‚Ć‚ ‚ę‚΂ť‚ĚŽž‚Ĺ‚Ěs“Ž‚đŽŚ‚ľ‚Ü‚ˇB

‚ą‚Ěƒf[ƒ^‚Š‚çupAdown‚̏ꏩ‚đ‹‚ß‚˝‚˘‚ĆŽv‚˘‚Ü‚ˇB
‚‚܂čA‰ş‚Ě—á‚ĹˆÚ“ŽŠJŽn‚Š‚ç‚Ě‹——Ł3‚Ĺup aA‹——Ł3.5‚Ĺup bA‚Ć‚˘‚¤‹ď‡‚Ĺ‚ˇB
Œo‰ßŽžŠÔ‚Ć‘Ź“x‚Š‚çęŠ‚đŒvŽZ‚ˇ‚é‚ž‚Ż‚Ĺ‚ˇ‚ށB‘Ź“x‚đ•ĎX‚ˇ‚éƒ^ƒCƒ~ƒ“ƒOE
‰ń”‚Í•s’čA‘Ź“xƒf[ƒ^‚ƍs“Žƒf[ƒ^‚Í‚Ć‚ŕ‚ÉŒo‰ßŽžŠÔ‡‚É‹L˜^‚ł‚ę‚Ä‚˘‚Ü‚ˇB
‘Ź“x•ĎX‚đ‚Ç‚¤ˆľ‚Ś‚΂˘‚˘‚Ě‚ŠA‚ż‚ĺ‚Á‚Ć“Ş‚Ş‰ń‚č‚Ü‚š‚ńB

---Œłƒf[ƒ^—á---
0 ‘Ź“x 10
50 ‘Ź“x 20
200 ‘Ź“x 25
30 up a
35 up b
40 down a
40 down b
50 up a
70 down a
200 up c
250 down c

---ˆ—Œă---
3 up a
3.5 up b
4 down a
4 down b
5 up a
6 down a
12.5 up c
14.5 down c

711 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/10/01(ŒŽ) 11:28:30.42
‹^–â‚đ’ńŽŚB
$1‚ޏí‚ÉŽž‚Ĺ$2‚Ş‘Ź“x‚Ě‚Ć‚Ť‚Ě$3‚Ş‘Ź“x‚Č‚çA
30 up a‚Ě‚Ć‚Ť‚É30 * 10‚Ĺ300 up a‚É‚Č‚é‚ń‚ś‚á‚Č‚˘‚ž‚낤‚ŠB
“Ż‚ś‚悤‚ɁA70 down a‚Ě‚Ć‚Ť‚É50 * 10 + (70 - 50) * 20‚Ĺ900 down a‚É‚Č‚é‚ń‚ś‚á‚Č‚˘‚ž‚낤‚ŠB

$3‚Ş‘Ź“x(’PˆĘŽžŠÔ“–‚˝‚č‚ĚˆÚ“Ž—Ę)‚Ĺ‚Í‚Č‚­’PˆĘˆÚ“Ž—Ę“–‚˝‚č‚̏Š—vŽžŠÔ‚Č‚Ě‚Ĺ‚ ‚ę‚΁A
30 up a‚Ĺ30 / 10 = 3A70 down a‚Ĺ50 / 10 + (70 - 50) / 20 = 6‚É‚Č‚é‚ń‚ž‚Ż‚ǂˁB

712 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/10/01(ŒŽ) 13:21:34.21
ŽŔ‘•‚ľ‚Ä‚Ý‚˝B‘Ź“x‚Ş“r’†‚ɏo‚Ä‚Ť‚Ä‚ŕ‚˘‚˘‚悤‚Épos‚đ–ˆ‰ńŒvŽZ‚ˇ‚é‚Š‚çŒř—ŚˆŤ‚˘‚Ż‚ǁB
--
BEGIN {
sCount = 0;
}
$2 == "speed" {
sTime[sCount] = $1;
sSpeed[sCount] = $3;
++sCount;
next;
}
{
pos = 0;
for (ic = 1; ic < sCount; ++ic) {
if (sTime[ic] > $1) break;
pos += (sTime[ic] - sTime[ic - 1]) / sSpeed[ic - 1];
}
pos += ($1 - sTime[ic - 1]) / sSpeed[ic - 1];
print pos, $2, $3;
}

713 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/10/01(ŒŽ) 20:30:33.48
>>711
‚ˇ‚Ý‚Ü‚š‚ńA‘OŽŇ‚Ĺ‚ˇ‚ˁB‚Č‚ń‚ž‚낤A’p‚¸‚Š‚ľ‚˘B

>>712
‚Ȃ̂ŁAƒAƒNƒVƒ‡ƒ“•”‚Ě / ‚đ * ‚É•Ď‚Ś‚ę‚΂悳‚ť‚¤‚Ĺ‚ˇB

‚¨“ń•űA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

714 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/12/13(–Ř) 11:40:43.98
awk‚É‚Š‚í‚é“Ż“™‚Ě‚ŕ‚Ě‚ ‚č‚Ü‚ˇH

715 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/12/13(–Ř) 13:08:08.26
python

716 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/12/13(–Ř) 13:13:55.85
>>715
awk‚Ý‚˝‚˘‚ÉŽg‚˘ŸŽč‚˘‚˘‚Ě‚Š‚ȁH

717 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/12/13(–Ř) 13:18:24.65
—Ç‚˘‚Ĺ‚ˇ‚ć

718 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/12/13(–Ř) 13:24:31.23
>>717
‚ ‚č‚Ş‚Ć‚ˇB•×‹­‚ľ‚Ä‚Ý‚Ü‚ˇ

719 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2012/12/13(–Ř) 14:45:25.45
‚Í‚˘

720 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/06(…) 03:49:18.86
g”CˆÓ‚Ě‹L†h‚đŠÜ‚ń‚žƒVƒFƒ‹•Ď”‚đawk‚É“n‚ˇ‚ą‚Ƃ͉”\‚Ĺ‚ˇ‚ŠH‚˝‚Ć‚Ś‚Î

[user@localhost ~]$ var='hoge'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge
hoge

‚ą‚ą‚ŁAvar‚É$‚đŠÜ‚Ü‚š‚é‚Ć

[user@localhost ~]$ var='hoge$fuga'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge$fuga

‚Ć‚¤‚Ü‚­ƒ}ƒbƒ`‚ľ‚Ü‚š‚ń‚Ĺ‚ľ‚˝BvarŽŠ‘Ě‚Í“n‚ł‚ę‚Ä‚˘‚é‚Í‚¸‚Ĺ‚ˇ‚ށA‰˝‚ŞŒ´ˆö‚Ĺ‚ľ‚傤‚ŠH

721 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/06(…) 11:23:41.42
>>720
‚˘‚ż‚Ź‚傤‚ß‚Ě‚Đ‚ž‚č‚Ş‚í‚Ě var ‚́A‚Ђ傤‚Š‚Ě‚ł‚˘‚É
‚š‚˘‚Ť‚Ђ傤‚°‚ń‚Ö‚Ě‚Š‚˝‚Ö‚ń‚Š‚ń‚Ş‚¨‚ą‚Č‚í‚ę‚éB

$0 ~ /hoge$fuga/ {print "hoge$fuga"}
END {print "hoge$fuga"}

‚ß‚˝‚ŕ‚ś‚Ć‚Č‚Á‚Ä‚ľ‚Ü‚¤‚ŕ‚̂́A‚ś‚ş‚ń‚ ‚邢‚Í‚ą[‚Ç‚Ě‚Č‚Š‚Ĺ
‚Ś‚ˇ‚Ż[‚Ő‚ˇ‚é‚Ђ‚悤‚Ş‚ ‚éB

722 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/06(…) 11:29:22.31
~(ƒ`ƒ‹ƒ_)‚̉E•Ó‚͐ł‹K•\Œť‚Ć‚ľ‚ĉđŽß‚ł‚ę‚é‚Š‚çA"hoge" ~ /hoge$fuga/ ‚Ĺƒ}ƒbƒ`‚ˇ‚é‚í‚Ż‚Ş‚Č‚˘B
‹t‚É”J‚ëA"hoge$fuga" ~ /hoge/ ‚Č‚çƒ}ƒbƒ`‚ˇ‚éB

723 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/06(…) 11:33:09.61
>>720
>721‚ŕ>722‚ŕ‚Ç‚ż‚ç‚ŕŒ´ˆöB‚â‚č‚˝‚˘‚ą‚Ć‚đ‚ć‚­Ž—‚ľ‚悤B

724 F720F2013/02/06(…) 15:09:21.72
‚ˇ‚˘‚Ü‚š‚ńAecho "hoge"‚Ĺ‚Í‚Č‚­echo "$var"‚Ĺ‚ľ‚˝B
‚˝‚žAŒ‹‰Ę‚Í>>720‚Ć“Ż‚ś‚Ĺ‚ˇB

—v‚Í“ü—̓tƒ@ƒCƒ‹“ŕ‚́uƒƒ^•śŽšž‚Ý‚Ě”CˆÓ‚Ě•śŽš—ńv‚đA•Ę‚́uƒƒ^•śŽš‚Ɖüsž‚Ý‚Ě”CˆÓ‚Ě•śŽš—ńv‚Ĺ’uŠˇ‚ˇ‚éA
‚Ć‚˘‚¤‚Ě‚đƒƒ^•śŽš‚ĚƒGƒXƒP[ƒv“™‚Ě–Ę“|‚ȏˆ—‚đ‚š‚¸‚ɃTƒNƒb‚Ć‚â‚č‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚Ĺ‚Ť‚Ü‚ˇ‚ŠH

725 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/07(–Ř) 05:01:43.19
ŃŘ

—\‚߁uƒƒ^•śŽš‚ĆŒž‚Á‚Ä‚ŕ $ ‚ľ‚Šo‚Ä‚ą‚Č‚˘v‚Ć‚Š”ť‚Á‚Ä‚é‚Č‚ç‘ĺ‚ľ‚˝‚ą‚Ć–ł‚˘‚Ż‚Ç
ˆę”ʉť‚ˇ‚ę‚΂ˇ‚é‚Ů‚Ç–Ę“|‚É‚Č‚é

726 F720F2013/02/07(–Ř) 22:14:56.21
>>725
‚â‚Í‚č‚ť‚¤‚Ĺ‚ˇ‚ŠB
Ą‚Ü‚Ĺ‚ą‚¤‚˘‚Á‚˝ˆ—‚Ísed‚Ĺ‚ľ‚ą‚ľ‚ąƒGƒXƒP[ƒv‚ľ‚Ä‚â‚Á‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށA‚˘‚˘‰ÁŒ¸–Ę“|‚É‚Č‚Á‚˝‚̂ŁA
‚˝‚Ć‚Ś‚Îfgrep‚Ý‚˝‚˘‚ɐł‹K•\Œť‚đƒIƒt‚É‚ľ‚ďˆ—‚ˇ‚é•ű–@‚Í‚Č‚˘‚Š‚Ć’T‚ľ‚Ä‚˘‚é‚ń‚Ĺ‚ˇ‚ށA
awk‚Ĺ‚Í–ł—‚Ĺ‚ˇ‚ŠEEEB

727 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/08(‹ŕ) 11:20:14.98
>>726
’P‚Ɉę’v‚Ȃ琳‹K•\Œť‚Č‚ń‚ŠŽg‚킸‚É”äŠr‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
fgrep‚ĹŽ–‚Ş‘Ť‚č‚é‚Ě‚Č‚çawk‚Š‚çfgrep‚đ‹N“Ž‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB

728 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/08(‹ŕ) 19:27:47.04
>>726
fgrep‚Č‚ç index()ŠÖ”‚ś‚á‚Č‚˘‚Ě?

729 F720F2013/02/09(“y) 15:32:27.55
>>727
„’P‚Ɉę’v‚Ȃ琳‹K•\Œť‚Č‚ń‚ŠŽg‚킸‚É”äŠr‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
ˆÓ–Ą‚Ş•Ş‚Š‚ç‚Č‚˘‚ń‚Ĺ‚ˇ‚ށAawkă‚Ě˜b‚Ĺ‚ˇ‚ć‚ˁH

>>728
index()‚Ěˆř”‚Í•śŽš—ń‚ž‚Š‚çA‚ą‚ę‚đ‚¤‚Ü‚­Žg‚Ś‚ΖړI‚̏ˆ—‚Ş‚Ĺ‚Ť‚éEEE‚Ě‚Š‚ȁH

‚Ĺ‚ŕ‚Č‚ń‚Šawk‚Ĺ‚˛‚ż‚傲‚ż‚ĺ‚â‚é‚ć‚čAƒƒ^•śŽš‚đƒGƒXƒP[ƒv‚ˇ‚é‘Oˆ—‚đ‚Š‚Ü‚ˇ‚Č‚č
‰˝‚Č‚č‚ľ‚˝‚Ů‚¤‚Ş‘f’ź‚Č‹C‚Ş‚ľ‚Ä‚Ť‚˝EEEB‚˝‚Ć‚Ś‚΂ą‚ń‚ČŠ´‚ś‚Ĺ

$ var='hoge$fuga'
$ var2=$( echo "$var" | sed 's/\$/\\\\$/g' )@ŠƒGƒXƒP[ƒvˆ—
$ echo "$var" | awk -v var="$var2" '
$0 ~ var {print var}
END {print var}
'
hoge\$fuga
hoge\$fuga

730 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/09(“y) 17:49:52.25
/bin/sh‚Ĺ‚˛‚ż‚傲‚ż‚ĺ‚â‚é‚Ě‚ŞD‚Ý‚Č‚çAawk‚ŕfgrep‚ŕŽg‚킸Acase•ś‚Ĺ‚â‚č‚Ⴂ‚˘‚ń‚ś‚á‚Č‚˘‚́B

731 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/09(“y) 21:34:09.39
>>729
•śŽš—ń‚Ě”äŠr‚Í“™†‚Ĺ‚Ĺ‚Ť‚é‚Á‚Ä”FŽŻ‚Í‚Č‚˘‚Ě?

732 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/10(“ú) 14:31:49.57
>729
‚˘‚âA‚ť‚Ě•ű–@‚Ĺ‚ŕŒ‹‹Ç ' ‚̓GƒXƒP[ƒv‚Ş•K—v‚Ĺ‚ľ‚ĺB
ƒ_ƒCƒŒƒNƒg‚ɃVƒFƒ‹•Ď”‚É“ü‚ę‚é•ű–@‚ŠA
ƒtƒ@ƒCƒ‹‚Č‚Ç‚É“f‚Ťo‚ľ‚Ä‚¨‚­•ű–@‚Ě•ű‚ވŔ’čB
‚Ü‚Ÿ‚ť‚ę‚Ĺ‚ŕ‰üs‚Ć‚Š§Œä•śŽš“ü‚ę‚ç‚ę‚é‚Ć‚ŕ‚É‚ĺ‚éę‡‚Ş‚ ‚é‚Ż‚ǂȁB

733 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/11(ŒŽ) 20:15:01.17
‚ť‚ą‚Ü‚Ĺ‚ß‚ń‚Ç‚­‚ł‚­‚Č‚Á‚˝‚çperl‚Ć‚Šruby‚Ć‚ŠŽg‚Á‚˝•ű‚ŞŠy‚ž‚źw

734 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/11(ŒŽ) 22:46:25.57
‰˝‚Ĺ gawk -f ‚Ć‚ŠŽg‚킸ƒƒ“ƒ‰ƒCƒi[‚ɍS‚é‚Ě‚Š‚Ë‚Ľ

735 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/02/12(‰Î) 22:00:38.07
>>732
’†ŠŘƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚ÍîŽă‚ĚŽdŽ–iƒhƒ„Šç
>>734
ƒƒ“ƒ‰ƒCƒi[ƒfƒBƒX‚Á‚Ä‚ń‚́H

736 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/03/11(ŒŽ) 10:05:12.56
#
# text converter ( Mac to MS-DOS on Windos/MS-DOS machine)
# convert CR to CR+LF
#
BEGIN{ RS = "\r" }
{ print }

737 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/03/15(‹ŕ) 08:05:25.28
#
# Line(s”)‚𐔂Ś‚é
#

END { FNR }

738 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/03/20(…) 19:07:17.00
# text to html converter
# usage: awk -f txt2htm.awk infile1.txt > outfile2.html

BEGIN{
print("<html>"); print("<head>")
print("<titile> My favorite URLs </titile>")
print("</head>"); print("<h1> </h1>"); print("<body>");
}

/^[:space:]*http/ { print "<A HREF=\""$1"\">"$1"</A><BR>"}

END{
print("</body>")
print("</html>")
}

739 FUNIX(LF) to DOS(CR+LF) conversionF2013/03/21(–Ř) 21:15:00.86
awk 1 infile1 > outfile2.txt

740 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/03/21(–Ř) 22:10:08.07
# awk -f add.awk
BEGIN {
  s1 = "323524855"
  s2 = "4972560"

  reverse(a2, s2)
  size = reverse(a1, s1) # s1 > s2
  carry = 0

  for(k = 1; k <= size; k++) { # s1 > s2
    d = a1[k] + a2[k] + carry
    if(d >= 10) {
      e[k] = d - 10
      carry = 1
    } else {
      e[k] = d
      carry = 0
    }
  }

  if(carry == 1) {
    e[k] = 1
    size = k
  }

  g = produce_string(e, size)
  printf("%s + %s = %s\n", s1, s2, g)
  printf("%f\n", s1 + s2)
  exit
}

741 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/03/21(–Ř) 22:11:11.39
# >>740‚̂‚ÂŤ
function reverse(a, s, k, i) {
  k = 1;
  size = length(s)
  for(i = size; i >= 1; i--) {
    a[k++] = substr(s, i, 1)
  }

  return size
}
function produce_string(a, size, i) {
  g = ""
  for(i = size; i >= 1; i--) {
    g = g a[i]
  }

  return g
}

742 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/03/21(–Ř) 22:12:57.08
function produce_string(a, size, g, i) {

743 Fgrep‚đawk‚ŁF2013/03/22(‹ŕ) 13:32:02.74
# usage: awk -f grep.awk char1 file1 file2

BEGIN{
pattern = ARGV[1]
ARGV[1] = ""
}
$0 ~ pattern {print($0" File name=" FILENAME)}

744 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/11/30(“y) 12:16:25.95
$ echo 10 20 30 | awk '{for(i=0;i<4;)print _$++i}'
10
20
30

_$++i‚Ĺ‚ŕ$++i‚Ĺ‚ŕ‚Ç‚ż‚ç‚Ĺ‚ŕ‚˘‚Ż‚é‚Ě‚Ĺ‚ˇ‚ށAƒAƒ“ƒ_[ƒXƒRƒA‚Ş•t‚˘‚ĉ˝ŒĚ‘ĺä•v‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH

745 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/11/30(“y) 16:04:55.55
‚ˇ‚˘‚Ü‚š‚ńA‚í‚Š‚č‚Ü‚ľ‚˝
‹ó‚̕ϐ”_‚Ć$++i‚ĚŒ‹‰Ę‚Şˆę‚É‚Č‚Á‚Ä‚˝‚ž‚Ż‚Č‚ń‚Ĺ‚ˇ‚Ë

746 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2013/11/30(“y) 20:37:58.81
’P‚ÉŽŽ‚đ•Ŕ‚ׂé‚Ć•śŽš—ń˜AŒ‹‚É‚Č‚éA‚Ě㩂Š

747 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/02(…) 00:10:13.15 ID:T3/5Epfc
•ŰŽç

‚Ä‚Š”ź”N‹ß‚­‘‚Ťž‚Ý‚Ş–ł‚Š‚Á‚˝‚Š

748 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/14(ŒŽ) 22:41:42.89 ID:5r697USd
4.1.1‚Á‚Ä‚ŕ‚¤ƒŠƒŠ[ƒX‚ł‚ę‚˝‚́H

749 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/19(“y) 13:45:38.45 ID:Db2IzPol
‚Ć‚ ‚égawkƒXƒNƒŠƒvƒg‚̐擪‚Ĺ
{last_hoge=hoge; hoge=$ 3}
‚Á‚Ä‚â‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁA
hoge=$ 3‚Íhoge=$3‚ĚŠÔˆá‚˘? ‚ť‚ę‚Ć‚ŕ‚ą‚¤‚˘‚¤‹L–@‚Ş‚ ‚é?

750 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/19(“y) 14:56:08.53 ID:A73fEYrr
>>749
$ ‚͉‰ŽZŽq‚ž‚Š‚çAa=b+1‚đa = b + 1‚Ə‘‚­‚悤‚Č‚ŕ‚Ě‚Š‚ȁB

751 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/19(“y) 21:10:32.64 ID:Db2IzPol
‚Ś‚Ś[ ‰‰ŽZŽq‚ž‚Á‚˝‚Ě‚Š‚ BŐŒ‚‚ĚŽ–ŽŔ

752 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/20(“ú) 12:36:45.70 ID:SQaIR8ej
‰‰ŽZŽq‚ž‚Š‚çA•Ď”‚Ĺ‚ŕ‚˘‚˘‚ćB

753 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/20(“ú) 14:34:12.09 ID:YSeiuWKu
ŽŽ‚ޏ‘‚Ż‚é‚ˁB
$ ‚͈ę”Ô—Dć‡ˆĘ‚ލ‚‚˘‚Š‚çA‚Š‚Á‚ą‚ĹŠ‡‚ç‚ɂႢ‚Š‚ń‚ށB

754 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/04/20(“ú) 15:12:13.25 ID:k3tDznaJ
Ą‚Í‚ś‚ß‚Ä’m‚Á‚˝Bhaskell‚Ě$‚͉‰ŽZŽq‚ž‚Á‚Ä’m‚Á‚Ä‚˝‚Ż‚ǁAawk‚Ĺ‚ŕ‰‰ŽZŽq‚ž‚Á‚˝‚ń‚ž‚ˁB

755 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/10/14(‰Î) 13:37:28.35 ID:cBz5RbAX
‚ť‚ľ‚Ä”ź”N‹ß‚­‘‚Ťž‚Ý‚Ş–ł‚Š‚Á‚˝

756 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/10/15(…) 03:28:03.90 ID:SS4U/DMU
‚˘‚âawkƒXƒŒ‚Č‚ń‚Ä•’i‚Í‚ť‚ń‚Č‚É˜b‘č‚Č‚˘‚ž‚ë

757 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/10/21(‰Î) 15:46:10.36 ID:TQsAGJgk
Žż–â‚ł‚š‚Ä‚­‚ž‚ł‚˘

ĄƒfƒBƒŒƒNƒgƒŠ“ŕ‚Ěƒtƒ@ƒCƒ‹‚Ě–źĚ‚ĆƒTƒCƒY‚ĚƒŠƒXƒg‚đě‚č‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇ
ƒRƒ}ƒ“ƒh‚Ć‚ľ‚Ä‚Íls -l‚đŽŔs‚ľ‚Ä‚˘‚Ü‚ˇ‚Ş‚ą‚ę‚đ‚ł‚ç‚Éawk‚ɃpƒCƒv‚ľ‚Ä‚˘‚Ü‚ˇ
‚˝‚ž‚ľƒtƒ@ƒCƒ‹–ź‚ɃXƒy[ƒX‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚˝‚ßˆČ‰ş‚̂悤‚Č‹ę“÷‚̍ô‚đ‚Ć‚Á‚Ä‚¨‚č‚Ü‚ˇ‚Ş

ls -l | awk '{print $5 "\t" $9$10$11$12$13$14$15$16$17$18$19}'

10ŒÂˆČă‚Ĺ‹ćŘ‚ç‚ę‚Ä‚é‰Â”\Ť‚ŕ‚ ‚é‚˝‚ߍޖ{“I‚ȑΉž‚đ‚ľ‚˝‚˘‚ƍl‚Ś‚Ä‚˘‚Ü‚ˇ‚Ş
‚悢ˆÄ‚Í‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š

758 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/10/21(‰Î) 17:25:55.68 ID:EsuQiv22
# ƒtƒ@ƒCƒ‹–ź‚Ɂu"v‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚˝‚ç’m‚ç‚ˁB
ls -Ql |awk '{split($0, foo, "\x22"); print $5 "\t" foo[2]}'

759 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/10/21(‰Î) 23:41:50.65 ID:stXOK2Vv
QƒIƒvƒVƒ‡ƒ“‚͕׋­‚É‚Č‚Á‚˝
ls -l|awk '{s=$5;for(i=1;i<9;i++)$i="";print s"\t"$0}'

760 F–ź–ł‚ľ‚ł‚ń—‚ť‚¤‚ž‘I‹“‚ɍs‚ą‚¤F2014/12/13(“y) 17:07:55.12 ID:8LbgKkKk
034@@‚́@h@i”źŠpj
035@@‚́@”@i”źŠpj@@@@@@@‚Ĺ‚¨‚‹‚Ĺ‚ˇ‚ŠH

761 F–ź–ł‚ľ‚ł‚ń—‚ť‚¤‚ž‘I‹“‚ɍs‚ą‚¤F2014/12/13(“y) 18:17:16.35 ID:FQOeA8KF
>>760
‚˘‚˘‚Śˆá‚˘‚Ü‚ˇB

762 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2014/12/14(“ú) 00:00:31.34 ID:7YfznIJB
‚Ç‚ż‚ç‚ŕ”ń‰Â“Ç•śŽš‚Ĺ‚ˇ‚ˁB‚ť‚ľ‚Ä‚ť‚¤‚Č‚é‚ĆƒXƒŒˆá‚˘B
awk‚Ć—‚Ţ‚Ě‚Č‚ç‹ď‘Ě“I‚É‚Ç‚¤‚źB

763 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/02/03(‰Î) 10:36:52.13 ID:Dvc0nyMp
Terastation‚Ěƒtƒ@ƒCƒ‹Eƒzƒ‹ƒ_–ź‚ÉŽg‚¤‚Ćƒtƒ@ƒCƒ‹ƒŒƒvƒŠƒP[ƒVƒ‡ƒ“‚ĹƒGƒ‰[‚Ş‹N‚ą‚é•śŽš‚Ş‚ ‚Á‚āA‚ť‚ę‚đ•ĎŠˇ‚ˇ‚éƒoƒbƒ`‚𐜐Ź‚ˇ‚鎞‚É‚ą‚Ěƒ}ƒCƒi[ŒžŒę‚Ş‘ĺŠˆ–ô‚ľ‚˝B
–ń80–œŒ‚Ěƒtƒ@ƒCƒ‹ƒzƒ‹ƒ_–ź‚Š‚ç’Šo‚ˇ‚é‚Ě‚É10•Ş’ö“x‚ž‚Á‚˝B

764 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/05/26(‰Î) 00:18:03.33 ID:Y5HiR/XE
Gawk4.1.2‚ޏo‚˝‚Č‚ A‚ĆŽv‚Á‚Ä‚˝‚炡‚Ž4.1.3‚ޏo‚˝B
‘fl‚É‚Íˆá‚˘‚Ş‚ ‚Ü‚č•Ş‚Š‚ç‚ń‚Ě‚ž‚ށB

765 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/05/31(“ú) 09:20:55.82 ID:PB6Yeih1
http://www.amazon.co.jp/AWKŽŔ‘H“ü–ĺ-Software-Design-plus-’†“‡/dp/477417369X

V‚ľ‚˘–{Ao‚˝‚ń‚ž‚Č
”p‚ę‚Č‚˘‚Ě‚ŞŚ‚˘

766 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/06/03(…) 20:45:34.22 ID:vBAc8MUN
>>765
”ƒ‚Á‚Ä‚Ť‚˝B‚Ü‚žĹ‰‚Ě•ű‚ĆĹŒă‚Ě•ű‚đ’­‚ß‚˝‚ž‚Ż‚ž‚Ż‚ǁB

ƒy[ƒWiviu‚Í‚ś‚߂Ɂvj‚Ĺawk‚Ě•\‹L‚ɂ‚˘‚āu–{‘“ŕ‚ł́A‚˘‚¸‚ę‚Ě
ę‡‚ŕ‚ˇ‚ׂśŽš‚Ěawk‚Ć‚˘‚¤•\Œť‚É“ˆę‚ľ‚Ä‚¨‚č‚Ü‚ˇv‚Ć
‚ ‚é‚̂ɁA‘–ź‚ŞAWKB

ŠŞ––‚ĚƒŠƒtƒ@ƒŒƒ“ƒX‚Ĺ‹C‚É‚Č‚Á‚˝‚Ć‚ą‚ëB
‰‰ŽZŽq‚Ě—Dć‡ˆĘ‚ɐG‚ę‚Ä‚˘‚Č‚˘AƒtƒB[ƒ‹ƒh‰‰ŽZŽq‚Ş
u“Á•Ę‚ČˆÓ–Ą‚đŽ‚Â‚Č•Ď”v‚Ě’†‚É“ü‚ę‚ç‚ę‚Ä‚˘‚éB

ŽQl‘‚â•śŒŁ‚Ş‚Č‚˘‚Ż‚ǁAĄŽž‚́uƒlƒbƒg‚ĹƒOƒO‚ęv‚Š‚ȁB

767 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/07/06(ŒŽ) 22:02:56.12 ID:Wnwr3Nh9
Mono: Playback -9707 [5%] [-97.07dB] [on]
ă‚̍s‚Š‚çƒp[ƒZƒ“ƒg‚đœ‚˘‚˝”Žšiă‚Ě—á‚ž‚Ć5j‚đŽć“ž‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚Ě‚ć‚¤‚É‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
ƒp[ƒZƒ“ƒg‚Ě’l‚Í0‚Š‚ç100‚̐Ž”‚ž‚ĆŽv‚˘‚Ü‚ˇ

768 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/07/07(‰Î) 15:47:02.78 ID:NFKuqu84
# $0 ‚É“ü‚Á‚Ä‚˘‚é‚Ć‚ľ‚Ä
sub(/%.*/, "");
sub(/.*[^0-9]/, "");

769 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/07/08(…) 11:55:27.32 ID:rptAPQZX
awk -F"[%[]" '{print $2}'
‚Ĺ‚Í‚Ü‚¸‚˘?

770 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/07/08(…) 18:52:19.39 ID:GgkVcZ7j
>>768,769
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝
‚Ç‚ż‚ç‚Ĺ‚ŕŠó–]‚ĚŒ‹‰Ę‚đ‹‚ß‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚ľ‚˝

771 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/07/10(‹ŕ) 10:45:11.15 ID:VcZTZ3UB
ƒeƒ“ƒvƒŒ‚Ĺ‚ ‚锤‚Ě1‚Ş“Ç‚ß‚Č‚˘‚ń‚ž‚ށA‚ą‚ĚƒXƒŒ“I‚É‚ÍPOSIX‚ŏ‘‚­‚Ě‚Ş
ł“H•’i‚ÍGawk‚ľ‚ŠŽg‚í‚Č‚˘‚Ě‚Ĺˆę‰žŠm”FB

772 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2015/10/10(“y) 22:36:33.12 ID:1AEUTcmG
awk ‚Ě a ‚́Aaho ‚Ě a

‚˝‚ž‚ľAƒGƒCƒz‚Ć“Ç‚Ţ‚ç‚ľ‚˘
‚Ö‚Ľ[[[[[

773 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/12(‹ŕ) 17:12:05.45 ID:VH2jVHwT
awkŽg‚Á‚Ä‚éƒVƒFƒ‹ƒXƒNƒŠƒvƒgŒŠ‚é‚Ć“Ś‚°‚Ä‚é‚Č‚ ‚ĆŽv‚¤

774 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/18(–Ř) 00:13:16.92 ID:E3KgV2Kz
•’Ę‚Í x[3]=5 ‚Ə‘‚­‚ށA=‚Č‚ľ‚Ě
x[3]
‚ž‚Ż‚Ĺ‚ŕƒGƒ‰[‚ƂȂ炸Ax ‚đ”z—ń‚Ć‚ľ‚ÄŠm•Ű‚ľAlength(x)=1 ‚É‚Č‚é‚Ě‚đ”­ŒŠ
‚Ü‚ A‚ ‚Ü‚č•K—v‚Č‚˘‚Ż‚Ç

775 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/18(–Ř) 23:58:18.64 ID:kHIvdCfG
‚Ü‚ Agawk‚Ěƒ}ƒjƒ…ƒAƒ‹‚Ĺ‚ŕ‘ă“ü‚Ě‘O‚ÉŽQĆ‚ޏo‚Ä‚­‚é‚ľ

776 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/20(“y) 00:57:58.12 ID:OTE8dQpJ
‚ť‚¤‚Ĺ‚ľ‚˝‚ŠAV”­ŒŠ‚Ĺ‚Č‚Š‚Á‚˝

777 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/20(“y) 15:01:09.40 ID:91Q+YYwH
‘ă“ü‘O‚É‚¤‚Á‚Š‚čŽQĆ‚ľ‚Ä‚ľ‚Ü‚¤‚Ě‚Í‹H‚É—Ç‚­‚ ‚éB

778 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/28(“ú) 01:02:06.47 ID:Atbyv4Wk
IGNORECASE=1
‚đBEGIN ‚Ě‘O‚É’u‚˘‚Ä‚ŕƒGƒ‰[‚ɂȂ炸A•s‰Â‰đ“Žě
ƒZƒLƒ…ƒŠƒeƒB“I‚É‚â‚΂­‚Č‚˘‚Ě

779 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/02/28(“ú) 02:01:41.85 ID:2mMmSiU+
>>778
BEGIN ƒZƒNƒVƒ‡ƒ“‚đć“ނɏ‘‚Ż‚Ƃ͉˝ˆ‚É‚ŕ‘‚˘‚Ä‚Č‚˘B

BEGIN ‚đĹŒă‚ɏ‘‚˘‚Ä‚ŕ END ‚đĹ‰‚ɏ‘‚˘‚Ä‚ŕ–â‘č‚Í–ł‚˘B
‰˝ˆ‚ɏ‘‚˘‚Ä‚ŕAŽŔŰ‚ɂ͐擪s“ǂݍž‚Ý‘OAŠes“ǂݍž‚ÝŽžAĹIs“ǂݍž‚ÝŒă‚É‚ť‚ę‚ź‚ę
ƒpƒ^[ƒ“ƒ}ƒbƒ`‚ލs‚í‚ę‚Ä‚˘‚éB
‚˝‚žƒ}ƒbƒ`‚ˇ‚éđŒ‚Ş“ÁŽę‚ž‚Š‚çAć“Ş‚ŠĹŒă‚Ĺ‚ľ‚Š’†‚Ě•ś‚ŞŽŔs‚ł‚ę‚Č‚˘‚ž‚ŻB

780 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/03/29(‰Î) 09:03:58.15 ID:/c8bAcK4
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’ö‚Ő‚ ‚˝‚ńi‚ľ‚ă‚Á‚ż‚傤‚Ü‚˘‚­‚ë‹łˆç’ˇŒđ‘ăjt•śŽˇs40‘㔄ăˇŠzƒVƒ…ƒK[ƒ`ƒ‡ƒR
https://www.youtube.com/watch?v=NDq1QoJY0nY‰Fƒhƒiƒ‹ƒhƒAƒiƒŠƒXƒgƒpƒ[ƒXƒg[ƒ“ƒR[ƒ`ƒ“ƒO‚Ć‚ľ‚Ü‚Ś‚ń
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’öŒĂ–{‰Ž‚ć‚ľ‚˝‚Ż‚ľ‚ă‚Á‚ż‚傤‚ż‚ĺ‚ą‚ľ‚ă‚Ş[
ƒfƒB[ƒ‰[Ĺ–ą“VËŠJ”­ŽŇŽ€–S‹l‚݃ˆƒ~ƒhƒNƒ^[ƒ}ƒCƒNƒƒT[ƒrƒX•s‘Ť
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’ö‚Ő‚ ‚˝‚ńƒVƒtƒgŒő‹ŕ‚ł‚Š‚˘‹­§ƒoƒCƒglŒ NŠQ–â‘č
t•ŞŽ‘ŒšŽˇsƒjƒ…[ƒˆ[ƒN’ጴ‰ż‚Ú‚Á‚˝ƒXƒe[ƒLƒ\ƒ‹ƒgƒŒƒCƒN•Ÿ‰Ş‰Ą•lV‹´“z—ę‰Ű‹ŕƒpƒ`ƒVƒtƒg‹­§ƒoƒCƒg–â‘čVŠƒ•ÄƒZƒ“ƒ^[śŽc
ƒRƒXƒ‚Q‚Sƒ`ƒƒƒŠƒeƒB[‰B‚ę40‘㐜Šˆ•ŰŒěƒvƒŒƒCƒ{[ƒCƒoƒCƒgƒŒ[ƒh‚˘‚˝‚č‚ ‚ńÚ‘Ň–â‘č
ƒ}ƒXƒRƒ~KARDƒ[ƒ“ƒP[ƒI[ƒT[ƒrƒX•s‘ŤĽŠˆƒp[ƒeƒB[Šń•t‹ŕŽˇsŒ´”­ƒrƒWƒlƒX
FBIƒ`ƒƒƒCƒj[ƒYƒ^ƒCƒzƒeƒ‹”„ăŽ––ąŠƒKƒ`ƒƒŒˆŽZƒKƒ`ƒƒƒLƒƒƒ“ƒy[ƒ“i”Ě”„•ń“šw‰ßŒƒ”h‘gDŒüŒg‘эŐVî•ń’ń‹ŸI—š
Z’ˇ”­Œž×S’ˆÓƒm[ƒgƒ“ŽY”pƒGƒ‰[(’˜ěŒ ƒNƒŒ[ƒ€’†‘”˝‰ž—ZŽ‘‚Šz‹łˆç”ď)(’†‘•ßŒ~’c‘Ě40‘ăŽĐˆőƒTƒbƒJ[ƒRƒƒ“ƒg
‚Šz“üŠw‹ŕƒ„ƒtƒEV‹´‘ĺŠwƒ„ƒtƒEV‹´—Ž–’ˇFXŒo”ď ‚¨‚ś‚â50‘㎑ŽYƒKƒŠƒoƒYƒtƒB[ƒh40‘ăƒGƒŠ[ƒg

781 Fawk–˝F2016/05/10(‰Î) 10:11:56.15 ID:qP72K9YB
mawk32.exe‚Łumultibyte charv‚ĚƒƒbƒZ[ƒW‚Ş‚Ĺ‚Ä˘‚Á‚Ä‚Ü‚ˇA‰˝‚ŞŒ´ˆö‚Ĺ‚ľ‚傤?
—}Ž~‚ˇ‚é•ű–@‚Í‚ ‚č‚Ü‚ˇ‚Š?
multibyteŽw’č‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒIƒvƒVƒ‡ƒ“‚Í–ł‚˘‚悤‚Č‚Ě‚Ĺ‚ˇ‚Ş?

782 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/10(‰Î) 13:22:33.71 ID:pT7b4QGj
UTF-8 ‚ŞŽg‚Ś‚Č‚˘‚Ě‚Š‚ŕ

umawk multibyte charv‚ĹŒŸőI

783 Fawk–˝F2016/05/11(…) 00:10:08.64 ID:EkexSAUH
„‚V‚W‚Q

ƒf[ƒ^‚ŕƒvƒƒOƒ‰ƒ€‚ŕ‚r‚i‚h‚r‚Ĺ‚ˇB
‰˝‚É”˝‰ž‚ľ‚Ä multibyte char‚ޏo‘ą‚Ż‚é‚Ě‚Š•s–ž‚Ĺ‚ˇB
‚‡‚‚—‚‹‚‘Ź‚Č‚Ě‚Ĺ–ž‘Ť‚Č‚Ě‚Ĺ‚ˇ‚ށA‚r‚s‚c‚d‚q‚q‚É multibyte char‚Ş‚Ĺ‘ą‚Ż‚é‚Ě‚Ĺ‚¤‚´‚˘‚ľA‚ą‚̏o—Í‚Ô‚ń‚ž‚Ż‘Ź“x‚ŕ’ቺH

784 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/11(…) 00:13:30.76 ID:Qn6YFszJ
“ü—Í‚ÉSJIS‚Ĺ‚Č‚˘•śŽš‚ލŹÝ‚ľ‚Ä‚˘‚é‚ą‚Ć‚Č‚˘H
nkf -s “ü—̓tƒ@ƒCƒ‹ | awk
‚Ĺ•ĎŠˇ‚ľ‚˝‚ç

785 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/11(…) 03:47:08.47 ID:6KznZIvs
ƒR[ƒh‚đ‹ł‚Ś‚ĉş‚ł‚˘B
ƒ`ƒƒƒŒƒ“ƒW‚ľ‚Ü‚ľ‚˝‚ށA‚ą‚ę‚Ĺ‚Íƒ_ƒ‚Ĺ‚ˇBB
(for i=1, i<=NF, i++){
if $i<0{$i=0}
}
print $0


‚ľ‚˝‚˘‚ą‚Ƃ́A‰ş‹L‚̂悤‚ȍs—ń‚̐”Žš‚Ş‚ ‚Á‚āA•‰‚Ě’l‚đƒ[ƒ‚É’uŠˇ‚ľ‚˝‚˘‚Ĺ‚ˇB

ĽŒł‚̍s—ń
3 15 6 1
-5 4 0 2
8 9 -7 11

Ľ‚â‚č‚˝‚˘•ĎŠˇŒă‚̍s—ńƒCƒ[ƒW
3 15 6 1
0 4 0 2
8 9 0 11

786 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/11(…) 04:14:37.49 ID:gi9ycYMA
\•ś‚Ş‚ş‚ń‚ş‚ń‘ʖځB
{for(i=1;i<=NF;i++)if($i<0){$i=0};print $0;}

u‚ľ‚˝‚˘‚ą‚Ƃ́A`‚ľ‚˝‚˘‚Ĺ‚ˇBv‚̍\•ś‚ŕ‘ʖځB“TŒ^“I‚Č‚Ë‚ś‚ę•śB

787 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/11(…) 07:39:07.59 ID:E3fj3Ww+
Ruby, Python ‚Č‚Ç‚đŽg‚Ś‚΁H

788 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/11(…) 12:31:52.37 ID:ZhRn3EDd
>>787
Ruby, Python ƒXƒNƒŠƒvƒg‚đ’ńŽŚ‚ľ‚Ä‚Ý‚ë‚ćB

789 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/11(…) 22:58:11.78 ID:Lckmn9CP
>>786
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇIo—ˆ‚Ü‚ľ‚˝I

(ˆęsƒvƒƒOƒ‰ƒ~ƒ“ƒOIawk•Ö—˜‚Ĺ‚ˇ‚Ë)

790 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/05/13(‹ŕ) 01:56:22.83 ID:VtzDMLxe
awk ‚ś‚á‚Č‚­‚Ä‚ŕ‚˘‚˘‚ń‚Č‚ç

$ sed 's/-[0-9][0-9]*/0/g' ...

GNU sed ‚Č‚ç

$ sed -r 's/-[0-9]+/0/g' ...

‚Ĺ‚Ś‚Ś‚ń‚ż‚ႤH

791 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/06/22(…) 00:21:13.08 ID:X+fwM1CQ
‚Š‚܂Ձ@uwƒVƒFƒ‹Œ|x‚ÉŒř‚­ AWKˆ•űⳁv

ƒGƒCƒzćśuAWK‚Á‚ÄŽg‚˘ŽĚ‚Ä‚ĚŒžŒęi’†—ށjƒvƒ‰ƒXƒAƒ‹ƒtƒ@‚̏ˆ—‚Ş‚â‚č‚˝‚˘‚ć‚ˁB
‚˝‚ž‚ť‚̏ˆ—‚Í‚Ć‚Ä‚ŕŠČ’P‚ȏˆ—‚Ĺ‚˘‚˘B‚ť‚ą‚ɑ΂ľ‚ĐV‚ľ‚˘ƒvƒƒOƒ‰ƒ€ŒžŒę‚đě‚Á‚Ä‚˘‚Ť‚˝‚˘v

AWKƒu[ƒ€‘ć1˘‘ă‚́uƒAƒCƒhƒ‹ŽŤ‘v‚ĹŠw‚ń‚ž\\“ú–{GNU AWKƒ†[ƒU[‰ď Ä“Ą‚ł‚ń (1/5)FCodeZineiƒR[ƒhƒWƒ“j
http://codezine.jp/article/detail/9478
2016/06/15 14:00

792 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/06/22(…) 23:46:54.12 ID:P+7nG182
‚â‚˝‚ç‚Ć‘ą‚Ť‚Í“o˜^‚ľ‚Ä“Ç‚ß‚ĆŒž‚í‚ę‚Ä‚ŕ‚Č‚ B
‚ą‚ĚƒXƒŒ‚Ş—§‚Á‚˝ ‚Š‚çJGAUC‚ĚHP‚ލXV‚ł‚ę‚Ä‚˘‚Č‚˘‚Á‚Ä‚Ě‚ŕŚ‚˘B

793 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/08/27(“y) 09:20:46.26 ID:2q8s4uQl
Windows”Ĺ‚Ěgawk‚Ĺ—V‚ń‚Ĺ‚˝‚ç
for (i=0; i<n; i++) ‚ć‚č
for (i=0; i<n; i+=1) ‚Ě‚Ů‚¤‚Ş
ŽŔsŽžŠÔ‚Ş’Z‚­‚Č‚é‚ą‚Ć‚É‹C‚Ă‚˘‚˝
‚Č‚ń‚ž‚ą‚č‚á

794 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/13(‰Î) 23:56:36.77 ID:mfLTwPLq
for(i=1;i<=1000000;i++){a[i]=1}
‚Ć
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
Œ‹‰Ę‚Í“Ż‚ś‚Í‚¸‚Ȃ̂ɁAŒăŽŇ‚ÍˆŮí‚Ƀƒ‚ƒŠ‚đH‚¤I‚Ó‚ľ‚ŹI

795 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/14(…) 00:22:19.58 ID:YCeX8Gov
“Ż‚ś‚ś‚á‚Č‚˘‚źB”’l‚Ć•śŽš—ń‚žB
‚Ć‚ą‚ë‚ŁAŒN‚ŞŽg‚Á‚Ä‚é awk ‚Í‚Ç‚ę?

apropos awk

‚Á‚Ä‚â‚Á‚Ä‚Ý‚˝‚çA‚ą‚ń‚Č‚ńo‚Ä‚Ť‚˝B

gawk (1) - ƒpƒ^[ƒ“ŒŸőEˆ—ŒžŒę
igawk (1) - ƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚đŽg‚¤ gawk
a2p (1) - Awk to Perl translator
awk (1) - pattern scanning and text processing language
English (3perl) - use nice English (or awk) names for ugly punctuation v...
mawk (1) - pattern scanning and text processing language
nawk (1) - pattern scanning and text processing language

796 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/14(…) 22:01:59.31 ID:DqYC5LBT
>>795
—á‚ŞˆŤ‚­‚ăXƒ}ƒ\ACygwină‚Ĺgawk4.1.4Žg‚Á‚Ä
for(i=1;i<=1000000;i++){a[i]="1"}
‚Ć
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
‚Ĺƒ‹[ƒv’Eo’źŒă‚Ěƒƒ‚ƒŠŽg—p—Ę‚đ”äŠr‚ˇ‚é‚Ć
ă‚Ş60MBytesA‰ş‚Ş600MBytes‚Ć‚Š‚É‚Č‚Á‚˝

cmd‚Ĺ“Ž‚­gawk‚Ě3.1.7‚Ĺ‚ŕ“Ż‚ś‚悤‚ȍˇ‚Ş‚Ĺ‚˝
Linux‚ÍŽŽ‚ľ‚Ä‚˘‚Č‚˘‚Ż‚ǁA‚ŕ‚ľ‘ĺä•v‚Č‚çWindows”Ĺ‚Ě–â‘č‚Š‚ŕ

797 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/14(…) 22:50:10.30 ID:PWB0Awgu
>>796
OSX El Capitan
gawk 4.1.4

‚ť‚ę‚ź‚ęBEGIN{}‚É“ü‚ę‚˝ƒXƒNƒŠƒvƒg‚đ“ǂݍž‚Ü‚š‚ÄŽŔsB
‚Ĺ‘OŽŇ”\MBAŒăŽŇ3GB’´‚Ü‚Ĺƒƒ‚ƒŠŽg‚Á‚˝iƒAƒNƒeƒBƒrƒeƒBƒ‚ƒjƒ^jB

798 F795F2016/09/14(…) 23:40:38.22 ID:YCeX8Gov
‚â‚Á‚Ä‚Ý‚˝‚ćBŠÂ‹Ť‚Í Debian jessieB
ƒeƒXƒgƒvƒƒOƒ‰ƒ€

#!/usr/bin/perl -w
use strict;
{
my $do_ps = 'system("ps p $PPID o pid,sz,args")';
foreach ( 1,'sprintf("1")'){
system('gawk',"BEGIN { for(i=1;i<=1000000;i++){a[i]=$_} $do_ps;}");
}
}

ŽŔsŒ‹‰Ę

PID SZ COMMAND
7389 7693 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=1} system("ps p $PPID o pid,sz,args");}
PID SZ COMMAND
7392 158116 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=sprintf("1")} system("ps p $PPID o pid,sz,args");}

KB ’PˆĘ‚ç‚ľ‚˘‚Š‚ç 8MB ‚Ć 160MB B‚˝‚ž‚˛‚Ć‚ś‚á‚Č‚˘ˇ‚ž‚ˁB
1 ‚đ "1" ‚É•ĎX‚ľ‚Ä‚ŕ‚ą‚ń‚ČŠ´‚ś‚ž‚Š‚琔’l‚Ć•śŽš—ń‚̍ˇ‚Ć‚˘‚¤‚í‚Ż‚Ĺ‚Í‚Č‚ł‚ť‚¤B

799 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/14(…) 23:49:14.48 ID:YCeX8Gov
‚˛‚ß‚ńA‘‚Ť–Y‚ę‚˝B

GNU Awk 4.1.1, API: 1.1 (GNU MPFR 3.1.2-p3, GNU MP 6.0.0)
Copyright (C) 1989, 1991-2014 Free Software Foundation.

800 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/17(“y) 08:30:37.61 ID:didBD5ba
‚ć‚­l‚Ś‚˝‚çAƒƒ‚ƒŠ‚ĚŽg—p—ĘŽŠ‘Ě‚ś‚á‚Č‚­‚āA‚ť‚ę‚Ş‚Ç‚ę‚ž‚Ż‘‚Ś‚˝‚Š‚ޏd—v‚ž‚ˁB
‚ť‚ľ‚āA˜A‘z”z—ń‚̍\‘˘‘Ě‚ĆƒL[‚É•K—v‚Č—Ę‚Í‚Ç‚ĚƒP[ƒX‚Ĺ‚ŕ“Ż‚ś‚ƍl‚Ś‚ç‚ę‚éB
‚‚܂čA˜A‘z”z—ń‚Ě—v‘f‚Ě‚˝‚ß‚Ě—Ę‚Ş‚Ç‚ę‚ž‚Żˆá‚¤‚Š‚𒟐ڒm‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚é‚Í‚¸B
‚Ć‚˘‚¤‚í‚Ż‚ŁA‚ŕ‚¤ˆę‰ńƒeƒXƒgB

https://ideone.com/mRuFj7

801 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/17(“y) 08:32:42.20 ID:didBD5ba
ŽŔsŒ‹‰Ę

element before after diff
1 5685 7691 2006
i 5685 29226 23541
sprintf("%d",i) 5685 158124 152439
sprintf("%d",i) + 0 5685 29221 23536
sprintf("%d",i) "" 5685 37026 31341

1000000 —v‘f‚Ě”z—ń‚Ĺ 2MB ‚Á‚āA‚˘‚Á‚˝‚˘‚Ç‚¤‚â‚Á‚Ä‚é‚ń‚ž‚낤B­‚Č‚ˇ‚Ź‚éB
sprintf("%d",i) ‚ޓˏo‚ľ‚Ä‘˝‚˘‚Ě‚Í sprintf ‚Ĺ‘˝‚ß‚ÉŠm•Ű‚ľ‚Ä
Ř‚č‹l‚ß‚˝‚č‚š‚¸‚É‚ť‚Ě‚Ü‚ÜŽg‚Á‚Ä‚é‚Ě‚ž‚낤‚ŠB
‚ł‚ Agawk ‚Ěƒ\[ƒXƒR[ƒh‚đƒnƒbƒN‚ľ‚Ä‚Ý‚é‚Š!

802 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/17(“y) 14:11:27.89 ID:IIH0ZjSk
„‘Ş‚ž‚Ż‚ǁAstream, yield, callbackA’x‰„ˆ—‚Š‚ŕ

ƒf[ƒ^‚đƒoƒbƒtƒ@ƒTƒCƒY•Ş‚ž‚Ż“ǂݍž‚ń‚ŏˆ—‚ľ‚āA
ŽŸ‚ĚƒRƒ}ƒ“ƒh‚Ö‘—‚Á‚˝‚çA‚ť‚ę‚đŽĚ‚ĂāAŽŸ‚Ěƒf[ƒ^‚đ“ǂݍž‚Ţ‚Ě‚Š‚ŕ

‚ą‚Ě•űŽŽ‚ž‚Ćƒƒ‚ƒŠ‚́Aƒoƒbƒtƒ@ƒTƒCƒY•Ş‚ž‚Ż‚ľ‚ŠŽg‚í‚Č‚˘

803 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 10:41:36.96 ID:6jI6cHER
ƒxƒNƒ^[‚ÉŒöŠJ‚ł‚ę‚Ä‚égawk3.1.5i‚Ć”ńŒöŠJ‚Ě3.1.7jAƒwƒ“ƒeƒR‚ȏˆ—‚ŞŒŠ‚‚Š‚Á‚˝‚Ě‚Ĺƒƒ‚
‚ą‚Ěgawk‚ĚsystemŠÖ”‚đŽŔs‚ˇ‚é‚ƁAŠÂ‹Ť•Ď”TMP‚ŞŽw‚ľ‚Ä‚éƒtƒHƒ‹ƒ_‚É
@echo off
systemŠÖ”‚Ěˆř”
‚Ć‚˘‚¤2s‚ޏ‘‚Š‚ę‚˝ƒoƒbƒ`ƒtƒ@ƒCƒ‹pip?.bati?‚ÍsystemŽŔs‰ń”+1j‚Ć‚˘‚¤‚Ě‚ŞěŹ‚ł‚ę

804 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 10:44:42.56 ID:6jI6cHER
EEE‚˘‚Á‚Ř‚ń‚ɏ‘‚ą‚¤‚Ć‚ľ‚˝‚çƒnƒl‚ç‚ę‚éorz

805 F803F2016/09/18(“ú) 10:46:32.08 ID:6jI6cHER
(‘ą‚Ť)
‚ť‚ę‚đ/c pip?.bat‚Ĺ‹N“ŽAŠŽ—šŒă‚Épip?.bat‚đ
íœ‚Ć‚˘‚¤—Ź‚ę‚ĹƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚é

806 F803F2016/09/18(“ú) 10:47:07.98 ID:6jI6cHER
(‘ą‚Ť)
systemŠÖ”‚đŽg‚Á‚˝ƒXƒNƒŠƒvƒg‚đ“ŻŽž‚É1‚‚ľ‚ŠŽŔs‚ľ‚Č‚˘‚Č‚ç—Ç‚˘‚Ż‚Ç
2‚ÂˆČăŽŔs‚ľ‚˝‚Ć‚Ť‚̓^ƒCƒ~ƒ“ƒOŽŸ‘ć‚Ĺpip?.bat‚̐”Žš‚ނԂ‚Š‚čAć‚ÉŽŔs‚ľ‚˝‘¤‚Ş
E ƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚Č‚˘
E ƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚é‚Ż‚ǁAŠŽ—šŒă‚Ɂuƒoƒbƒ`ƒtƒ@ƒCƒ‹‚ŞŒŠ‚‚Š‚č‚Ü‚š‚ńv‚Ş“f‚Š‚ę‚é
‚Ć‚˘‚¤Œ‹‰Ę‚É‚Č‚é

—\‚ßcmd‚Ě‘‹‚˛‚Ć‚ÉTMP‚đ•Ď‚Ś‚Ä‚¨‚Ż‚Ζâ‘č‚Č‚˘‚Ż‚Ç–Ę“|‚­‚ł‚˘
ƒRƒ}ƒ“ƒh | getline‚Ĺ‹N“Ž‚ľ‚˝‚Ů‚¤‚ŞŽč‚ÁŽć‚葁‚˘‚ĆŽv‚¤
i‚˝‚ž‚ľo—Í‚Ş2KBytes—­‚Ü‚é‚ĆŽ~‚Ü‚é‚Š‚ç“K‹XƒŠƒ_ƒCƒŒƒNƒg‚ˇ‚éj

‚Ĺ‚ŕ‰˝‚Ĺ‚ą‚ń‚Č•ű–@‚ĹsystemŠÖ”‚đŽŔ‘•‚ľ‚˝‚ń‚ž‚낤‚Ë(LEƒÖEM)

807 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 13:53:41.51 ID:EIh/dcA1
tmpfile ‚đŽg‚Ś‚΁A‘ź‚Əd•Ą‚ľ‚Č‚˘Aƒ‰ƒ“ƒ_ƒ€‚Č–ź‘O‚Ěƒtƒ@ƒCƒ‹‚đě‚ę‚é‚̂ɁA

‚Ç‚¤‚ľ‚ÄŽg‚í‚Č‚˘‚Ě‚ž‚낤H

808 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 14:54:02.97 ID:KtcAr9oX
MS-DOS ‚ł͂ˁAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚Ě’ˇ‚ł‚̐§ŒŔ‚ŞŒľ‚ľ‚Š‚Á‚˝‚ń‚ž‚ćB‹Á‚­‚Č‚Š‚ęA‚˝‚Á‚˝ 128 ƒoƒCƒg‚žB
‚ť‚ń‚Ȋ‹Ť‚ł́Aƒoƒbƒ`ƒtƒ@ƒCƒ‹‚É‚ˇ‚ę‚ÎŽŔs‚Ĺ‚Ť‚é‚Ż‚Ç

command /c "prog arg1 arg2 ..."

‚Ĺ‚Í command /c ‚Ě‚š‚˘‚Ő§ŒŔ‚đ‰z‚Ś‚é‚Ć‚˘‚¤‚ą‚Ć‚ŕ‚ ‚é‚ž‚낤B‚‚܂čA‚ť‚¤‚˘‚¤‚ą‚Ć‚žB
cccç’k‚žBŠm‚Š‚É‚ť‚¤‚˘‚¤§ŒŔ‚Í‚ ‚Á‚˝‚Ż‚ǁB
ŒťÝ‚Í‚ŕ‚¤ system ŠÖ”‚Ĺ‚Í‚ť‚¤‚˘‚¤‚ą‚Ć‚đ‚ľ‚Ä‚˘‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć‚Ş ChangeLog ‚ɏ‘‚Š‚ę‚Ä‚é‚ćB

2014-01-15 Eli Zaretskii <eliz@gnu.org>
* popen.c (os_system): Use spawnl, and quote the command line, to be consistent with what gawk_popen does.
(os_popen) [__MINGW32__]: Don't scriptify the command, to be consistent with gawk_popen.
(os_pclose) [__MINGW32__]: Update to match os_open: no need to unlink the script file.

809 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 15:07:54.47 ID:KtcAr9oX
‚Ĺ‚ŕƒ\[ƒXƒR[ƒh‚đŒŠ‚é‚Š‚Ź‚čAƒpƒCƒv‚Ĺ‚Í‚ť‚¤‚˘‚¤‚ą‚Ć‚đ‚ľ‚Ä‚é‚Ý‚˝‚˘‚Č‚ń‚ž‚Ż‚ǁcc
‚ż‚ĺ‚Á‚ĆŽŽ‚ľ‚Ä‚Ý‚Ä‚­‚ę‚Č‚˘‚Š‚ȁB

system("dir") | getline

‚Ý‚˝‚˘‚ČŠ´‚ś? ‚ć‚­’m‚ç‚Č‚˘‚Ż‚ǁB

810 F803F2016/09/18(“ú) 16:19:12.82 ID:6jI6cHER
ƒRƒ}ƒ“ƒh | getline ‚Ĺ‹N“Ž‚ˇ‚éę‡‚Ípip?.bat‚͍ě‚ç‚ę‚Ü‚š‚ń‚Ĺ‚ľ‚˝
systemŠÖ”‚ž‚Żpip?.batŒo—R‚Ě–Í—l
klabaster”Ĺ‚Ěwindows—pgawk4.1.3‚ž‚ĆsystemŠÖ”‚Şpip?.bat‚đ
ě‚ç‚Č‚Š‚Á‚˝‚Š‚çAƒxƒNƒ^[”ĹŒĹ—L‚Ě“Ž‚Ť‚Š‚Č‚ ‚ĆŽv‚˘‚Ü‚ˇ

811 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 17:46:00.36 ID:KtcAr9oX
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
gawk-4.1.1 ‚Ě pc/popen.c ‚đŒŠ‚˝ŒŔ‚č‚Ĺ‚Í gawk ‚Ě system ŠÖ”‚Ĺƒoƒbƒ`ƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í MINGW ŒŔ’č‚ŁA
ChangeLog ‚É‚Í–â‘č‚Ş‰đÁ‚ł‚ę‚˝‚Š‚ç’źÚ spawnl ‚ĹŽŔs‚ˇ‚é‚悤‚É‚ľ‚˝‚Ə‘‚Š‚ę‚Ä‚˘‚é‚í‚Ż‚Ĺ‚ˇ‚Ş
gawk ‚ĚƒpƒCƒvˆ—‚đŽŔs‚ľ‚Ä‚˘‚é(‚ĆŽv‚í‚ę‚é) os_popen ŠÖ”‚Ĺ‚Íƒoƒbƒ`ƒtƒ@ƒCƒ‹‚đě‚é‚Ć‚Ť‚Ć“Ż—l‚É
tempnam ŠÖ”‚Ĺƒtƒ@ƒCƒ‹–ź‚đě‚Á‚˝ă‚ŁA‚ť‚Ěƒtƒ@ƒCƒ‹‚đŒo—R‚ľ‚ÄŽó‚Ż“n‚ľ‚đ‚ľ‚Ä‚˘‚é‚悤‚ÉŒŠ‚Ś‚Ü‚ˇB
‚ą‚ę‚Í MS-DOS ‚ĚŽž‘ă‚Š‚çŽg‚í‚ę‚Ä‚é‚â‚č•ű‚ŁAƒpƒCƒv‚̂悤‚ÉŒŠ‚Ś‚Ä‚ŕƒpƒCƒv‚Ĺ‚Í‚ ‚č‚Ü‚š‚ńB
‚ą‚Ě‚â‚č•ű‚ž‚Ć gawk ‚Ĺ

while (( command | getline) > 0)

‚Ə‘‚˘‚Ä‚ŕŽŔŽż“I‚É‚Í

system("command > filename"); while (( getline < "filename") > 0)

‚Ć“Ż‚ś‚ą‚Ć‚É‚Č‚č‚Ü‚ˇB
‚ ‚­‚Ü‚Ĺ‚ŕ 4.1.1 ‚Ě pc/popen.c ‚Ě os_popen ŠÖ”‚Ş‚ť‚¤ŒŠ‚Ś‚é‚Ć‚˘‚¤‚ž‚Ż‚ŁAŽŔŰ‚ɂ͈Ⴄ‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ş
ŽŠ•Ş‚ĹŽŽ‚ˇ‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚š‚ńB‚ť‚ŕ‚ť‚ŕ 3.1.5 ‚Ěƒ\[ƒXƒR[ƒh‚Á‚Ä‚Ç‚ą‚É‚ ‚é‚Ě?
‚ŕ‚ľŠ¨ˆá‚˘‚ś‚á‚Č‚˘‚Č‚ç >>806 ‚Ć“Ż‚ś–â‘č‚Ş‹N‚ą‚č‚ť‚¤‚Č‹C‚ށcc
Linux ‚đŽg‚Á‚Ă鎊•Ş‚É‚ÍŠÖŒW‚Č‚˘‚Ć‚˘‚Á‚Ä‚ľ‚Ü‚Ś‚΂ť‚ę‚Ü‚Ĺ‚Ĺ‚ˇ‚ށB

812 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 19:56:17.75 ID:zTPoEkjL
>>811
vector‚Ě”z•zƒtƒ@ƒCƒ‹“ŕ‚Ěreadme‚ɂ̓\[ƒXƒR[ƒh‚Ě
ŒöŠJęŠ‚đ’T‚ľ‚Ä‚é‚Ć‚ŠA’źÚ˜A—‚ˇ‚ę‚Γn‚ˇ‚Ć‚Š‘‚˘‚Ä‚ ‚éB

Windows”ŁANT‚ ‚˝‚č‚Š‚çˆęŽžƒtƒ@ƒCƒ‹ě‚炸‚ɃpƒCƒv“Žě‚ˇ‚é‚悤‚É
‚Č‚Á‚˝‚Ć‚ŠA‚Ç‚ą‚Š‚Ĺ“Ç‚ń‚ž‹C‚Ş‚ˇ‚é‚Ż‚ǁB

813 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/18(“ú) 22:03:20.37 ID:KtcAr9oX
“ä‚Í‰đ‚Ż‚˝B
ƒtƒ@ƒCƒ‹‚đŽg‚Á‚ăf[ƒ^‚đ“n‚ˇ‚Ě‚Íƒ}ƒNƒ __DJGPP__ ‚Ćƒ}ƒNƒ __MINGW32__ ‚Ş
‚˘‚¸‚ę‚ŕ’č‹`‚ł‚ę‚Ä‚˘‚Č‚˘ę‡‚ç‚ľ‚˘‚Ĺ‚ˇB
Vector ‚Ě‚Í MINGW ‚Č‚Ě‚ĹŠY“–‚ľ‚Ü‚š‚ńB‚¨‘›‚Ş‚š‚ľ‚Ü‚ľ‚˝B

814 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/19(ŒŽ) 11:56:06.00 ID:iIvzjj/t
ƒtƒ@ƒCƒ‹‚đŒo—R‚ľ‚Ä‚˘‚Ä‚ŕAƒXƒgƒŒ[ƒW‚ɏ‘‚Ťž‚Ţ‚Ć‚ÍŒŔ‚ç‚Č‚˘

ƒƒ‚ƒŠă‚ž‚Ż‚É‘śÝ‚ˇ‚éAƒtƒ@ƒCƒ‹‚ŕ‚ ‚č“ž‚éB
Linux‚ĚRAMƒfƒBƒXƒNAtmpfs ‚Ć‚Š

815 F803F2016/09/19(ŒŽ) 14:26:19.66 ID:fDWhtT6v
>>811
î•ń‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB>>803‚ŏ‘‚˘‚˝uƒwƒ“ƒeƒR‚ȏˆ—v‚đpc\popen.c“ŕ‚ÉŠm”F‚Ĺ‚Ť‚Ü‚ľ‚˝B
scriptifyŠÖ”‚ĚtempnamŒÄ‚ń‚Ĺ‚é‚Ć‚ą‚ë‚ĹƒvƒƒZƒXID‚ŕ‚‚Ż‚é‚Č‚čA×H‚ľ‚˝‚˘‚Č‚ EEE

816 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/20(‰Î) 17:00:26.41 ID:RIxgZ1yj
ć“úƒAƒNƒZƒX‚Ĺ‚Ť‚Č‚Š‚Á‚˝ GNU ‚ĚƒTƒCƒg‚Ş•œŠˆ‚ľ‚Ä‚˝‚Ě‚Ĺ 3.1.5 ‚Ěƒ\[ƒXƒR[ƒh‚đ“üŽč‚Ĺ‚Ť‚Ü‚ľ‚˝B
‚â‚Á‚Ď‚č os_popen ‚Š‚ç‚ŕ scriptify ‚đŒÄ‚ń‚Ĺ‚˝‚Ý‚˝‚˘‚Ĺ‚ˇ‚ˁB4.1.1 ‚Ěƒ\[ƒXƒR[ƒh‚ś‚ᔝ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
ˆę‰ž chdir ‚̓Aƒgƒ~ƒbƒN‚ȏˆ—‚Ě‚Í‚¸‚Č‚Ě‚ĹƒŠƒXƒN‰ń”đ‚ɖ𗧂‚Ǝv‚˘‚Ü‚ˇ‚ćB‚ť‚ęˆČŠO‚É•ű–@‚Ş‚Č‚Ż‚ę‚΁B
chdir ‚ľ‚˝‚ç rmdir ‚ŕ–Y‚ꂸ‚ɁB

817 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/20(‰Î) 17:06:03.57 ID:RIxgZ1yj
ŠÔˆá‚Ś‚˝Bchdir ‚ś‚á‚Č‚­‚Ä mkdir ‚Ĺ‚ˇB

818 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/22(–Ř) 12:11:24.09 ID:nnsRF/zz
>>794
‚Ç‚¤‚â‚ç >>801 ‚Ĺ‘z‘œ‚ľ‚˝’Ę‚č sprintf ‚ĚŽd—l‚ç‚ľ‚˘B
–{‘Ě‚Í builtin.c ‚Ě format_tree ŠÖ”‚ç‚ľ‚˘B
Ĺ‰‚É 512 ƒoƒCƒgŠm•Ű‚ľ‚˝ƒoƒbƒtƒ@‚Í‘ĺ‚Ť‚­‚Í‚Č‚Á‚Ä‚ŕŹ‚ł‚­‚Í‚Č‚ç‚Č‚˘B
ŽŔŰ‚Ě•śŽš—ń‚ɍ‡‚í‚š‚ÄŠm•Ű‚ľ‚Č‚¨‚ľ‚˝‚ç‚Ç‚¤‚Č‚é‚Š >>800 ‚ĚƒeƒXƒg‚đ‚ľ‚Ä‚Ý‚˝‚ćB

‰ü‘˘‘O
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@151283@148530
sprintf("%d",i) + 0@@@@@ 2753@ 22376@ 19623
sprintf("%d",i) ""@@@@@@2753@ 30174@ 27421

‰ü‘˘Œă
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@ 30174@ 27421
sprintf("%d",i) + 0@@@@@ 2753@ 22373@ 19620
sprintf("%d",i) ""@@@@@@2753@ 30230@ 27477

‚ ‚ęH jessie ‚Ě gawk ‚Ć”ä‚ׂăƒ‚ƒŠ‚ĚŽg—p—Ę‚Ş­‚Č‚˘B
-DDEBUG •t‚Ť‚ĹƒRƒ“ƒpƒCƒ‹‚ľ‚˝‚Š‚瑝‚Ś‚é‚Š‚ĆŽv‚Á‚˝‚̂ɁB
‚Ü‚ A‚ť‚ęˆČŠO‚Íˆę‰ž—\‘z’Ę‚č‚Ĺ‚Í‚ ‚éB

819 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/22(–Ř) 23:15:31.17 ID:SYBS8P/o
>>793‚Ć‚Š
•śŽš—ń‚Ě˜AŒ‹‚Í "A" "B" ‚ć‚č‚ŕsprintf("%s%s", "A", "B") ‚Ě•ű‚Ş‘Ź‚˘‚Ć‚Š
gawk‚Á‚ÄŒ‹\ƒNƒZ‚ ‚č‚Ü‚ˇ‚Ë

820 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/23(‹ŕ) 02:39:22.63 ID:o4qLonoN
>>819
> •śŽš—ń‚Ě˜AŒ‹‚Í "A" "B" ‚ć‚č‚ŕsprintf("%s%s", "A", "B") ‚Ě•ű‚Ş‘Ź‚˘
ƒ}ƒW‚ŠB‹t‚ž‚Ć•ˇ‚˘‚Ä‚˘‚˝‚ށB

821 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/23(‹ŕ) 16:06:39.19 ID:Y+5MXC/e
‚ť‚ń‚ČƒoƒJ‚ȁcc‚ĆŽv‚Á‚Ä‚â‚Á‚Ä‚Ý‚˝B

https://ideone.com/jIYn2p

jessie —p‚ĚƒpƒbƒP[ƒW‚É‚ć‚éŽŔsŒ‹‰ĘB

i++@@@@@@@@@6.15614
i = i + 1@@@@@@6.02501
cat " and " dog@@@13.0163
sprintf@@@@@@@19.1612

ƒCƒ“ƒNƒŠƒƒ“ƒg‚Ć‘Ť‚ľŽZ‚̍ˇ‚Í—LˆÓ‚Ć‚ÍŽv‚Ś‚Č‚˘B
˜AŒ‹‚Ć sprintf ‚̍ˇ‚Í‘˝•ŞA”{‚­‚炢B
sprintf ‚Ě’†‚Ě•ĄŽG‚ł‚đl‚Ś‚ę‚ΈӊO‚ƍˇ‚͏Ź‚ł‚˘‚Ć‚˘‚Ś‚éB
ƒtƒH[ƒ}ƒbƒg•śŽš—ń‚Ş’č”‚Ȃ琳‹K•\Œť‚Ý‚˝‚˘‚ɃRƒ“ƒpƒCƒ‹‚ˇ‚ę‚Î
‚‘Ź‰ť‚Ĺ‚Ť‚écc‚Ě‚Š‚Č‚ ? ŽŠ•Ş‚Ĺ‚â‚Á‚Ă݂悤‚Ć‚Í(Ą‚Í‚Ü‚ž)Žv‚í‚Č‚˘B

822 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/24(“y) 23:15:47.76 ID:+IiHRmp0
Windows‚ĹŽg‚Ś‚éawk‚ĹUnicode‚𐳂ľ‚­ˆ—‚Ĺ‚Ť‚éilength("‚ ‚˘‚¤")‚Ĺ3‚Ş•Ô‚Á‚Ä‚­‚éj‚ŕ‚Ě‚Í
Cygwin”Ĺ‚ĆVector”ĹˆČŠO‚É–ł‚˘‚Ĺ‚ľ‚傤‚ŠH

823 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/25(“ú) 10:08:34.07 ID:BH82R274
‰˝‚Ş‚ ‚Á‚˝‚ń‚Ĺ‚ˇ‚Š?

http://tanimoto.to/nlp/jgawk/jgawk.html

‚ɏ‘‚Š‚ę‚Ä‚˘‚é‚悤‚Č‚ą‚Ć‚Ĺ‚ˇ‚Š? •Ę‚Ě‘I‘đŽˆ‚ŕˆę‰ž‚ ‚é‚Ý‚˝‚˘‚Ĺ‚ˇ‚ށB
ƒgƒ‰ƒ“ƒXƒŒ[ƒ^‚Ĺ‚ŕ‚˘‚˘‚Č‚ç Perl ‚É a2p ‚Ş“ŻŤ‚ł‚ę‚Ä‚Ü‚ˇB

824 F822F2016/09/25(“ú) 14:28:36.60 ID:MNlfsMjx
“Á‚ɍ˘‚育‚Ć‚Í–ł‚˘‚Ě‚Ĺ‚ˇ‚ށAĹV‚ĚVer4.1.4‚â‚ť‚Ě‹ß•Ó‚Ěƒo[ƒWƒ‡ƒ“‚Ĺ
Unicode‚ސł‚ľ‚­ˆ—‚Ĺ‚Ť‚é‚ŕ‚Ě‚Ş‚ ‚ę‚΁AĄŽg‚Á‚Ä‚˘‚éBruce”Ĺ3.1.7‚Š‚ç
ć‚芡‚Ś‚˝‚˘‚Č‚ ‚ĆŽv‚˘‚Ü‚ľ‚āB

Ť‚Ě5”N‘O‚ɏ‘‚Š‚ę‚˝‹LŽ–‚̍ ‚ć‚č‘I‘đŽˆ‚Ş‘‚Ś‚˝‚č‚ľ‚Ä‚˝‚çŠđ‚ľ‚˘‚ȂƁEEEB
http://blog.livedoor.jp/corbie/archives/3924154.html

825 F823F2016/09/26(ŒŽ) 09:17:05.22 ID:bhAuZr+w
—‰đ‚ľ‚Ü‚ľ‚˝B‘S–Ĺ‚ž‚Á‚˝‚ń‚Ĺ‚ˇ‚ˁB
Windows ‚Ĺ‚ĚŽ–î‚Í‘ś‚ś‚Ü‚š‚ń‚ށA‚ą‚ż‚ç‚Ĺ‚ŕŽć‚č‹}‚Ź gawk 3.1.5 ‚đ make ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
‚Ć‚ą‚ë‚ŁA‚ť‚Ěƒy[ƒW‚ĚƒeƒXƒg3‚Í•s\•Ş‚Ĺ‚ˇB
UTF-8 ‚Ĺ‚Ěƒpƒ^[ƒ“ƒ}ƒbƒ`‚Í’Ęí•śŽš‚ĚŒëƒ}ƒbƒ`‚ÍŒ´—“I‚É‹N‚ą‚č‚Ü‚š‚ńB‹N‚ą‚Á‚˝‚çƒoƒO‚Ĺ‚ˇB
‚ž‚Š‚çAUTF-8 ‚ɑΉž‚ľ‚Ä‚˘‚é‚Š‚Ç‚¤‚Š‚đƒeƒXƒg‚ˇ‚é‚˝‚ß‚É
sub(/.‚¤/, "U")
‚Ć‚˘‚¤‚悤‚Č‚ŕ‚Ě‚đ“ü‚ę‚ÄŽŽ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
Ąƒrƒ‹ƒh‚ľ‚˝‚΂Š‚č‚Ě gawk 3.1.5 ‚Ć jessie ‚ĚƒpƒbƒP[ƒW‚Ě gawk 4.1.1 ‚Ş‚ą‚ĚƒeƒXƒg‚ɍ‡Ši‚ľ‚Ü‚ľ‚˝B
mawk 1.3.3 ‚ŕƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚Ä‚Ü‚ľ‚˝‚ށA‚ą‚ż‚ç‚̓}ƒ‹ƒ`ƒoƒCƒg•śŽš‚ɑΉž‚ľ‚Ä‚˘‚Č‚˘‚悤‚Ĺ‚ˇB

‚ł‚āAŒ‹˜_‚Ĺ‚ˇB
ƒVƒtƒgJIS ‚ɑΉž‚ľ‚Ä‚˘‚é‚Ć‚ł‚ę‚é‚ŕ‚Ě‚Í”đ‚Ż‚˝•ű‚Ş‚˘‚˘‚ĆŽv‚˘‚Ü‚ˇB
—]Œv‚ȉü‘˘‚Í‚ľ‚Č‚˘•ű‚ސM—ŠŤ‚͍‚‚˘‚Ĺ‚ľ‚傤B
length ‚ރoƒCƒg”‚Ȃ̂́A’P‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•śŽš”ń‘Ήž‚ĹƒRƒ“ƒpƒCƒ‹‚ł‚ę‚Ä‚é‚Š‚ç‚ž‚ĆŽv‚˘‚Ü‚ˇB
ƒ}ƒ‹ƒ`ƒoƒCƒg•śŽš‘Ήž”Ĺ‚đ’N‚Š‚ރŠƒŠ[ƒX‚ľ‚Ä‚­‚ę‚é‚Ě‚đ‘҂‚ŠAŽŠ•Ş‚ĹƒRƒ“ƒpƒCƒ‹‚ˇ‚é‚Š‚Ĺ‚ˇ‚ˁB

826 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/27(‰Î) 17:33:47.16 ID:Icjzq3KF
Linux ‚ł͊‹Ť•Ď” LANG ‚É UTF-8 ‚Ş“ü‚Á‚Ä‚Č‚˘‚ĆŠú‘Ň’Ę‚č‚É“Ž‚˘‚Ä‚­‚ę‚Ü‚š‚ńB
łŠm‚É‚Í LANG ‚Ć‚˘‚¤‚ć‚č LC_CTYPE ‚Ĺ‚ˇ‚ށA‚ť‚ę‚Í‚¨‚˘‚Ć‚˘‚āB
‚ŕ‚ľ‚Š‚ľ‚˝‚ç‚ĆŽv‚Á‚āAŽŠ•Ş‚É‚Í–ł—p‚ž‚ĆŽv‚Á‚Ä‚˝ Wine ‚Ĺ klabaster gawk 4.1.3 ‚đ“Ž‚Š‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
‚Ć‚ą‚ë‚ŞAł‹K•\Œť‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•śŽš‚ŞŒť‚ę‚˝Žž“_‚Ĺ“{‚ç‚ę‚Ü‚ˇB
‚Ç‚¤‚â‚ç LANG ‚Ş–ł‚˘‚ŠALANG=C ‚ś‚á‚Č‚Ż‚ę‚΃}ƒ‹ƒ`ƒoƒCƒg•śŽš‚đŽg‚Ś‚Č‚˘‚悤‚Ĺ‚ˇB
‚ť‚ľ‚ÄŒ‹‹ÇAł‹K•\Œť‚Ě . ‚â length ‚đ UTF-8 ƒ‚[ƒh‚É‚ˇ‚é•ű–@‚ÍŒŠ‚‚Ż‚ç‚ę‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
‹LŽ–‚ĚƒRƒƒ“ƒg‚É‚Í LC_ALL=ja_JP.UTF-8 ‚Ĺ“Ž‚­‚Á‚ď‘‚˘‚Ä‚ ‚é‚̂ɁB
‚Đ‚ĺ‚Á‚Ć‚ľ‚āAWindows ‚Ĺ‚ÍŒ´—“I‚É‚Ĺ‚Ť‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć?
‚ą‚ę‚Í‚˘‚悢‚ć a2p ‚ŞŒťŽŔ“I‚Č‘I‘đŽˆ‚Š?
cc‚ĆŽv‚Á‚˝‚çAo—Í‚ˇ‚é Perl ƒR[ƒh‚ŞŠÔˆá‚Á‚Ä‚Ü‚ˇB

‚ŕ‚¤~ŽQ‚Ĺ‚ˇBUTF-8 ‘Ήž‚Ě gawk ‚đ‚¨–]‚Ý‚Ě•ű‚É‚Í Linux ‚Ö‚Ěˆř‰z‚ľ‚đ‹­‚­‚¨§‚ß‚ľ‚Ü‚ˇB

827 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/27(‰Î) 18:24:36.25 ID:JiNhKH2a
cygwin‚âmsys2‚Ěgawk‚đŽg‚¤‚Ě‚Í‚ž‚߂Ȃ́H

828 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/27(‰Î) 18:34:39.64 ID:BPXrtVfk
Windows Subsystem for Linux (WSL)‚ł́AUbuntu64‚ĚŽŔsƒtƒ@ƒCƒ‹‚Ş“Ž‚­B
Linux API ‚đAWindows API ‚Ö•ĎŠˇ‚ľ‚ÄŒÄ‚Ńo‚ˇ

Ubuntu‚ĚƒpƒbƒP[ƒW‚ŕAapt-get‚ĹƒCƒ“ƒXƒg[ƒ‹‚Ĺ‚Ť‚é

829 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/27(‰Î) 19:26:43.05 ID:Icjzq3KF
‚ž‚ß‚Ć‚˘‚¤‚ŠAŒŠ‚‚Ż‚ç‚ę‚Č‚Š‚Á‚˝B
‚˝‚ž‚Ĺ‚ł‚Ś Windows ‚Ě‚ą‚Ć‚Č‚ń‚Š’m‚ç‚Č‚˘‚ń‚ž‚Š‚ç‚ą‚ęˆČă–ł—B
‚˘‚˘•ű–@‚đ’m‚Á‚Ä‚˝‚ç‹ł‚Ś‚Ä‚ ‚°‚āB

830 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/27(‰Î) 19:51:11.26 ID:Icjzq3KF
Cygwin ‚ÍŽŽ‚ľ‚Ä‚Ý‚˝‚Ż‚ǃCƒ“ƒXƒg[ƒ‰‚É’šd‚É‚¨’f‚č‚ł‚ę‚˝‚ćB

831 F822F2016/09/27(‰Î) 23:10:22.59 ID:eGFFwbsN
‚˝‚­‚ł‚ń‚̏î•ń‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇBŒťó‚ĹWindows‚ɍS‚é‚Č‚çABruce”Ĺ3.1.7‚đŒp‘ą‚ľ‚Ä
Žg—p‚ˇ‚é‚ŠACygwin”Ĺ‚Éć‚芡‚Ś‚é‚ŠAWindows Subsystem for Linux‚Ĺ“Žě‚ł‚š‚é‚Š‚Ě
‚˘‚¸‚ę‚Š‚É‚Č‚č‚ť‚¤‚Ĺ‚ˇ‚ˁB

Cygwin‚âWindows7‚Ĺ‚ĚWindows Subsystem for Linux‚́A‚Ç‚ż‚ç‚ŕ•Ę“rƒCƒ“ƒXƒg[ƒ‹‚Ş•K—v
‚Ć‚Ě‚ą‚ƂȂ̂ŁAEę‚ĚŽŠPC‚Í‚Ć‚ŕ‚Š‚­ƒXƒNƒŠƒvƒg”z•zć‚ɁiƒXƒNƒŠƒvƒg‚đ“Ž‚Š‚ˇ‚˝‚ß‚ž‚Ż‚Ɂj
“ą“ü‚ľ‚Ä‚ŕ‚ç‚í‚Č‚˘‚Ć‚˘‚Ż‚Č‚˘‚Ě‚Í‚ż‚ĺ‚Á‚Ć“ď‚ľ‚ť‚¤‚Ĺ‚ˇB
Cygwin‚Ě“ą“üó‹ľ‚ĆWindows10‚ւ̐؂č‘Ö‚ŚŽžŠú‚Ě—lŽq‚đŒŠ‚Â‚ÂA‚ľ‚΂炭Bruce”Ĺ3.1.7‚đ
Žg‚¤‚ą‚Ć‚É‚ľ‚Ü‚ˇB

832 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/09/28(…) 07:26:06.87 ID:6NcLFLen
ŽŔ‚Í•ű–@‚Ş–ł‚˘‚í‚Ż‚Ĺ‚Í‚Č‚˘BƒVƒ“ƒOƒ‹ƒoƒCƒgƒ‚[ƒh‚Č‚ç‚Ĺ‚Ť‚éB‚Ĺ‚ŕ–{“–‚É‚â‚č‚˝‚˘?
–{“–‚ɐ^Œ•‚É•K—v‚Ć‚ľ‚Ä‚˘‚é‚Č‚çA‚ą‚ĚƒXƒNƒŠƒvƒg‚ĹƒeƒXƒg3‚đ‚â‚Á‚Ä‚Ý‚Ä‚Ů‚ľ‚˘B

{
@@c = "[\\000-\\177]|[\\340-\\357][\\200-\\277][\\200-\\277]"
#@ print( length($0));
@@str = $0; print( gsub( c,"0",str));
@@print;
@@sub(/<tag>/, "");
@@sub(/<\/tag>/, "");
@@sub(/hello/, "ABC");
#@ sub(/.‚¤/, "U");
@@sub( sprintf("(%s)‚¤",c),"U")
@@print;
}

833 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/10/01(“y) 22:37:26.49 ID:apxhHWta
‚â‚Á‚Ď‚č klabaster gawk ‚Í‚ć‚­‰đ‚ç‚Č‚˘B

$cat u2.awk
{
@@print( length($0))
@@sub(/‚¤/, "U")
@@print;
}
$LANG=C wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.EUC-JP wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.UTF-8 wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
gawk64: u2.awk:3: sub(//, "U")
gawk64: u2.awk:3: ^ unterminated regexp
gawk64: u2.awk:4: sub(//, "U")
gawk64: u2.awk:4: ^ unexpected newline or end of string
$

UTF-8 ‚Łu‚¤v‚Í 3 ƒoƒCƒg‚ž‚Š‚çAƒVƒtƒgJIS‚ʼnđŽß‚ľ‚˝Œ‹‰Ę
‚ť‚ĚŒă‚ë‚Ě / ‚ŕƒ}ƒ‹ƒ`ƒoƒCƒg•śŽš‚Ěˆę•”‚É‚Č‚é‚Ě‚ž‚낤‚ŠB
‚˘‚âAUTF-8 ‚ʼnđŽß‚ľ‚Ä‚­‚ę‚Č‚˘‚ą‚Ć‚É•ś‹ĺ‚đŒž‚˘‚˝‚˘‚ń‚ś‚á‚Č‚˘‚ń‚žB
UTF-8 ‚ŏ‘‚˘‚Ä‚ ‚é‚Ě‚É‚Č‚ş LANG=ja_JP.UTF-8 ‚ĚŽž‚ž‚ŻƒGƒ‰[‚É‚Č‚é‚Ě‚ž‚낤B

834 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/10/02(“ú) 00:14:27.80 ID:lSw/Qfuv
‚ą‚Ě‹LŽ–‚đŒŠ‚é‚Š‚Ź‚č‚Ĺ‚ÍklabasterˆČŠO‚ĚWindows”Ĺgawk‚Ĺ‚ŕƒ_ƒ‚Á‚Ű‚˘‚Ĺ‚ˇ
https://groups.google.com/forum/#!topic/comp.lang.awk/coXxXOpeoXU

835 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/10/08(“y) 21:51:54.06 ID:66+5bUgM
>>749‚Š‚ç‚ĚƒŒƒX‚ŁA$‚މ‰ŽZŽq‚ž‚Á‚˝‚́H@‚Ć‚˘‚¤‚悤‚Č‚Ć‚ą‚ë‚Ş‹C‚É‚Č‚Á‚Ä
­‚ľ’˛‚ׂĂ݂˝i’˛‚ׂ˝‚Ć‚˘‚¤‚Ů‚Ç‚Ěě‹Ć‚Í‚ľ‚Ä‚Č‚˘‚ŠjB

‚Ü‚¸‘ĐBŽčŽ‚ż‚̐”ű‚ĹŠm”FB
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKxiƒgƒbƒpƒ“@‰”Ĺ‘ć7üj
‚ł‚˘‚˛‚̂܂Ƃ߂ʼn‰ŽZŽqˆę——‚É‹LÚB–{•ś’†(p8)‚ł́u—“‚͏í‚É$1,$2‚̂悤‚É
ŽQĆ‚ľ‚Č‚­‚Ä‚Í‚˘‚Ż‚Č‚˘‚ĆŽv‚í‚ę‚Ä‚˘‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚ށAŽŔ‚Í$‚Ě‚ ‚Ć‚É‚Í,—“‚Ě
”ԍ†‚đŽw‚ľŽŚ‚ˇ‚˝‚ß‚Ě”CˆÓ‚ĚŽŽ‚đ‘‚˘‚Ä‚ŕ‚悢v‚Ə‘‚Š‚ę‚Ä‚˘‚éB‚Ü‚˝Ap46‚É‚Í
u—“•Ď”v‚̍€‚Ɂu“ü—͍s‚Ě—“ifieldj‚Í,$1,$2‚Š‚çŽn‚Ü‚Á‚Ä,$NF‚Ć‚˘‚¤–ź‚ĹŒÄ‚Î‚ę‚év
‚Ć‚Ě‹Lq‚Ş‚ ‚éB

wsed & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOxiƒAƒXƒL[o”ŋǁ@‰”Łj
‹Œ”ŁB–{•ś’†ip212j‚ŁuƒtƒB[ƒ‹ƒh‚đŽQĆ‚ľ‚˝‚˘‚Ć‚Ť‚ɂ́AƒtƒB[ƒ‹ƒh‰‰ŽZŽq$‚đŽg‚Ś‚΂悢v
‚Ü‚˝ip217j‚ŁuƒtƒB[ƒ‹ƒh‚đŽQĆ‚ˇ‚é‚ɂ̓hƒ‹‹L†($)‰‰ŽZŽq‚đŽg‚¤vAAppendixip471j‚Ĺ
u‚ť‚ę‚ź‚ę‚ĚƒtƒB[ƒ‹ƒh‚́A$1‚Č‚ç‚΍ŏ‰‚ĚƒtƒB[ƒ‹ƒh‚Ě’l‚đŽQĆ‚ľAv‚Ć•\Œť‚ł‚ę‚Ä‚˘‚éB
Appendix‚̉‰ŽZŽqˆę——‚É‹LÚB

wAWK‚đ256”{Žg‚¤‚˝‚ß‚Ě–{xiƒAƒXƒL[o”ŋǁ@‰”Łj
Appendix‚ʼn‰ŽZŽqˆę——‚É‹LÚ‚ł‚ę‚Ä‚˘‚é‚ŞA–{•śip65j‚Łu•Ş‰đ‚ł‚ę‚˝ŠeƒtƒB[ƒ‹ƒh‚́A
$n‚Ć‚˘‚¤•Ď”in‚́AŽn‚ß‚ĚƒtƒB[ƒ‹ƒh‚Š‚珇‚É1,2,3...‚Ć‚Č‚éB‚ŕ‚ż‚ë‚ń‘Ś’l‚Ě‘ă‚í‚č‚ɕϐ”‚đ
Žw’股‚é‚ą‚Ć‚ŕ‰Â”\‚žj‚ĹƒAƒNƒZƒX‚ˇ‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚év‚Ć‚ ‚éB‘ź‚Ě‰ÓŠ‚Ĺ‚ŕ$n•Ď”‚Ə‘‚˘‚Ä‚ ‚é
‚Ć‚ą‚ë‚Ş‚ ‚éBp66‚ŁuŠeƒtƒB[ƒ‹ƒh‚đ•\‚ˇ$n‚Ĺ‚ ‚é‚ŞA‚Č‚ş‚ą‚ń‚Č–ź‘O‚É‚Č‚Á‚Ä‚˘‚é‚Š‚˛‘ś‚ś‚ž‚낤‚ŠH
ŽŔ‚Í‚ą‚ę‚ŕUNIX•ś‰ť‚Š‚ç‚Ť‚Ä‚˘‚é‚Ě‚žBUNIX‚Ě‘ă•\“I‚ČƒVƒFƒ‹‚Ĺ‚ ‚ésh‚âcshiĹ‹ß‚Ĺ‚Íksh‚â
tcsh‚Š‚ȁHj‚ĚƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ě‚Č‚Š‚ĹƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒpƒ‰ƒ[ƒ^‚đ•\‚ˇ•Ď”‚Ć‚ľ‚Ä$n‚ŞŽg—p‚ł‚ę‚Ä
‚¨‚či’†—ށj‚ą‚ę‚É‚ ‚í‚š‚Äawk‚Ĺ$n‚ŞŽg—p‚ł‚ę‚Ä‚˘‚é‚悤‚Č‚Ě‚Ĺ‚ ‚év‚Ə‘‚˘‚Ä‚ ‚éB

wAWKŽŔ‘H“ü–ĺxi‹Zp•]˜_ŽĐ@‰”Łj
>>766‚É‚ ‚é‚悤‚É“Á•Ę‚ȕϐ”‚Ć‚ľ‚Ĉľ‚í‚ę‚Ä‚¨‚čAƒŠƒtƒ@ƒŒƒ“ƒX‚É‚ŕ$‚މ‰ŽZŽq‚Ĺ
‚ ‚é‚ą‚Ć‚Ě‹LÚ‚Ş‚Č‚˘B
i‘ą‚­j

836 F835F2016/10/08(“y) 22:00:44.45 ID:66+5bUgM
i‘ą‚Ťj
ƒlƒbƒg‚̏î•ńB2016.10.8ŒťÝB
Gnu Awk ƒ†[ƒU[ƒYƒKƒCƒh/The GAWK Manual/Effective AWK Programming
gawk‚̉đŕ‘Bƒo[ƒWƒ‡ƒ“ˆá‚˘‚Ş‚ ‚é‚悤‚ž‚ށA–|–ó”Ĺ‚Ĺ–Ú‚É—Ż‚Ü‚Á‚˝‚ŕ‚́B
u’萔‚Ĺ‚Č‚˘ƒtƒB[ƒ‹ƒh”ԍ†v‚̍€‚Łu‚ ‚éƒtƒB[ƒ‹ƒh‚đŽQĆ‚ˇ‚é‚˝‚߂ɁAawkŒžŒę‚Ĺ‚Ě”CˆÓ‚ĚŽŽ‚đ
`$'‚ĚŒă‚ĹŽg‚¤‚ą‚Ć‚Ş‚Ĺ‚Ť‚év‚Ć‹Lq‚ł‚ę‚Ä‚˘‚éBu‰‰ŽZŽq‚Ě—Dć‡ˆĘv‚̍€‚ł͉‰ŽZŽq‚Ć‚ľ‚Ä
•Ŕ‚ׂç‚ę‚Ä‚˘‚éB

man gawk
–|–ó”ŁAƒŠƒiƒbƒNƒXƒRƒ}ƒ“ƒh‚Ć‚˘‚¤ƒTƒCƒgiwww.linux-cmd.comj‚Š‚çB
u“ü—̓ŒƒR[ƒh’†‚ĚŠeƒtƒB[ƒ‹ƒh‚Ě’l‚́Aś‚Š‚ç $1, $2 “™‚Ć‚˘‚¤–ź‘O‚ĹŽQĆ‚Ĺ‚Ť‚Ü‚ˇB
$0 ‚̓ŒƒR[ƒh‘S‘Ě‚Ĺ‚ˇBƒtƒB[ƒ‹ƒh‚É’l‚đ‘ă“ü‚ˇ‚é‚ą‚Ć‚ŕ‚Ĺ‚Ť‚Ü‚ˇBƒtƒB[ƒ‹ƒh‚͒萔‚ž‚Ż‚Ĺ‚Č‚­A
•Ď”‚É‚ć‚Á‚ÄŽQĆ‚ˇ‚é‚ą‚Ć‚ŕ‚Ĺ‚Ť‚Ü‚ˇBv‚Ć‚Č‚Á‚Ä‚˘‚éB‰‰ŽZŽq‚Ě‚Ć‚ą‚ë‚É‹LÚ‚ ‚čB

AWK Users JP
ƒTƒCƒg’†uawk Šî‘b•ś–@Ĺ‘Źƒ}ƒXƒ^[v‚Ěƒy[ƒW‚Łu“ÁŽę•Ď”v‚̍€‚É$0,$1`$NF‚Ěŕ–žB
ƒtƒB[ƒ‹ƒhŽQĆ‚ĚŒę‚Í‚Č‚˘B‚Ü‚˝AƒŠƒtƒ@ƒŒƒ“ƒX“I‚ȉ‰ŽZŽq‚Ě‚Ü‚Ć‚ß‚Í‚Č‚˘iHjB
ƒy[ƒWă•”‚Ɂu‚ą‚Ě•ś‘‚͏‘‚Ť‚Š‚Ż‚Ĺ‚ˇv‚Ć‚ ‚é‚̂ŁA–˘Ž”ő‚Ć‚˘‚¤‚ą‚Ć‚ž‚낤‚ŠB

IBM Knowledge Center
awkƒRƒ}ƒ“ƒh‚Ěƒy[ƒWiwww.ibm.com/support/knowledgecenter/ja/ssw_aix_71/
com.ibm.aix.cmds1/awk.htmj‚ł́uƒŒƒR[ƒh‚ĆƒtƒB[ƒ‹ƒh‚É‚ć‚éƒtƒ@ƒCƒ‹ˆ—v‚̍€‚Ĺ
uŠeƒtƒB[ƒ‹ƒh‚̓tƒB[ƒ‹ƒh•Ď”‚É‚ć‚Á‚ÄŽQĆ‚ł‚ę‚Ü‚ˇBƒŒƒR[ƒh‚̍ŏ‰‚ĚƒtƒB[ƒ‹ƒh‚É‚Í $1 •Ď”A
2 ”Ô–Ú‚ĚƒtƒB[ƒ‹ƒh‚É‚Í $2 •Ď”‚Ć‚˘‚¤‚悤‚ɁA•Ď”‚ŞŠ„‚č“–‚Ä‚ç‚ę‚Ü‚ˇBv‚Ć‚Ě‹LqB­‚ľ‚¤‚ľ‚ë‚Ě
•űAuƒtƒB[ƒ‹ƒh•Ď”v‚̍€‚Ĺ‚ŕuƒtƒB[ƒ‹ƒh•Ď”‚́A$ (ƒhƒ‹‹L†) ‚Ć‚ť‚ę‚É‘ą‚­”’l‚Ü‚˝‚͐”’lŽŽ‚Ĺ
Žw’č‚ľ‚Ü‚ˇBv‚Ć‚ ‚éB$‚މ‰ŽZŽq‚Ĺ‚ ‚é‚ą‚Ć‚Ě‹LÚ‚Í‚Č‚˘B

‚Ä‚ČŠ´‚ś‚ŁAwƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKx‚Ĺ‚ŕu—“•Ď”v‚Ć‚˘‚¤•\Œť‚Ş‚ ‚čAŒë‰đ‚ľ‚ť‚¤‚ČŠ´‚ś‚Í‚ˇ‚éB
‚Ü‚˝A256”{–{‚ɏ‘‚˘‚Ä‚ ‚é‚悤‚ɃVƒFƒ‹ƒXƒNƒŠƒvƒg’†‚Ěƒpƒ‰ƒ[ƒ^‚Ć‚ľ‚Ä$n‚Ş‚ ‚é‚ą‚Ć‚Š‚çA$n‚Ş
i“Á•Ę‚ȁj•Ď”‚Ć‚ľ‚Ä”FŽŻ‚ł‚ę‚Ä‚ľ‚Ü‚Á‚Ä‚˘‚é‚Ě‚Ĺ‚Í‚Č‚˘‚ŠA‚Ć‚ŕ‘z‘œ‚ˇ‚éBŒÂlƒTƒCƒg‚Ěawk‚̉đŕ
ƒy[ƒW‚ł́A$n‚Ć‚˘‚¤•Ď”‚ɃtƒB[ƒ‹ƒh‚Ş‘ă“ü‚ł‚ę‚é‚Ćŕ–ž‚ľ‚Ä‚˘‚é‚Ć‚ą‚ë‚ŕ‚ ‚Á‚˝B‚ť‚̂悤‚É—‰đ‚ľ‚Ä
ƒXƒNƒŠƒvƒg‚đ‘‚˘‚Ä‚ŕ‚ł‚ľ‚Ä•s“s‡‚Í‚Č‚˘‚ž‚낤‚ȁA‚Ć‚ÍŽv‚¤‚ށB

837 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/10/08(“y) 23:11:50.50 ID:ZMh6U7O9
L”Í‚Č’˛¸‰łBGawk‚Ěrefcard‚Ĺ‚ŕ‚ż‚á‚ń‚Ćoperator‚ÉŠÜ‚Ü‚ę‚Ä‚˘‚é‚Č‚ B
‰‰ŽZŽq‚Ć–žŠm‚É”FŽŻ‚ľ‚Ä‚˘‚Č‚­‚Ä‚ŕA$‚ĚŒă‚ÉŽŽOK‚ĆŽv‚Á‚Ä‚˘‚ę‚΍ˇ‚ľŽx‚Ś‚Č‚ł‚ť‚¤B

838 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/10/18(‰Î) 23:10:18.54 ID:TQpGgbw6
gawk4‚Ŋ֐”ƒ|ƒCƒ“ƒ^‚Ý‚˝‚˘‚Č‚ŕ‚ń‚ޒljÁ‚ł‚ę‚Ü‚ľ‚˝‚Ż‚ǁA‚ą‚ęlength‚Ć‚Šsubstr‚Ě
‘gž‚݊֐”‚â@load‚ľ‚˝ŽŠědll‚̊֐”‚Ć‚Š‚É‚ŕŽg‚Ś‚é‚ń‚Ĺ‚ˇ‚Ë
ˆÄŠO•Ö—˜‚Š‚ŕ

@load "hage.dll"
@BEGIN{
@kumi = "length"
@func = "hagefunc"
@ng[1] = "substr"
@print @kumi("ABC")
@print @func("œc Ü ƒ~ ")
@print @ng[1]("XYZ", 1, 1) # ”z—ń‰z‚ľ‚ɌĂڂ¤‚Ć‚ľ‚˝‚çsyntax errorEEEŽc”O
}

839 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/10/21(‹ŕ) 17:10:59.85 ID:MQQBNMPM
>>756
‚ą‚¤‚˘‚¤‰ß‘aƒXƒŒ‚Ĺ–ł‘Ę‚É“Ë‚Á‚Š‚Š‚Á‚Ä‚­‚é‚â‚‚ނŠ‚‚­‚ń‚ž‚ŞŽ€‚Ë

840 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/11/23(…) 00:01:26.03 ID:bt3mTQnz
>>839
ƒu[ƒƒ‰ƒ“‚Š‚ć‚—‚—‚—

841 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/11/23(…) 01:18:15.98 ID:noM2Pdp3
_‚¨‚Í‚°‚ž[I^

842 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2016/11/30(…) 02:56:38.28 ID:PeC/aWZc
http://imgur.com/a/1WEjn

843 F‚b‰SŽŇF2017/02/28(‰Î) 13:18:15.09 ID:Mb8mQo1M
‚‚—‚‹ƒXƒNƒŠƒvƒg‚đ‚bƒ\[ƒX‚É•ĎŠˇ‚ľ‚ăRƒ“ƒpƒCƒ‹‚ˇ‚é‚˝‚߂́u‚‚—‚‹‚v‚Ć‚˘‚¤ƒc[ƒ‹‚Ĺ‚Ĺ‚Ť‚é‚ž‚ŻŠČ’P‚É‚t‚s‚e|‚WƒTƒ|[ƒg‚ł‚š‚é•ű–@‚đ’m‚č‚˝‚˘‚Ĺ‚ˇB
ƒlƒbƒg‚ĹŽUX’˛‚ׂ܂ľ‚˝‚Ş‚Č‚˘‚悤‚Ĺ‚ˇH

844 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/02(–Ř) 00:28:53.73 ID:CDxvUfiY
‚ą‚ĚƒXƒŒ‚ŕ‚P‚OŽü”N‚Š

845 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/05(“ú) 09:28:55.73 ID:EQCsqksH
>>843
‚ť‚ę‚Ş‚ ‚Č‚˝‚ĚŒťÝ‚ĚŽŔ—Í‚ž‚Á‚˝‚Ć‚˘‚¤‚ą‚Ć‚Ĺ‚ˇ
‚¨”ć‚ę—l‚Ĺ‚ľ‚˝

846 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/05(“ú) 14:45:26.28 ID:KmKKYedf
gawk‚ɑΉž‚ľ‚Ä‚é‚Č‚ç‘ĺä•v‚Á‚Ä‚ą‚Ć‚Š‚ȁH
ascii‚ľ‚Šl‚Ś‚Ä‚˘‚Č‚˘‚Č‚çAƒ\[ƒX‘Sƒ`ƒFƒbƒNcB
—v‚ˇ‚é‚ɁA“ú–{Œę‰ť‚ˇ‚é‚ń‚ž‚낤‚Ż‚ǁB

‘S‘R•Ę‚ĚŒžŒę•ĎŠˇ‚É‚ż‚ĺ‚Á‚Ć™ů‚ń‚ž‚ą‚Ć‚Ş‚ ‚é‚ń‚ž‚Ż‚ǁA
ť•i‰ť‚ľ‚ż‚á‚Á‚Ä‚Š‚çƒ_ƒuƒ‹ƒoƒCƒgl—ś‚ľ‚Ä‚Č‚˘‚ą‚Ć‚Ş‚í‚Š‚Á‚āA‚Š‚Č‚č–Ę“|‚ž‚Á‚˝B

‚Ć‚č‚ ‚Ś‚¸•ĎŠˇ‚ľ‚Ä‚Š‚çAƒ\[ƒXŒŠ‚Ä’ź‚ˇ‚Ů‚¤‚Ş‘‚Š‚Á‚˝‚čiÎ

‚Ş‚ń‚΂Á‚ĂˁB

847 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 11:39:31.22 ID:FdaYmB9f
awk‚Ł@$1,$2...$6 ‚ą‚ń‚ȏo—Í‚đŤ‰ş‚É‚ľ‚˝‚˘‚ń‚ž‚Ż‚ǁ@‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ˇ‚Š‚ˁH
470230
470290
Ť
002347
002479

848 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 12:33:46.83 ID:FW5jfGh1
GNU awk ‚Ě asort() ‚đŽg‚¤‚Ć‚ŠB

printf '470230\n470290\n' |
gawk -vFS= -vOFS= '{
for(i=1;i<=NF;i++){
arr[i]=$i
};
asort(arr);
for(i=1;i<=NF;i++){
$i=arr[i]
};
print
}'

849 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 15:19:43.83 ID:FdaYmB9f
‚ ‚č‚Ş‚Ć‚¤
gawk ‚˘‚ę‚Č‚˘‚Ĺ‚Č‚ń‚Ć‚Š‚Č‚ç‚Č‚˘‚Š‚Č

850 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 17:28:40.15 ID:FW5jfGh1
‚¤`‚ńA‚ť‚¤‚Č‚é‚Ć awk ‚đŽg‚í‚Č‚­‚Ä‚ŕ‚˘‚˘‚Š‚Č

printf '470230\n470290\n' |
while read -r n
do
echo "$n" | grep -o . | sort -n | tr -d '\n'; echo
done

851 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 19:23:27.89 ID:08XsJPyW
>>840
‚ž‚Š‚çƒu[ƒƒ‰ƒ“‚Ć‚Š‚ť‚¤‚˘‚¤‚ĚŠÖŒW‚Č‚˘‚Š‚玀‚Ë‚Á‚ÄŒž‚Á‚Ä‚ń‚ž‚ëƒJƒX
Ž€‚Ë

852 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 19:24:30.15 ID:08XsJPyW
>>844
”S’…‚Ş10”NˆĘ‰„–˝‚ľ‚Ä‚ŕ‰˝‚ŕ‚ˇ‚˛‚­‚Ë‚Ś‚ć
“Ë‚Á‚Š‚Š‚Á‚Ä‚Ť‚˝‚Ô‚ż‚ą‚낡‚źŽG‹›Ž€‚Ë>>840

853 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/06(ŒŽ) 19:26:33.18 ID:08XsJPyW
>>840
ƒu[ƒƒ‰ƒ“‚Ć‚Š‚ś‚á‚Č‚­‚ÄŽ€‚Ë‚Á‚ÄŒž‚Á‚Ä‚ń‚ž‚Š‚玀‚˃{ƒP

854 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/07(‰Î) 08:17:48.93 ID:6Hf5Xh2e
‚¨”ć‚ę—l‚Ĺ‚ľ‚˝

855 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/09(–Ř) 21:48:39.65 ID:0T9qj2kA
˜A‘z”z—ń‚Ĺ
echo '470230' | awk 'BEGIN{FS=""}{for(i=1;i<=NF;i++){a[$i]++}for(i=0;i<=9;i++){for(j=1;j<=a[i];j++){printf("%s", i)}}printf("\n")}'
002347

856 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/10(‹ŕ) 00:18:57.87 ID:+B1nKlhG
Šů‚ɔے肳‚ę‚Ä‚˘‚é‚Şgawk4‚Ş‚ŕ‚ľŽg‚Ś‚˝‚ç
awk '{ORS="";PROCINFO["sorted_in"]="@val_num_asc";x=split($0,a,"");for (i in a)print a[i];print "\n"}'

857 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/03/10(‹ŕ) 04:05:38.25 ID:wGo6zQ56
Ĺ‹ß‚Ě gawk ‚Č‚çƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚Ş—pˆÓ‚ł‚ę‚Ä‚Ä join ‚Ć‚ŠŽg‚Ś‚˝‚č

gawk -vFS= -vOFS= -i join.awk '{split($0,a,"");asort(a);print join(a,1,length(a),SUBSEP)}'

858 FƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ńF2017/04/04(‰Î) 22:35:43.00 ID:9/WMFGSO
# gawk4‚Ě“Çž‚݃^ƒCƒ€ƒAƒEƒg‹@”\A‚Ż‚Á‚ą‚¤•Ö—˜‚ť‚¤EEE‚ž‚Ż‚ÇWindows‚ÍCygwin”Ĺ‚ś‚á‚Č‚˘‚ĆŽg‚Ś‚Č‚˘BŽc”O–ł”OB
BEGIN{
@ PROCINFO["/dev/stdin", "READ_TIMEOUT"] = 180000
@ print "3•ŞŠÔ‘Ň‚Á‚Ä‚â‚é"
@ getline t < "/dev/stdin"
@ if (t=="ƒoƒ‹ƒX") {
@ @ print "‚ ‚ c‚ ‚ c–Ú‚Ş‚ ‚Ÿ‚Ÿ‚Ÿ‚Ÿ‚Ÿ`I"
@ }
@ else {
@ @ print "ŽžŠÔ‚žI“š‚Ś‚đu‚ą‚¤I"
@ }
}

244 KB
V’…ƒŒƒX‚Ě•\ŽŚ

šƒXƒ}ƒz”Łš ŒfŽŚ”Â‚É–ß‚é ‘S•” ‘O100 ŽŸ100 ĹV50
–ź‘OF E-mail (Č—މÂ) :


read.cgi ver 05.02.02 2014/06/23 Mango Mangüé š
FOX š DSO(Dynamic Shared Object)