‚Q‚ż‚á‚ń‚˂遚ƒXƒ}ƒz”ŁšĄŒfŽŚ”‚ɖ߂遥‘S•”1-ĹV50

awk‚ɂ‚˘‚ÄŒę‚éƒXƒŒ $2

1 :
2007/02/23(‹ŕ) 23:55:42
•…‚Á‚Ä‚ŕ‘âH éuűű‚ŕ˜V‚˘‚Ä‚Íém”n‚É—ň‚éH
ŽOl‚̐׊w‚ސś‚ݏo‚ľ‚˝ƒXƒNƒŠƒvƒgŒžŒęAWK‚ɂ‚˘‚ÄŒę‚éƒXƒŒ

Ÿ ‘OƒXƒŒ
awk‚ɂ‚˘‚ÄŒę‚éƒXƒŒ
http://pc10.2ch.net/test/read.cgi/tech/1023556171/

Ÿ ŠÖŒWƒXƒŒ
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘Š’kŽş
http://pc10.2ch.net/test/read.cgi/tech/1112553783/
AWK‚ĹCGI
http://pc10.2ch.net/test/read.cgi/php/1171804314/
ysedzƒVƒFƒ‹ƒXƒNƒŠƒvƒg‘‡@LINUX Part2yawkz
http://pc10.2ch.net/test/read.cgi/linux/1154578200/

Ÿ ŽQl
The AWK Programming Language (Brian Kernighan)F
ttp://cm.bell-labs.com/cm/cs/awkbook/index.html

GAWK (GNU Projedt):
ttp://www.gnu.org/software/gawk/
2 :
2007/02/24(“y) 00:04:13
awking shoes
3 :
2007/02/24(“y) 00:24:49
ƒI[ƒN
ƒI[ƒN
ƒI[ƒN

@‰œ‚ł‚ń
4 :
2007/02/24(“y) 01:35:13
‘˝‚­‚ÍŒę‚é‚Ü‚˘B

Mawk - Mike' AWK
http://gnuwin32.sourceforge.net/packages/mawk.htm
5 :
2007/02/24(“y) 23:32:05
‚˘‚â‘˝‚­‚đŒę‚Á‚Ä‚­‚ę
6 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/02/25(“ú) 06:34:37
ƒ[ƒJƒ‹•Ď”AB
7 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/02/27(‰Î) 21:39:18
ƒNƒ[ƒWƒƒ‚đŽ‚Á‚˝awkŽŔ‘•‚Ć‚Š‚Č‚˘‚Š‚Ë
8 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/02/27(‰Î) 23:45:59
ƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ĺ‚ż‚ĺ‚ż‚ĺ‚Á‚ĆŽg‚¤‚ą‚Ć‚Í•p”É‚É‚ ‚é‚Ż‚Ç
‹C‡‚˘“ü‚ę‚ăvƒƒOƒ‰ƒ~ƒ“ƒO‚ˇ‚é‚Á‚Ä‚Ě‚ÍĹ‹ß–ł‚­‚Č‚Á‚˝B
9 :
2007/02/28(…) 00:13:16
>>7
‘OƒXƒŒ‚ÉObjective awk‚ŞŽŔÝ‚ˇ‚é‚Š‚̂悤‚Č˜b‚Ş‚ ‚é‚Şƒlƒ^‚ž‚낤B
ŽŔ—pŤ‚𖳎‹‚ˇ‚ę‚ÎawkŽŠg‚ŏ‘‚­‚ą‚Ć‚ŕ•s‰Â”\‚Ĺ‚Í‚Č‚˘‚Š‚ŕ‚ľ‚ę‚Č‚˘B
‚¨–]‚݂Ɉę”Ô‹ß‚˘ŽŔ‘•‚́AŽŔ‚ÍJavaScript‚Ĺ‚Í‚Č‚˘‚Š‚ƁB
http://developer.mozilla.org/ja/docs/New_in_JavaScript_1.7
10 :
2007/03/01(–Ř) 00:43:46
ƒgƒbƒpƒ“‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK‚ރuƒbƒNƒIƒt‚Ĺ105‰~‚Ĺ’@‚Ť”„‚ç‚ę‚Ä‚é‚Ě‚đŒŠ‚Ä
‚Č‚ń‚Š”ß‚ľ‚˘‹C•Ş‚É‚Č‚Á‚˝
11 :
2007/03/01(–Ř) 16:01:47
>>10
‰´‚ŕƒIƒ‰ƒCƒŠ[‚́used & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOv–{‚ށA}‘ŠŮ‚́u–ł—ż‚ĹŽ‚Á‚Ä‚Ż[’Iv
‚É‚ ‚Á‚˝‚̂ŁA‘Ś GET ‚ľ‚˝B‚Ü‚ A‚Š‚Č‚čŒĂ‚˘–{i1991 ”Nj‚ž‚Ż‚ǁA“ŕ—e‚Í‚˘‚˘–{‚žB
’艿 \3800 ‰~‚ĚƒoƒJ‚–{‚ŁA ‚˝‚Ô‚ńAV‘‚Ĺ‚Í”ƒ‚í‚Č‚Š‚Á‚˝‚ž‚낤B

ƒgƒbƒpƒ“‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK‚Á‚āA‚˘‚‚˛‚ë‚Ě–{‚ž‚Á‚˝‚ŻB‚Ć‚č‚ ‚Ś‚¸A105‰~‚Č‚ç
—~‚ľ‚˘‚Á‚ˇB
12 :
2007/03/01(–Ř) 21:49:42
>>11
Ô‚˘•\Ž†‚Ě‘ć‚P”Ĺ‚ž‚Ë‚Ť‚Á‚ƁB
—΂̕\Ž†‚Ě‘ć‚Q”Ĺ‚ŞŽčŒł‚É‚ ‚é‚Ż‚ǁAgawk‚ĹŠg’Ł‚ł‚ę‚Ä‚˘‚é
ł‹K•\Œť‚Ěŕ–ž‚Ć‚Š‘‚Ś‚Ä‚Ä‘ć‚Q”Ĺ‚Ě‚Ů‚¤‚Ş‚¨ŠŠ‚߁B
‚ż‚Ȃ݂ɒ艿‚S‚P‚O‚O‰~‚Č‚čB
13 :
2007/03/01(–Ř) 23:52:54
>>12
> Ô‚˘•\Ž†‚Ě‘ć‚P”Ĺ‚ž‚Ë‚Ť‚Á‚ƁB
‚ť‚¤A‚ť‚ę‚ť‚ęB ‚Ů‚ń‚ŁA
gensub ‚Ş‚Č‚˘B‚ŕ‚ż‚ë‚ńA
/inet/..... |& ....@‚ŕ‚Č‚˘B

Ĺ‹ßA/inet/..... |& ....@‚Ş‚ ‚éigawk3.1 ‚Š‚çj‚ą‚Ć‚đ’m‚Á‚āAgawk ‚đŒŠ’ź‚ľ‚Ä‚˘‚éB
Žg‚˘ŽĚ‚Ä‚ĚƒvƒƒOƒ‰ƒ€‚Í gawk ‚ɏ`!!B
14 :
2007/03/02(‹ŕ) 02:09:03
>>11
ƒgƒbƒpƒ“‚̍ŏ‰‚Ě–{‚Č‚çŠm‚Š1990”N‚̏t ‚ž‚Á‚˝‚ĆŽv‚¤B
ˆę‰žnawkƒŒƒxƒ‹‚Ě‹Lq‚Ě‚Í‚¸‚Č‚ń‚ŁAgawk‚Č‚ń‚Š‚ĚŒĹ—L‚Ě
Šg’Ł‚đœ‚Ż‚Ώ\•ŞŽg‚Ś‚é‚Ĺ‚ľ‚ĺB

105‰~‚́c‚ż‚Ɣ߂ľ‚˘‚Ż‚Ç‚˘‚˘l‚ɏE‚í‚ę‚Ä—~‚ľ‚˘‚Ë‚ŚB
15 :
2007/03/02(‹ŕ) 02:27:22
>>13
gawk‚Ě /inet Šg’Ł‚Á‚ăCƒ}ƒCƒ`Žg‚˘‚Ă‚ç‚­‚Ë?

”Ä—p“I‚Č‚Ě‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁA‚¨ŽčŒy‚ÉhttpŒo—R‚Ĺwebƒy[ƒW‚Ě
“ŕ—eŽć‚ę‚ę‚΂˘‚˘‚Á‚Ä‚Ć‚Ť‚É‹Lq‚Ş–Ę“|B
16 :
2007/03/04(“ú) 00:06:22
>>15
’Pƒ‚É

gawk '{print $0}' http://foo.org/index.html

‚Ć‚Š‚ĹƒV[ƒ€ƒŒƒX‚ɃAƒNƒZƒX‚Ĺ‚Ť‚é‚Ć‚˘‚¤‚Ů‚¤‚Ş•Ö—˜‚Č‚Ě‚Š‚Č?
17 :
2007/03/04(“ú) 00:24:42
http://www.gnu.org/software/gawk/manual/gawkinet/gawkinet.html#Web-page
‚Š‚çAŠČ’P‚Č—áB

BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/www.yahoo.com/80"
print "GET http://www.yahoo.com" |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
18 :
2007/03/04(“ú) 00:38:54
awk‚ĹSQL‚Ěleftjoin‚Ý‚˝‚˘‚Č‚ą‚Ć‚Ĺ‚Ť‚éH
19 :
2007/03/04(“ú) 01:55:43
>>17
‚Č‚ń‚ś‚á‚ą‚č‚áB
wget -O - http://www.yahoo.com/ ‚̏o—Í‚đ“Ç‚Ţ‚Ě‚Ć‘S‘R•Ď‚í‚ç‚ń‚ȁB
20 :
2007/03/04(“ú) 03:46:24
>>16
‚Ü‚  wget‚Ć‚ŠcurlŽg‚Á‚Ä•W€“ü—Í‚Š‚çŽć‚ę‚ć‚Ć‚˘‚¤˜b‚ŕ‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁA
http://‚Ů‚°‚Ů‚° ‚Í“Á•Ęˆľ‚˘‚ľ‚Ä‚­‚ę‚é‚Ć‚¤‚ę‚ľ‚˘‚Č‚ ‚ĆŽv‚Á‚Ä‚éB

‚Ü‚ HTML“Ç‚ń‚Ĺ‚ť‚ę‚đ‰đÍ‚ˇ‚éŽčŠÔ‚ŞŽŸ‚É‘Ň‚Á‚Ä‚é‚Ż‚Ç‚łw
21 :
2007/03/04(“ú) 03:55:11
ƒGƒ“ƒR[ƒfƒBƒ“ƒO‘Ήž‚Ć‚ŠFXl‚Ś‚é‚ƁAawk‚ĹHTML‚đˆ—‚ľ‚悤‚Ć‚ˇ‚é‚Ů‚¤‚Ş
–ł—‚Ş‚ ‚銴‚śB
‘f’ź‚ÉP‚Ĺ‚Í‚ś‚܂錞Œę‚Ć‚ŠŽg‚Á‚Ć‚Ż‚΁H‚Ý‚˝‚˘‚ȁB
22 :
2007/03/04(“ú) 04:55:31
>>21
P‚Ć‚ŠRŽg‚Ś‚Á‚Ä‚Ě‚Í‚Ü‚ ‚ť‚¤‚Č‚ń‚ž‚Ż‚ǁAHTML‚Ě‘Ă“–Ť‚Ć‚ŠƒGƒ“ƒR[ƒfƒBƒ“ƒO‚đ‹C‚É‚ľ‚Č‚˘‚Ĺ
‚˘‚˘Žg‚˘“š‚ōl‚Ś‚Ä‚˝(ŒÂl“I‚É‚ť‚¤‚˘‚¤Žů—v‚Ş‚ ‚é)‚̂łˁB
HTML‚ÉŠÖ‚ľ‚Ä‚Í‚Ť‚ż‚ń‚Ć‚ľ‚˝ƒhƒLƒ…ƒƒ“ƒg‚Č‚çxgawk‚Ĺ‚Ç‚¤‚É‚Š‚Č‚é?


23 :
2007/03/14(…) 16:26:36
ĚAFortranAC‚Ž‚炢‚ľ‚Š’m‚ç‚Č‚Š‚Á‚˝ŽžA
u‚Ś‚ÁA‚ą‚ń‚Ȑ”s‚ĹŒvŽZo—ˆ‚é‚́Hv
uƒvƒƒOƒ‰ƒ€“ŕ‚Ƀtƒ@ƒCƒ‹–ź‘‚Š‚Č‚­‚Ä—Ç‚˘‚́Hv
u‚ą‚̐”s‚ŁA‚ˇ‚×‚Ä‚Ěƒf[ƒ^‚ĚŒvŽZ‚ľ‚Ä‚­‚ę‚é‚́Hv
‚Á‚āA‹Á‚Ť‚Č‚Ş‚ç—Fl‚É‹ł‚Ś‚Ä‚ŕ‚炢‚Ü‚ľ‚˝B
Ą‚Č‚çAExcel‚Ĺ‚ˇ‚é‚悤‚ČŒvŽZ‚Í‚ˇ‚ׂÄawk‚Ĺ‚ľ‚Ä‚Ü‚ľ‚˝B
ƒAƒXƒL[‚Š‚ç256”{ƒVƒŠ[ƒY‚ޏo‚˝‚Ž‚炢‚ž‚Š‚ç
’–Ú‚ĚŒžŒę‚ž‚Á‚˝‚ń‚ž‚ć‚ˁB

24 :
2007/03/14(…) 16:40:22
Visicalc‚Ć1-2-3‚Íawkƒu[ƒ€‚ć‚čĚ‚Š‚ç‚ ‚Á‚˝‚ń‚ž‚Ż‚ǂˁB
UNIX‚Á‚ĈӊO‚ĆŒĂ‚­‚Č‚˘‚ń‚ž‚ć‚ˁB
25 :
2007/04/14(“y) 08:00:42
>10
”­sŠ‚ސV‹IŒłŽĐ‚́uƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKv‚đ2005”N‚ɒ艿3465‰~iĹžj‚Ĺ”ƒ‚˘‚Ü‚ľ‚˝B
‰œ•t‚Ɂu–{‘‚Í1989”N11ŒŽ‚ÉŠ”ŽŽ‰ďŽĐƒgƒbƒpƒ“‚ć‚č”­s‚ł‚ę‚Ü‚ľ‚˝B‚ą‚Ě“xAŠ”ŽŽ‰ďŽĐV‹IŒłŽĐ‚ć‚čAŒ´o”ŎЁA–óŽŇ‚Ě‹–‰Â‚đ“ž‚ÄÄ”­s‚˘‚˝‚ľ‚Ü‚ľ‚˝Bv‚Ə‘‚Š‚ę‚Ä‚˘‚Ü‚ˇB
26 :
2007/04/14(“y) 09:43:47
V‹IŒłŽĐ‚Á‚ÄRPG‚Ě–{‚ľ‚Šo‚ľ‚Ä‚Č‚˘‚ĆŽv‚Á‚Ä‚˝‚Š‚çˆÓŠO‚žB
27 :
2007/04/14(“y) 13:42:47
‘ĺĚ‚É’Ę‚Á‚Ä‚˝‚ę‚Ě“y–؍HŠw‰Č‚É‚Íawk‚ĚŽö‹Ć‚Ş‚ ‚Á‚˝
ŽŔŒą‚Ěƒf[ƒ^ˆ—‚É‚Ĺ‚ŕŽg‚Á‚Ä‚Ů‚ľ‚Š‚Á‚˝‚ń‚ž‚낤
28 :
2007/04/16(ŒŽ) 17:34:08
>24
awkƒu[ƒ€‚́Aź—ď‚ž‚Ɖ˝”N ‚Ĺ‚ľ‚傤‚Š?
29 :
2007/04/17(‰Î) 00:31:15
>>28
DOS––ŠúB256”{–{‚ޏo‚˝93”N ‚ރs[ƒN‚ł́B
Œă‚ĚPerl‚Ć‚Í”äŠr‚É‚Č‚ç‚Č‚˘ƒvƒ`ƒu[ƒ€‚ž‚Ż‚ǁB
30 :
2007/04/17(‰Î) 08:45:33
>29
Œä‰ń“š‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
31 :
2007/05/04(‹ŕ) 21:28:49
Ĺ‹ß‚̏î•ń‚́A‚ą‚ż‚çI
ttp://gauc.no-ip.org/
32 :
2007/07/14(“y) 08:27:58
‹SŽÔawk‚đ’N‚Šě‚Á‚Ä‚­‚ę‚Č‚˘‚Š‚ȁ[
33 :
2007/07/15(“ú) 03:17:40
>>32
‚˘‚˘‚ą‚ĆŒž‚¤‚Ë‚ĽB
Ž^Ź!
34 :
2007/09/03(ŒŽ) 08:59:45
‚ ‚Ćƒ[ƒJƒ‹•Ď”‚Ş—~‚ľ‚˘‚Č
35 :
2007/09/03(ŒŽ) 10:30:14
function‚Ě’†‚̓[ƒJƒ‹•Ď”‚É‚Č‚é‚ćB
36 :
2007/09/04(‰Î) 00:12:17
‚˘‚‚Š‚çH–˘‚ž‚Ɉř”‚É•Ŕ‚ׂé‚ŕ‚ń‚ž‚ƁB
37 :
2007/09/04(‰Î) 09:33:02
‚ [A‚˛‚ß‚ńAˆř”•Ŕ‚ׂ˝‚â‚‚ރ[ƒJƒ‹•Ď”‚É‚Č‚éB‚ž‚Á‚˝B
ć‚ɐ錞‚ˇ‚ę‚΂˘‚˘‚ń‚ž‚Š‚ç•Ę‚É‚ć‚­‚ˁH
38 :
2007/09/09(“ú) 04:42:02
ƒLƒ‚‚˘‚â‚ńB‚ť‚Ě‚â‚č•űB
39 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/09/14(‹ŕ) 04:37:24
‚ą‚ę‚Š‚çawk‚đ•×‹­‚ľ‚Ü‚ˇB
40 :
2007/09/14(‹ŕ) 09:05:13
awk‚đŠw‚Ô‚ą‚Ć‚É‚Č‚é‚Ĺ‚ľ‚傤B
41 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/09/15(“y) 01:03:04
‚Ý‚Č‚ł‚ńawk‚ÍŒę‚ç‚Č‚˘‚Ě‚Ĺ‚ˇ‚ˁB
42 :
2007/09/15(“y) 10:28:44
‘D“Şawk‚ľ‚Ä‘DŽR‚É“o‚éB
43 :
2007/09/16(“ú) 03:03:51
l‚ÉŒž‚Ś‚é‚Ů‚Çawk’m‚Á‚Ä‚é–ó‚Ĺ‚ŕ–ł‚˘‚ľ
44 :
2007/09/16(“ú) 10:27:22
‚ž‚Ż‚ǐl‚Ě˜b‚Í•ˇ‚Ť‚˝‚˘‚ľ
45 :
2007/09/17(ŒŽ) 18:12:15
awk‚Ú—˜’Ę
46 :
2007/09/19(…) 08:55:44
1
47 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/09/19(…) 16:41:49
awk‚đ•×‹­‚ľ‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚ށAPerl‚ÉŠľ‚ę‚Ä‚˘‚é‚Š‚ç‚Š
awk‚Ĺ‚Ĺ‚Ť‚é‚ą‚Ć‚ÍPerl‚Ĺƒƒ“ƒ‰ƒCƒi[‚Ĺ‚â‚Á‚˝‚Ů‚¤‚Ş(­‚Č‚­‚Ć‚ŕŽŠ•Ş‚É‚Ć‚Á‚Ä‚Í)‘Ź‚˘‹C‚Ş‚ľ‚Ä‚Č‚č‚Ü‚š‚ńB
‚ą‚ę‚ɂ‚˘‚Äawkn—űŽŇ‚Ĺ‚ ‚éŠF—l‚Í‚˘‚Š‚Ş‚¨l‚Ś‚É‚Č‚č‚Ü‚ˇ‚ŠH
‚ą‚¤‚˘‚¤Žž‚Íawk‚Ě‚Ů‚¤‚Ş•Ö—˜I‚Ć‚˘‚¤—á‚É‚Í‚Ç‚ń‚Č‚ŕ‚Ě‚Ş‚ ‚č‚Ü‚ˇ‚ŠH
48 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/09/19(…) 16:43:11
Ş‚ ‚Á‘Ź‚˘‚Ć‚˘‚¤‚̂́AƒR[ƒh‚đ‘‚­‚Ě‚Ş‘Ź‚˘‚Ć‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
49 :
2007/09/19(…) 16:48:06
>>47
perl ‚Í‚Č‚­‚Ä‚ŕ awk ‚Č‚ç“ü‚Á‚Ä‚˘‚鎖‚Ş‚ ‚é
50 :
2007/09/19(…) 16:53:58
uƒR[ƒh‚đ‘‚­‚Ě‚Ş‘Ź‚˘v‚Ć‚˘‚¤Šî€‚ŁA
u‚ą‚¤‚˘‚¤Žž‚Íawk‚Ě‚Ů‚¤‚Ş•Ö—˜v‚Ć‚˘‚¤—á‚𑟐l‚É‹“‚°‚ł‚š‚Ä‚ŕA
‚ť‚ę‚Í‚ť‚̐lŠÔ‚É‚Ć‚Á‚Ä‚Ě‘Ź‚˘‹C‚Ş‚ˇ‚é•Ö—˜‚ł‚Ĺ‚ ‚Á‚āA
ˆÓ–Ą‚Ě‚ ‚éˆę”Ę“I‚Č‹c˜_‚É‚Č‚ç‚Č‚˘‚Ě‚Ĺ‚Í‚Č‚˘‚ŠH
51 :
2007/09/19(…) 16:57:51
Perl‚ŕRuby‚ŕPython‚ŕŽg‚¤‚Ż‚ǁA“Á’č‚ĚƒJƒ‰ƒ€‚ž‚Ż‚É‹ť–Ą‚Ş‚ ‚éƒP[ƒX‚Í
–łˆÓŽŻ‚Éawk‚đŽg‚¤‚ą‚Ć‚ŕ‚ ‚éB

perl -a ‚Ć‚Š cut‚ľ‚Äpaste‚Ć‚Š‚ŕ‚ ‚é‚Ż‚ǁB
52 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/09/19(…) 18:19:27
>>49 ŠÂ‹Ť‚É‚ć‚炸“ü‚Á‚Ä‚˘‚é‚Ć‚˘‚¤‚ą‚Ć‚Ĺ‚ˇ‚ˁB

>>50@‚ť‚¤‚Ĺ‚ˇ‚ˁB
‚Č‚şawk‚Č‚Ě‚ŠA
ˆę”Ę“I‚É‚Í‚Ç‚¤‚˘‚¤Žž‚Éawk‚ŞŽg‚í‚ę‚é‚Ě‚ŠA
‚Ć‚˘‚¤‚Ě‚ŞƒCƒ}ƒCƒ`ŽŠ•Ş‚Ě‚Č‚Š‚Ĺ•Ş‚Š‚Á‚Ä‚˘‚Č‚˘‚Ě‚Ĺ‚ˇB

>>51 ­‚ľ•×‹­‚ľ‚˝ŒŔ‚č‚ł́AŠm‚Š‚ɃJƒ‰ƒ€‚ĚŽć‚čo‚ľ‚Íawk‚Ş•Ö—˜‚Č‚Ě‚Š‚ŕ‚ĆŽv‚˘‚Ü‚ľ‚˝B

53 :
2007/09/19(…) 19:55:33
>>52
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ě’†‚ŁA•nŽă‚ČƒVƒFƒ‹‚ĚŒvŽZ”\—Í‚đ
•â‚¤‚˝‚߂ɁAƒc[ƒ‹ƒ{ƒbƒNƒX‚Ěˆę‚‚Ƃľ‚ÄŽg‚í‚ę‚é‚ą‚Ć‚Ş‘˝‚˘B

‚̂ŁAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚đ‘‚­‹@‰ď‚Ş‘˝‚˘‚Ě‚Č‚çA‚â‚Á‚Ä‚¨‚˘‚Ä
‘š‚Í–ł‚˘‚ĆŽv‚¤‚ށAƒtƒbƒgƒvƒŠƒ“ƒg‚Ş‘˝­ƒfƒJƒC‚ą‚Ć‚Ć‚â‚âˆÚAŤ‚É
Œ‡‚Ż‚é‚ą‚Ć‚đ‹C‚É‚ľ‚Č‚Ż‚ę‚΁A•Ę‚ÉPerlŽg‚Á‚˝‚Á‚Ä‚˘‚˘‚í‚Ż‚ž
i‚Ç‚¤‚šĄ‚Č‚ç‘ĺ’ď‚ÍŽg‚Ś‚é‚ž‚낤‚ľAawk‚É‚ľ‚Ä‚ŕˆę‰žPosix•W€‚ž‚Ş
FX•ĎŽí‚Ş‚ ‚éjB

‚܁A’P‚É•Ö—˜‚ČƒXƒNƒŠƒvƒgŒžŒę‚Ş—~‚ľ‚˘‚ž‚Ż‚Č‚çAĄXawk‚đ‚â‚éˆÓ–Ą‚Í
‚Ů‚Ć‚ń‚Ç‚Č‚˘‚ž‚낤B
ƒtƒB[ƒ‹ƒh•ŞŠ„‚ž‚Ż‚Č‚çperl -a‚Ĺawk‚̐^Ž—‚Ş‚Ĺ‚Ť‚é‚ľ‚ȁB
54 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/09/19(…) 20:06:52
>>53 ’š”J‚Č‚¨•ÔŽ–‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
ƒVƒFƒ‹‚ĚŒvŽZ‚Ě•â•‚Ĺ‚ˇ‚ŠB
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚đ‘‚­‹@‰ď‚Í‘˝­‚Í‚ ‚é‚̂ŁA‘˝­‚ÍŠo‚Ś‚Ä‚¨‚ą‚¤‚ĆŽv‚˘‚Ü‚ˇB
55 :
2007/09/19(…) 21:00:04
awk‚Ćper‚ŒAˆ—‘Ź“x‚Í‚Ç‚Á‚ż‚Ş‘Ź‚˘‚ń‚ž‚ëH
‚Á‚ăIƒ}ƒG‚ŞŽŽ‚š‚Á‚ÄŒž‚í‚ę‚ť‚¤‚ž‚Ż‚Ç‚Ó‚ĆŽv‚Á‚˝‚ń‚ŏ‘‚˘‚Ä‚Ý‚˝B
56 :
2007/09/19(…) 22:17:45
awk‚͏ˆ—Œn‘˝‚˘‚Š‚ç‚Č‚Ÿ
‰˝‚̏ˆ—‚Š‚É‚ŕ‚ć‚é‚ž‚낤‚ľ
57 :
2007/09/19(…) 23:45:00
‚Ç‚ż‚ç‚ŕ“žˆÓ‚Ć‚ˇ‚é’Pƒ‚ČƒeƒLƒXƒg‚ĚƒtƒBƒ‹ƒ^ƒŠƒ“ƒOˆ—‚Č‚çA
I/O‘Ź“x‚Ő§ŒŔ‚ł‚ę‚é‚Ě‚Ĺ‚Ç‚ż‚ç‚Ĺ‚ŕ(ˆ˝‚˘‚Ísed‚đŽ‚żo‚ľ‚Ä‚ŕ)‘ĺ‚ľ‚Ä•Ď‚í‚ç‚Č‚˘‚ĆŽv‚¤B

awk‚̐^œ’¸‚͈ęs–ě˜Y‚É‚ ‚é‚ĆŽv‚¤Ž„‚́A‚ą‚ń‚Č‚Ě‚đ‚ć‚­‘‚ŤŽĚ‚Ä‚éB
--
awk 'BEGIN {print 1+2*3-4;}'
ls -l /tmp|awk '$5>0'
ls -l |awk '{sum+=$5;} END{print sum;}'
58 :
2007/09/19(…) 23:51:16
Perl‚É‚˝‚˘‚ˇ‚éAwk‚ĚŒťŽŔ“IƒƒŠƒbƒg‚̓ƒ‚ƒŠÁ”ď‚Ş­‚Č‚˘‚ą‚Ć‚­‚炢‚Ĺ
‚ą‚ę‚͍Ą‚ĚŒvŽZ‹@‚Ĺ‚Í”÷X‚˝‚é–â‘č‚žB
ESR‚ĚArt of UNIX Programming‚𗧂ż“Ç‚Ý‚ľ‚˝‚ç
Awk‚ރƒ‚ƒŠß–ń‚Ě‚˝‚ß‚ÉŽd—l‚đ§ŒŔ‚ľ‚˝‚ą‚Ć‚Ş
‘Šú‚É‹Ł‘ˆ—Í‚đ‚Č‚­‚ľ‚˝——R‚Ć˜_‚ś‚Ä‚˘‚˝B
ƒoƒbƒh‚ČŒžŒęÝŒv‚ĚŒŠ–{‚Á‚ÄŠ´‚ś‚ŁA‚ż‚Ć•s–ů‰ő‚ž‚Á‚˝
59 :
2007/09/22(“y) 02:28:36
>>57
‰´‚ாX‚â‚éB
‚ť‚ĚŽž‚Í•Ö—˜I‚ĆŽv‚Á‚Ä.cshrc‚Ć‚Š‚Éalias“o˜^‚ˇ‚é‚Ż‚Ç‚ˇ‚Ž‚É–Y‚ę‚Ä“Ż‚ś“ŕ—e‚đŽč‘Ĺ‚ż‚ľ‚Ä‚˝‚股‚é
‚ť‚Ě‹“‹ĺ‚É‚ą‚ę‚Í•Ö—˜I‚ĆŽv‚Á‚Ä.cshrcŠJ‚­‚ĆŠů‚É“o˜^‚ľ‚Ä‚ ‚é‚Ć‚˘‚¤c
60 :
2007/09/22(“y) 09:21:37
>>59
‘S‰´‚Ş‹¤Š´‚ľ‚˝B
61 :
2007/09/24(ŒŽ) 12:01:33
i.cshrc‚đ.bashrc‚É’u‚ŤŠˇ‚Ś‚āj@‰´‚ŕ“Ż‚śŒoŒą‚Ş‚ ‚éB
62 :
2007/09/28(‹ŕ) 00:37:50
uˆęs–ě˜Yv‚Í–ź–ó
63 :
2007/09/28(‹ŕ) 01:20:24
‚Ţ‚Š‚ľAu“Ǐ‘‚ˇ‚éƒvƒƒOƒ‰ƒ}v‚đ‚ć‚ń‚ŁAawk‚ʼnďŒv‚đ‚ˇ‚é‚Ě‚Ş‚Š‚Á‚ą—Ç‚˘‚Ć
‚¨‚ŕ‚Á‚Ä‚Ü‚ľ‚˝B
‚Ĺ‚ŕŠm’č\‚đ‚ˇ‚ég‚É‚Č‚Á‚˝‚çEXCEL‚đŽg‚Á‚Ä‚˘‚éB

uƒGƒ“ƒWƒjƒA‚Ě‚˝‚ß‚ĚŽ––ąě‹Ć sed awk grep ‚ť‚ľ‚ÄTexv‚Č‚ń‚ď‘Đ‚Ş‚ ‚ę‚ΐH‚˘‚‚­‚Ě‚É...
64 :
2007/09/28(‹ŕ) 02:53:12
awk‚ʼnďŒv—pƒXƒNƒŠƒvƒg‚đ‘‚­‚ć‚čA‰ďŒv‚Ě‚ľ‚­‚Ý‚đ—‰đ‚ˇ‚é‚ą‚Ć‚Ě•ű‚Ş
‰´‚É‚Í—y‚Š‚É“ď‚ľ‚˘
65 :
2007/09/28(‹ŕ) 14:47:04
Perl‚ž‚Ż‚ǁA‚ą‚ę‚́H
http://www.moge.org/okabe/temp/balance/
66 :
2007/10/02(‰Î) 02:19:46
Perl ‚̓R[ƒhˆę–ÚŒŠ‚ĉ´‚Şcore“f‚Ť‚ť‚¤‚É‚Č‚é
67 :
2007/10/02(‰Î) 07:50:30
”CˆÓ‚É core ‚Ş“f‚Ż‚˝‚ç•Ö—˜‚ž‚ć‚ȁB“ú‹L‘ă‚í‚č‚É‚Č‚éB
68 :
2007/10/02(‰Î) 08:00:10
>>67
‘ĚŒ^ˆŰŽ‚Ě‚˝‚ß‚É—]‹V‚Č‚­‚ł‚ę‚Ä‚˘‚él‚ŕ‚˘‚˝‚悤‚Ĺ‚ˇB
Žw‚đA‚É“ü‚ę‚é‚悤‚É‚ˇ‚é‚̂ŁA‘­‚ÉŒž‚¤‚°‚ë‚ž‚ą‚ŞŽw‚É‚Ĺ‚Ť‚Ü‚ˇB
69 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/10/03(…) 23:18:59
awk‚Á‚Ä‚Č‚ń‚ĹPerl•—‚ɐł‹K•\Œť’uŠˇ‚Ĺ‚Ť‚é‚悤‚É‚Č‚ç‚ń‚́B“ĆŽŠŠg’Ł‚Ĺ‚ŕ‚˘‚˘‚ń‚ž‚Ż‚ǂȁB
70 :
2007/10/04(–Ř) 02:48:29
>>69
‚ńA‚­‚í‚ľ‚­B

Perl‚Ěƒƒ^•śŽš‚đŽg‚˘‚˝‚˘‚Ć‚˘‚¤‚Ě‚Ć‚Íˆá‚¤‚Ě?
#Žg‚Ś‚ń‚í‚Ż‚ž‚Ş
71 :
2007/10/04(–Ř) 21:53:48
awk‚ÍDFA‚Ĺperl‚ÍNFA‚ž‚Á‚Ż‚Š?
72 :
2007/10/05(‹ŕ) 02:45:00
>>71
ƒIƒŠƒWƒiƒ‹‚ł͂ˁB
’†‚É‚ÍNFA‚đŽg‚Á‚Ä‚˘‚éawk‚ŕ‚ ‚éBmawk‚Ć‚ŠB
73 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2007/11/22(–Ř) 06:36:33
xgawk‚Ĺ‘˝”{’ˇŽ”‚đŽg‚˘‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA
printf( "%ld\n", num );
‚Ĺ‚ÍŒ…”‚Í‘‚Ś‚Ä‚ŕ¸“x‚Íă‚Ş‚Á‚Ä‚Č‚˘‚悤‚Ĺ‚ˇB
Œ^éŒž‚ˇ‚é‚É‚Í‚Ç‚¤‚ˇ‚é‚Ě‚Ĺ‚ľ‚傤‚Š
74 :
2007/11/22(–Ř) 07:17:23
>>73
‘˝”{’ˇŽ”‚đŽŔ‘•‚ˇ‚é‚Ě‚ÉŒÂ•Ę‚Ě¸“x‚đă‚°‚Ä‚Ç‚¤‚ˇ‚éB
75 :
2007/11/22(–Ř) 07:34:48
xgawk‚Í‘˝”{’ˇŽ”‚ ‚é‚ń‚Ĺ‚ˇ‚ć‚ˁH
‚ŁAruby‚̂悤‚É–łéŒž‚ĹŽg‚Ś‚é‚Š‚ĆŽv‚Á‚˝‚ç‚ť‚¤‚Ĺ‚Í‚Č‚˘‚ç‚ľ‚˘‚̂ŁA
‚Ç‚¤‚ˇ‚é‚Ě‚Š‚ƁB

http://home.vrweb.de/~juergen.kahrs/gawk/XML/xmlgawk.html
‚˘‚Ü‚ą‚Ě‚Ö‚ńŒŠ‚Ä‚é‚ń‚Ĺ‚ˇ‚Ş
76 :
2007/11/22(–Ř) 08:47:49
MPFR,‘˝”{’ˇŽ”‚Ĺ‚Í‚Č‚­ŽŔ”‚Š‚ȁB
ƒOƒO‚Á‚ÄŒŠ‚‚Ż‚Ü‚ľ‚˝B
http://www.kt.rim.or.jp/~kbk/zakkicho/zakkicho7.html#D060126

http://golf.shinh.org/p.rb?Factorial
ŽŔ‚Í‚ą‚ę‚â‚Á‚Ä‚é‚ń‚Ĺ‚ˇ‚ށB
‚ ‚Ć‚Ídll‚ĚƒpƒX‚Ş•Ş‚Š‚ę‚΁EEE
77 :
2007/11/26(ŒŽ) 21:13:28
>>76
u‚ ‚Č‚˛‚év‚Ě xgawk ‚Í MPFR Ď‚ń‚Ĺ‚Č‚˘‚ĆŽv‚¤‚ށEEEB
78 :
2007/11/29(–Ř) 08:00:03
‚ť‚¤‚Ĺ‚ˇ‚Š
‚Ç‚ż‚ç‚É‚ľ‚Ä‚ŕŽŔ”‚Á‚ÄŽ–‚Í‚â‚Á‚Ď–ł—‚Č‹C‚Ş‚ľ‚Ü‚ľ‚˝
79 :
2008/01/04(‹ŕ) 07:28:20
sed‚Ý‚˝‚˘‚ɁAƒpƒ^[ƒ“•”•Ş‚đs”ԍ†‚ĹŽw’čo—ˆ‚Ü‚š‚ń‚ŠH
80 :
2008/01/04(‹ŕ) 09:32:19
>>79
awk 'NR == 79 {print;}'
‚Á‚Ä‚ą‚Ć? ‚ť‚ę‚Ć‚ŕA
awk 'FNR == 79 {print;}'
‚Á‚Ä‚ą‚Ć?
81 :
2008/01/04(‹ŕ) 14:24:54
>80
‚Í‚ś‚ßsed‚Ý‚˝‚˘‚É 10,35{ ‚Ý‚˝‚˘‚ČŠ´‚ś‚ɏ‘‚˘‚ă_ƒ‚ž‚Á‚˝‚Ě‚Ĺ; }
•’Ę‚É”äŠrŽŽ‘‚­‚ń‚Ĺ‚ˇ‚ˁB10<=NR&&NR<=35{ ‚ŏo—ˆ‚Ü‚ľ‚˝; }
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
82 :
2008/01/05(“y) 00:50:26
>>81
‚ŕ‚¤­‚ľ sed ‚ç‚ľ‚­‚ľ‚˝‚˘‚Č‚çA
10==NR, NR==35 { print }
‚Č‚ń‚Ä‚Ě‚ŕ‚ ‚č
83 :
2008/01/14(ŒŽ) 09:02:50
awk ‚̓IƒvƒVƒ‡ƒ“‚Č‚ľ‚ž‚Ćƒƒ“ƒ‰ƒCƒi[‚ĚƒR[ƒh‚đ‘‚­‚ą‚Ć‚É‚Č‚é‚ĆŽv‚˘‚Ü‚ˇ‚Ş
ŽŔŰ awk ‚Ěƒƒ“ƒ‰ƒCƒi[‚Á‚Ä‚Ç‚ń‚ČŽž‚ÉŽg‚˘‚Ü‚ˇ‚ŠH
‚ ‚Ü‚čŒŠ‚˝‚ą‚Ć‚Ş‚Č‚­‚āc
84 :
2008/01/14(ŒŽ) 09:45:08
>>83
UNIX‚Ĺ‚Í‘˝‚­‚Ěƒtƒ@ƒCƒ‹‚âo—Í‚Ş—“‹ćŘ‚čƒeƒLƒXƒg‚ĚŒ`ŽŽ‚É‚Č‚Á‚Ä‚˘‚é‚Š‚ç
‚ť‚̏ęŽg‚˘ŽĚ‚ăƒ“ƒ‰ƒCƒi[‚Ş–{—ˆ‚ĚŽg‚˘•ű‚Č‚ń‚ž‚Ż‚ǁA
‘ź‚ĚOS‚ž‚Ć BEGIN ‚đ main ‘ă‚í‚č‚ÉŽg‚¤‚悤‚Ȃ̂΂Á‚Š‚É‚Č‚é‚Š‚ŕ‚ˁB
85 :
2008/01/14(ŒŽ) 09:46:06
>>83‚Şsed‚đ‚Ç‚¤Žg‚Á‚Ä‚˘‚é‚Ě‚Š‹C‚É‚Č‚éB
sedƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚Ć‚Šě‚Á‚āAƒXƒNƒŠƒvƒg‚Ěˆř”‚ɏˆ—‘ÎŰ‚Ěƒtƒ@ƒCƒ‹‚đ“n‚ľ‚Ä‚˝‚股‚é‚Ě‚Š‚ȁB
86 :
2008/01/14(ŒŽ) 10:18:29
‚ć‚­‘‚­ˆęs–ě˜YB
--
du -sk /tmp/* | awk '{sum += $1;} END {print sum / NR;}'
# ‚Ü‚ŸAdu‚Á‚Ä‚Ě‚ÍĄŽv‚˘‚‚˘‚˝‚ž‚Ż‚ŁAŽŔŰ‚Édu‚̏o—Í‚Ě•˝‹Ď‚đŽć‚é‚ą‚Ć‚Í‚Č‚˘‚Ż‚ǂˁB
--
paste foo bar | awk '($1 - $2) > 1e-3 || ($1 - $2) < -1e-3 {print NR, $0;}'
# ˆę’v‚đŒŠ‚é‚ž‚Ż‚Č‚çdiff‚Ĺ‚˘‚˘‚Ż‚ǁA‹ßŽ—‚đŒŠ‚é‚É‚ÍŽg‚Ś‚Č‚˘‚ń‚ŁB
87 :
2008/01/15(‰Î) 18:34:44
>>85
sed‚Í’P‘Ě‚Ě–˝—ß‚đŒŠ‚Äu’uŠˇvus‚̐؂čŽĚ‚āv‚Ý‚˝‚˘‚Č—p“r‚Ş
ƒpƒb‚ĆŒŠ‚ÄŽv‚˘•t‚­‚Ě‚Ĺ‹^–â‚Í•Ś‚Š‚Č‚˘‚ń‚Ĺ‚ˇB

awk‚͂ЂƂ‚ЂƂ‚̖˝—ß‚đŒŠ‚Ä‚ŕ
•’Ę‚ÉƒXƒNƒŠƒvƒgŒžŒę‚Ě–˝—ß‚Ć‚ľ‚ŠŽv‚Ś‚Č‚˘‚Ě‚Ĺ
uƒR[ƒh‘‚­‚Č‚ç‚Ć‚ŕ‚Š‚­Aƒƒ“ƒ‰ƒCƒi[‚Ĺ‚Ç‚¤Žg‚¤‚́Hv‚Ć
‹^–â‚đ‚ŕ‚Á‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇB

>>86
‚¤`‚ńAŒ‹\•ĄŽG‚É‚Č‚č‚Ü‚ˇ‚ˁB
‚ť‚ę‚ž‚ĆŽ„‚Č‚çƒ^[ƒ~ƒiƒ‹‚ɏ‘‚Š‚¸‚É
ƒR[ƒh‚É‹N‚ą‚ľ‚Ä‚ľ‚Ü‚˘‚ť‚¤‚Ĺ‚ˇB

‚Ĺ‚ŕAƒpƒ^[ƒ“‚ĆƒtƒB[ƒ‹ƒh‚đăŽč‚­Žg‚Ś‚Î
FXo—ˆ‚é‹C‚Ş‚ľ‚Ä‚Ť‚Ü‚ľ‚˝B
—á‚đ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
88 :
2008/01/15(‰Î) 18:59:18
‚ AƒR[ƒh‘‚Ť‚ť‚¤‚Č‚Ě‚ÍŒăŽŇ‚Ĺ‚ˇB
•˝‹Ď‚Ć‚Š‡Œv‚Ý‚˝‚˘‚Čƒ‚ƒm‚É‚Í—Ç‚ł‚ť‚¤‚Ĺ‚ˇ‚ˁB
89 :
2008/01/15(‰Î) 19:28:50
Ą“ú‘‚˘‚˝ˆęs–ě˜YB
--
awk '{for (ic = 1; ic <= NF; ++ic) {if (max < $ic) max = $ic;}} END {print max;}'
--
‚ą‚ę‚ŕ‘SƒtƒB[ƒ‹ƒh‚ÉŠg’Ł‚ľ‚Ä‚˘‚é‚ž‚Ż‚ŁA’P‚ÉĹ‘ĺ’l‚đ“ž‚Ä‚˘‚é‚ž‚Ż‚ž‚ˁB
90 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/01/22(‰Î) 16:52:32
‚ć‚­‘‚­ˆęs
du -k|awk '$1 > 10000'
‚Ĺ‚Š‚˘ƒfƒŒƒNƒgƒŠ‚đ‚ł‚Ş‚ˇ
91 :
2008/01/29(‰Î) 23:34:51
‰´‚Ş‚ć‚­‘‚­ˆęs–ě˜Y
$ awk 1 > hoge.sh
92 :
2008/01/31(–Ř) 12:58:14
>>91
‚ť‚ę‚ɉ˝‚ĚˆÓ–Ą‚Ş?
cat > hoge.sh‚Ĺ‚ŕŽ–‚Ş‘Ť‚č‚ť‚¤‚ž‚ށB
93 :
2008/01/31(–Ř) 18:48:07
>92
Windows‚Éawk“ü‚ę‚Ä‚˝Žž‚ɁA‚ą‚ń‚Čƒwƒ“‚Č•Č‚Ş•t‚˘‚Ä‚ľ‚Ü‚Á‚˝B
94 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/02/02(“y) 12:38:28
‚ˇ‚Ý‚Ü‚š‚ńA‰SŽŇ‚Ĺ‚ˇ‚Şawk‚ÉŠÖ‚ˇ‚é˝Ú‚Ş‚ą‚ą‚ľ‚Š‚Č‚Š‚Á‚˝‚̂ŁB
Ť‚Ěƒ\[ƒX‚đ‘‚˘‚Ä‚˘‚˝‚ž‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށA‚˘‚Á‚˝‚˘‚Ç‚¤‚ˇ‚ę‚ÎŽg‚Ś‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚ż‚Ȃ݂ɁA‚ą‚ę‚̓tƒHƒ‹ƒ_“ŕ‚ĚWinrarŒ`ŽŽƒtƒ@ƒCƒ‹‚ĚƒŠƒJƒoƒŠƒŒƒR[ƒh‚Ş•t‚˘‚Ä‚˘‚é‚Š”Ű‚Š
ƒŠƒXƒg‚đˆęŠ‡‚ŏo—Í‚ˇ‚é‚ŕ‚Ě‚Ĺ‚ˇB
‚ć‚ë‚ľ‚ą
**************
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ž‚Ż‚Çunrar lt sample.rar‚̏o—Í—˜—p‚ľ‚ăŠƒXƒg‚đě‚é‚ž‚Ż
Žg‚˘•ű‚̓pƒCƒv‚Ĺawk‚É“n‚ľ‚ďˆ—unrar lt *.rar | gawk -f rr.awk
awk‚Č‚ń‚Š“ü‚Á‚Ä‚Č‚˘‚ž‚낤‚Š‚ç“–‘R‚ť‚Ě‚Ü‚Ü‚ś‚á“Ž‚Š‚Č‚˘

rr.awk
#!/usr/local/bin/gawk

BEGIN {$rr=0; printf "%-30s\t%s\n", "FileName", "RecoveryRecord";}

{if($1=="Solid" && $2=="archive"){
for(i=3;i<=NF;i++) printf "%-30s ",$i;printf "\t";getline;getline;
if($0=="Recovery record is present"){printf "Yes / ";
for(;;){getline;if($0=="Data header type: RR"){getline;printf "%sbyte\n",$2;break;}}
}else printf "No\n";}}
95 :
2008/02/02(“y) 13:01:48
‚ť‚ę‚đ“Ž‚Š‚ˇ‚É‚Í‚Ü‚¸ gawk ‚đ‚Ç‚ą‚Š‚Š‚ç“üŽč‚ˇ‚éB
96 :
2008/02/02(“y) 17:48:45
>>94
>Ť‚Ěƒ\[ƒX‚đ‘‚˘‚Ä‚˘‚˝‚ž‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށA

‘‚˘‚˝l‚É•ˇ‚­B

‚Ć“š‚Ś‚é‚ƁA‚í‚Ż‚Ě‚í‚Š‚ç‚ń——R‚đŒž‚Á‚Ä‚˛‚Ë‚é‚ž‚낤‚Š‚çA
ć‚ÉŒž‚Á‚Ć‚­‚ƁA‚ť‚ń‚ČŒŠ‹ę‚ľ‚˘Œž‚˘–󂡂é‚ȁB

‚Ç‚¤‚š“š‚Ś‚˝‚Á‚āAĄ“x‚́››‚Ş‚í‚Š‚č‚Ü‚š‚ń‚Ć‚ŠŒž‚˘o‚ˇ‚ń‚ž‚ëH
‚Ç‚Á‚Š‚Š‚çgawk‚đ—Ž‚Ć‚ľ‚Ä“WŠJ‚ľ‚ë‚ćB‘S‚­AˆęśƒOƒO‚Á‚Ä‚ë‚ćƒJƒX
"C:\Program Files\WinRAR\UnRAR.exe" lt *.rar | "gawk‚Ěƒtƒ‹ƒpƒX" -f rr.awk
97 :
2008/02/10(“ú) 19:16:33
‚ˇ‚˘‚Ü‚š‚ńA‚ ‚éƒeƒLƒXƒg‚đ{print $1,$2}‚Ć‚ľ‚Ä’Šo‚ľ‚Ä

aaa 1
aaa 2
aaa 3
bbb 1
bbb 2
ccc 1
ccc 4
...

‚Ć‚Ü‚Ĺ‚Í‚Ĺ‚Ť‚˝‚ń‚Ĺ‚ˇ‚ށA•Ŕ‚ń‚Ĺ‚˘‚éƒf[ƒ^‚đ‚ť‚ę‚ź‚ęA

aaa 6
bbb 3
ccc 5

‚ƏWŒv‚ľ‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA‚ǂ̂悤‚É‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH
98 :
2008/02/10(“ú) 19:28:07
awk '{count[$1] += $2;} END{for (aaa in count) {print aaa count[aaa]}}'
‚ ‚Ć‚Íƒ\[ƒg‚ˇ‚ę‚΂˘‚˘‚Í‚¸
99 :
2008/02/10(“ú) 20:22:03
>98‚ł‚ńA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇI
î‚Ż‚Č‚˘‚Ě‚Ĺ‚ˇ‚ށAĄ‚Ü‚Ĺ•Ö—˜‚Čƒc[ƒ‹‚É—Š‚Á‚Ä‚˘‚Ä‘S‘RƒRƒ}ƒ“ƒh‚ɂ‚˘‚Ä—‰đ‚Ĺ‚Ť‚Ä‚˘‚Č‚Š‚Á‚˝‚Ě‚Ĺ˘‚Á‚Ä‚˘‚Ü‚ľ‚˝B
ŽŔ‚̓[ƒ‹ƒƒO‚Ĺ‘—MŽŇ‚Ş‚Ç‚ę‚ž‚Ż‚̒ʐ”‚𑗐M‚ľ‚Ä‚é‚Š‚đŠm‚Š‚ß‚é‚˝‚߂ɃRƒ}ƒ“ƒh‚Ĺ‚Ĺ‚Ť‚Č‚˘‚ŠA‚Ĺ>97‚ł‚܂¢‚Ä‚˘‚Ü‚ľ‚˝B
‰˝‚Ć‚Š“r’†‚Ü‚Ĺ‚Ĺ‚Ť‚˝‚ń‚Ĺ‚ˇ‚ށA”ńí‚ɃX[ƒp[ƒGƒŒƒKƒ“ƒg‚Č1sƒR[ƒh‚Ĺ‚ľ‚ācB

Žż–â‚‚˘‚łŐ\‚ľ–ó‚Č‚˘‚Ě‚Ĺ‚ˇ‚ށA
(aaa in count) {print aaa count[aaa]}
‚Ěaaa‚ɂ‚˘‚Ä‚Í‚Ç‚¤‰đŽß‚ˇ‚ę‚΂˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH

100 :
2008/02/10(“ú) 20:33:27
>>99
bash‚Ć‚Š‚Ěfor‚Ć‚Š‚Ć“Ż‚ś‚Ĺ“K“–‚Č•śŽš—ń‚Č‚ç‚Č‚ń‚Ĺ‚ŕ‚˘‚˘‚Ĺ‚ˇD—á‚ɏo‚Ä‚Ť‚˝aaa‚Č‚ń‚Š‚É‚ˇ‚é‚Š‚ç‚â‚â‚ą‚ľ‚­‚Č‚Á‚Ä‚ˇ‚Ý‚Ü‚š‚ńD
for(hoge in list) {...}
‚Ĺ”z—ńlist‚ĚƒL[‚đ•Đ‚Á’[‚Š‚çhoge‚É“ü‚ę‚㋁[ƒv‚ˇ‚é‚Á‚ĈӖĄ‚É‚Č‚é‚Í‚¸‚Ĺ‚ˇ‚ćD
101 :
2008/02/10(“ú) 20:36:22
98‚ś‚á‚Č‚˘‚Ż‚Ç

awk '{count[$1] += $2;} END{for (i in count) {printf "%s %i\n", i, count[i]}}'

‚ą‚¤‚â‚Á‚ď‘‚Ż‚΂ľ‚ń‚š‚‚ś‚á‚ˁH
ƒf[ƒ^‚Ě’†‚Ěaaa‚ĆloopƒJƒEƒ“ƒ^[‚Ěaaa‚đ“Ż‚ś–ź‘O‚É‚ˇ‚é‚Ě‚ÍˆÓ’nˆŤ‚ž‚ĆŽv‚¤‚ć

102 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/02/10(“ú) 20:37:23
101‚Ĺ‚ˇB‚ˇ‚Ü‚ńonz
103 :
2008/02/10(“ú) 20:39:44
‚ [A‚Ý‚ń‚ȏ‘‚˘‚Ä‚˘‚é‚Š‚玄‚̏‘‚˘‚˝‚Ě‚Í‘ĺ•‚ɍí‚é‚ŠB
‚ť‚ĚENDƒuƒƒbƒN“ŕ‚́A
for (§Œä•Ď” in ˜A‘z”z—ń) {...;}
‚Ć‚˘‚¤ƒpƒ^[ƒ“B

‚ť‚Ě‘O’i‚Ěcount[$1] += $2‚͈ęs–Ú‚Ě‚Ć‚Ť
count["aaa"] += 1‚ƉđŽß‚ł‚ę‚éBˆČ‰ş“Ż—l‚ɁB
‚ą‚Ěcount‚ޘA‘z”z—ń‚Ć‚ľ‚ÄŽg‚í‚ę‚Ä‚˘‚é‚Ć‚˘‚¤‚ą‚ƁB
104 :
2008/02/10(“ú) 20:42:05
>>101
c”˝Č‚ľ‚Ä‚Ü‚ˇ

‚˘‚âC‚Ů‚çC‚‚˘‚˘‚‚ŕ‚ĚƒNƒZ‚Łc‚˛‚ß‚ń
105 :
2008/02/10(“ú) 20:52:15
‚˘‚Ś‚˘‚Ś‚˘‚Ś‚˘‚Śc‚ť‚¤‚˘‚¤ˆÓ–Ą‚ś‚á‚Č‚­‚Ä‹ł‚í‚Á‚Ä‚˘‚Č‚Ş‚ç‚ˇ‚˘‚Ü‚š‚ń‚Ĺ‚ˇB
ă‹L‚ŏ‘‚˘‚˝‚Ć‚¨‚č•Ö—˜ƒc[ƒ‹‚É—Š‚čŘ‚Á‚Ä‚Ä–w‚Ç’m‚ç‚Č‚˘Ž„‚ވŤ‚˘‚Ě‚Ĺ‚ˇ‚ށcB
ĄˆęśŒœ–˝3byte’ö“x‚Ě”]‚Ý‚ť‚ŕ׋­‚ľ‚Ä‚é‚ń‚Ĺ‚ˇ‚ށA2“ú–Ú‚ĹÁÜ‚ľ‚ť‚¤‚ĹŽż–â‚ł‚š‚ĖႢ‚Ü‚ľ‚˝cB

‚˝‚Ć‚Ś‚΃ƒO‚É‚Í
Feb 9 22:44:40 localhost postfix/qmgr[1936]: 345C48C0154: from=<use1@example.com>, size=556, nrcpt=1 (queue active)
‚Ć•K‚¸o‚Ü‚ˇB‚ŁA
1,śƒƒO‚đ‚ť‚Ě‚Ü‚Üˆ—‚ˇ‚é‚Ě‚Ş•|‚˘i‘ĺ‚Ť‚Čƒtƒ@ƒCƒ‹j‚̂ŁA“ú•t‚ĹƒƒO‚đ’Šo‚ľ‚Ä•Ęƒtƒ@ƒCƒ‹‚Ö•Ű‘śB
2,grep‚Ĺ nrcpt=‚Ć’Šo‚ľ‚āA‚ł‚ç‚Égrep -v‚ŏœŠO‚ˇ‚éƒhƒƒCƒ“‚đŽw’č‚ľ‚Ä’Šo
3,‚ť‚ľ‚Äsed‚Ĺnrcpt=‚đíœ‚ľ‚Ä
4,‚ą‚ą‚Ĺ>97‚̂悤‚É$7‚Ć$9‚đ•Ŕ‚ׂ˝‚Ć‚ą‚ë‚Ĺ”]‚Ý‚ť‚Ěƒoƒbƒtƒ@ƒGƒ‰[‚đ‹N‚ą‚ľ‚Ü‚ľ‚˝B

‚ą‚̏ˆ—‚Ě•ű–@‚ŕƒGƒŒƒKƒ“ƒg‚Č‚ą‚Ć‚Í•Ş‚Š‚Á‚Ä‚˘‚Ü‚ˇ‚ށA’p‚͏ł’m‚Ĺ‚¨Žf‚˘‚ľ‚˝ŽŸ‘ć‚Ĺ‚ˇcB
106 :
2008/02/13(…) 07:31:34
gsub‚Ĺ[.*]‚đ’u‚ŤŠˇ‚Ś‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH
107 :
2008/02/14(–Ř) 02:38:02
>>106
‚ť‚ę‚̓Šƒeƒ‰ƒ‹‚Ć‚ľ‚Ĉľ‚Á‚Ä‚Ć‚˘‚¤‚ą‚Ć‚Š‚˘?
‚Č‚ç‘S•”ƒGƒXƒP[ƒv‚ˇ‚ę‚΂˘‚˘‚ĆŽv‚¤‚މ˝‚Š–â‘č‚Ş‚ ‚é‚Ě?
108 :
2008/02/16(“y) 01:08:44
awk‚ĹŒťÝŽž‚Š‚çn•Ş‘O‚Š‚çˆČ~‚ĚƒƒO‚ž‚Ż‚𔲂Ťo‚ľ‚˝‚˘‚ń‚Ĺ‚ˇ‚ށA‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠcB
02 15 12:34:56 xxxxxxxxx
02 15 13:45:01 xxxxxxxxx
...
...
...
‚Ć‚Š‚ĚŒ`ŽŽ‚Ȃ̂ŁAstrftime()‚Ć‚Š‚ĹŒťÝ‚ĆƒƒO‚ĚŽž‚đ”äŠr‚ľ‚Ä”˛‚Ťo‚ˇA‚Ć‚Š‚đŽŽ‚ľ‚˝‚ń‚Ĺ‚ˇ‚ރ_ƒ‚Ĺ‚ľ‚˝c
109 :
2008/02/16(“y) 01:49:16
>>108 ‚ą‚ę‚Ĺ‘Ę–Ú‚Š‚ȁH(ˆę‰ž gawk 3.0.4 ‚Ĺ‚Í“Ž‚˘‚˝)
BEGIN{
n=5
basetime=strftime("%m %d %H:%M:%S", systime()-60*n)
}
{
chktime=substr($0, 1, 14)
if(chktime >= basetime) print
}
110 :
2008/02/16(“y) 02:23:28
>109

‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇc‘f’ź‚É–Ú‚Ş—Ř‚Ĺ‚ľ‚˝cB

> chktime=substr($0, 1, 14)

‚Č‚ń‚Ĺ‚ˇ‚ˁc
perl‚ŞŽg‚Ś‚Č‚˘ŠÂ‹Ť‚Ȃ̂ŁA‚ą‚ę‚Ş•Ş‚Š‚ę‚΂˘‚낢‚ë—Ź—pŒř‚­‚Ě‚Ĺ•‚Š‚č‚Ü‚ľ‚˝B
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‚ŕ‚¤‚ż‚ĺ‚Á‚Ɛ¸i‚ľ‚Ü‚ˇBBB
111 :
2008/02/18(ŒŽ) 18:58:36
>>29
đ”N6ŒŽ‚ɁuAWK‚đ256”{Žg‚¤‚˝‚ß‚Ě–{v‚Ş–{‰Ž‚̏‘’I‚É‚ ‚Á‚˝‚Ě‚Ĺ”ƒ‚˘‚Ü‚ľ‚˝B
‰œ•t‚É
1993”N8ŒŽ21“ú‰”Ĺ”­s
2007”N5ŒŽ9“ú@‘ć1”Ĺ‘ć16ü”­s
‚Ə‘‚Š‚ę‚Ä‚˘‚Ü‚ˇB
112 :
2008/02/18(ŒŽ) 22:32:44
>>111
‚˘‚Â‚ĚƒŒƒX‚ɃŒƒX‚ľ‚Ä‚ń‚ži‚—

ÓÚ‚ŕ”ƒ‚Á‚˝‚Ż‚ǁA‚Ü‚ž‘ĺ‚Ť‚Č–{‰Ž‚ĹŒŠ‚Š‚Ż‚é‚ˁB
113 :
2008/02/19(‰Î) 02:59:17
>2007”N5ŒŽ9“ú@‘ć1”Ĺ‘ć16ü”­s 

–{‰Ž‚Ě’I‚Ĺ–°‚č‘ą‚Ż‚Ä‚˝‚Á‚Ä‚í‚Ż‚ś‚á‚Č‚˘‚Ě‚Šw
114 :
2008/02/24(“ú) 00:57:13
–Ú‚Ş—Ř ‚Ɉę’v‚ˇ‚é“ú–{Œę‚Ěƒy[ƒW –ń 1,920 Œ’† 1 - 20 Œ–Ú (0.24 •b)
115 :
2008/02/24(“ú) 01:00:56
ƒƒK—Ř
116 :
2008/03/28(‹ŕ) 21:53:28
sed, awk, ruby ‚đŽg‚¤B
‚ť‚ę‚ź‚ę“KŢ“KŠ‚ĹŽg‚¤‚Ż‚ǁA
used ‚ž‚Żvuawk ‚ž‚Żv‚ĹĎ‚Ü‚š‚ç‚ę‚é‚ƁA
•sŽv‹c‚ČŠě‚Ń‚đŠ´‚ś‚éB
117 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/03/30(“ú) 14:05:33
>>116
‚¤‚żAAIXŽg‚Á‚Ä‚é‚ń‚Ĺksh+sed+awk+perl‚ž‚ȁB
ruby‚Ş•W€‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚Ä‚éŠÂ‹Ť‚Á‚Ä‚ ‚ń‚Ü‚Č‚˘‚ĆŽv‚¤B
118 :
2008/03/30(“ú) 16:22:26
ŒĂ‚˘ƒT[ƒo‚ž‚ĆPerl‚ˇ‚ç“ü‚Á‚Ä‚Č‚˘Ž–‚Ş‚ ‚é‚Š‚çawk‚͏d•ó‚ˇ‚éB
119 :
2008/04/06(“ú) 10:26:45
Ĺ‹ß‚Ěgawk‚ރlƒbƒgƒ[ƒN‚É‚ŕŽg‚Ś‚é‚Ć’m‚Á‚Ä‚ż‚ĺ‚Á‚Ć‹Á‚˘‚˝‚—
ƒJ[ƒjƒnƒ“‚Ě–{ƒŒƒxƒ‹i‚Ć‚Š256”{j‚ľ‚Š’m‚ç‚Č‚˘l‚Á‚Ä‘˝‚˘‚ĆŽv‚¤B
120 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/04/06(“ú) 12:44:41
ƒm[ƒ}ƒ‹‚Ěawk‚ĹXML‚đŽš‰ş‚°‚ľ‚˝‚č‚ľ‚Ä‚¤‚Ü‚­•\ŽŚ‚ł‚š‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ě‚Š‚ȁEEE
121 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/04/06(“ú) 17:09:18
sed‚ž‚Ż‚ŏ‘‚Ż‚é‚ƁA‰´‚Á‚ēރCƒC‚Š‚ŕ‚Á‚ÄŽv‚¤B

#!/bin/sed -f
122 :
2008/04/06(“ú) 17:16:17
•śŽš—ń‚Ě’Pƒ‚Č’uŠˇ‚ž‚Ż‚Č‚çawk‚ć‚čŠČ’P‚ɏ‘‚Ż‚é‚ń‚ž‚Ż‚ǁB
awk‚ÉŒĹŽˇ‚ľ‚Č‚˘‚Ĺ—Ő‹@‰ž•Ď‚Ésed‚đŽg‚¤‚Á‚ĈӖĄ‚Ĺ‚Č‚ç—v—Ě‚Ş‚˘‚˘‚Ć‚˘‚¤ˆÓ–Ą‚ĹŒŤ‚˘‚Ż‚ǁB
# awk‚ŏ‘‚˘‚˝•ű‚ŞŠČ’P‚Č‚ą‚Ć‚đsed‚ĹŠć’Ł‚Á‚ď‘‚˘‚˝‚Ě‚ž‚Ć‚ľ‚˝‚çA‚ť‚ĚˆÓ–Ą‚Ĺ‚Í“ŞˆŤ‚˘‚Čw
123 :
2008/04/06(“ú) 17:34:45
awk‚Š‚çsystem‚ĹsedŒÄ‚Ô‚ą‚Ć‚ÍŽžX‚ ‚é‚—
124 :
2008/04/06(“ú) 18:49:04
>>24
awk‚Á‚Ä•\ŒvŽZ‚̂悤‚ȏˆ—‚É“Á‰ť‚ľ‚Ä‚Ü‚ˇ‚ć‚ˁB
‚ť‚Ě“_‚Ş”ńí‚Ƀ†ƒj[ƒN‚Ć‚˘‚¤‚ŠŽ––ąˆ—‚ĚŒžŒę‚ž‚ȁA‚ƁB
visicalc(1979)awk(1977)‚Ĺ‚ˇ‚Š‚çawk‚Ě‚Ů‚¤‚ŞŽáŠąŒĂ‚˘‚ń‚Ĺ‚ˇ‚ށA
•\ŒvŽZ‚̓Zƒ‹‚É’źÚŽŽ‚đ‘‚­‚Ć‚˘‚¤”­‘z‚ސV‚ľ‚Š‚Á‚˝B‚¤‚ނށB
125 :
2008/04/06(“ú) 19:26:56
VisiCalc‚̍lˆÄŽŇDan Bricklin‚É‚ć‚éƒAƒCƒfƒA‚Ěŕ–ž
ttp://www.danbricklin.com/history/saiidea.htm

Dan‚Ě“d‘ě‚ŞHP‚ś‚á‚Č‚­‚ÄTI‚Č‚Ě‚ŞˆÓŠO‚ČŠ´‚śB
The idea for the electronic spreadsheet came to me while I was a student at the Harvard Business School, working on my MBA degree, in the spring of 1978.
Sitting in Aldrich Hall, room 108, I would daydream.
"Imagine if my calculator had a ball in its back, like a mouse..." (I had seen a mouse previously, I think in a demonstration at a conference by Doug Engelbart, and maybe the Alto).
And "..imagine if I had a heads-up display, like in a fighter plane, where I could see the virtual image hanging in the air in front of me.
I could just move my mouse/keyboard calculator around, punch in a few numbers, circle them to get a sum, do some calculations, and answer '10% will be fine!'"
(10% was always the answer in those days when we couldn't do very complicated calculations...)
126 :
2008/04/07(ŒŽ) 02:52:10
‚Í‚ś‚ß‚Ü‚ľ‚Ägawk‚ĚŽż–â‚Ĺ‚ˇ
‚¨Žč‚ˇ‚Ť‚ĚŽž‚É‚Ĺ‚ŕ‚˛‰đ“š’¸‚Ż‚Ü‚ľ‚˝‚珕‚Š‚č‚Ü‚ˇ

2ch‚Ĺ‚¨˜b‚ľ‚Ä‚˘‚˝‚ž‚˘‚˝•ű‚Š‚çgawk‚đ‹ł‚Ś‚Ä’¸‚Ť‚Ü‚ľ‚˝
ł‹K•\Œť‚Ĺƒ}ƒbƒ`‚ľ‚˝•”•Ş‚Ş‚˘‚­‚‚ ‚Á‚Ä‚ŕ‘S‚Ä‚Ě‰ÓŠ‚đ1ƒAƒNƒVƒ‡ƒ“‚Ĺ•Ű‘ś‚Ĺ‚Ť‚é—D‚ę‚ŕ‚Ě‚Ĺ‚ˇ
“–•űAŒžŒę‚Í‘S‚­’m‚ç‚Č‚˘‚̂Őć‚Ů‚Ç‚Ü‚ĹƒeƒXƒgŽŔs‚ľ‚Ä‚Í‹Á‚˘‚Ä‚˘‚Ü‚ľ‚˝
‚ą‚Ě—D‚ę‚ŕ‚Ě‚đĄŒă––‰i‚­Žg‚Á‚Ä‚˘‚Ť‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş
‰ş‹L‚ĚŽ–€‚đƒOƒO‚Á‚ÄŒŠ‚˝‚Ě‚Ĺ‚ˇ‚Ş‚í‚Š‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝
‚Ç‚Č‚˝‚Š‚í‚Š‚é•ű‚¨‚ç‚ę‚Ü‚ľ‚˝‚ç‹ł‚Ś‚ĉş‚ł‚˘

Ž„‚Ě‚â‚č‚˝‚˘‚ą‚Ć
EEUC‚đ“ǂݍž‚ń‚ĹS-JIS‚đo—Í
EŠů‘ś‚ĚƒeƒLƒXƒg––”ö‚ɒljÁ‘‚Ťž‚Ý•Ű‘ś
i‹ł‚Ś‚Ä’¸‚˘‚˝ƒXƒNƒŠƒvƒg‚Íă‘‚Ť•Ű‘ś‚Č‚Ě‚Ĺo—͐ć‚Ě“ŕ—e‚ޏÁ‚Ś‚Ä‚ľ‚Ü‚˘‚Ü‚ˇj

‹C’ˇ‚É‘Ň‚Á‚Ä‚˘‚Ü‚ˇ‚̂ʼn˝‘˛‚ć‚ë‚ľ‚­‚¨Šč‚˘’v‚ľ‚Ü‚ˇ
127 :
2008/04/07(ŒŽ) 03:10:31
>>126
‘OŽŇ‚Íawk‚Ĺ‚â‚é‚ׂŤ‚ą‚Ć‚Ĺ‚Í‚Č‚˘Biconv, nkf‚Č‚Ç‚ť‚ęę—p‚Ěƒc[ƒ‹‚Ş‚ ‚éB
ŒăŽŇ‚ŕ•K‚¸‚ľ‚ŕawk‚Í•s—vBƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ŞŽg‚Ś‚éŠÂ‹Ť‚Ȃ畁’Ę‚É‚Ĺ‚Ť‚éB
—á‚Ś‚΁AUnixŒn‚Č‚ç cat append.txt >> original.txt ‚ĹŠů‘ś‚Ěƒtƒ@ƒCƒ‹‚ɒljÁ‚Ĺ‚Ť‚éB
DOSŒn‚Ĺ‚ŕAtype append.txt >> original.txt ‚Ĺ‚Ĺ‚Ť‚éB
—v‚́Aawk‚Ě‚˘‚˘‚Ć‚ą‚ë‚Í‚ť‚ę’P‘Ě‚Ĺ‚Č‚ń‚Ĺ‚ŕ‚Ĺ‚Ť‚é(ˆ˝‚˘‚Í‚Ĺ‚Ť‚Č‚˘)‚ą‚Ć‚Ĺ‚Í‚Č‚­A
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ŠÂ‹Ť‚Ĺ—Í‚đ”­Šö‚ˇ‚éƒc[ƒ‹‚Ĺ‚ ‚é‚ą‚ƁB

—á‚Ś‚΁Ał‹K•\Œť‚Ĺƒ}ƒbƒ`‚ľ‚˝•śŽš—ń‚đ’uŠˇ‚ˇ‚é‚ž‚Ż‚Č‚çƒeƒLƒXƒgƒGƒfƒBƒ^‚Ĺ‚ŕ‚Ĺ‚Ť‚éB
‚ [‚ť‚¤‚ť‚¤AƒGƒfƒBƒ^‚Ş‚ ‚ę‚ΕśŽšƒR[ƒh‚Ě•ĎŠˇ‚ŕ‚ť‚ę‚ž‚Ż‚Ĺ‚Ĺ‚Ť‚éB
ŠˆŕƒeƒLƒXƒgƒGƒfƒBƒ^‚đŽg‚Á‚˝‚ą‚Ć‚Ş‚Č‚˘‚Č‚çAˆę“x(ł‹K•\ŒťŒŸő‹@”\A
•śŽšƒR[ƒh•ĎŠˇ‹@”\‚Ě‚ ‚é)ƒeƒLƒXƒgƒGƒfƒBƒ^‚đG‚Á‚Ä‚Ý‚é‚Ć‚˘‚˘‚Š‚ŕ‚ľ‚ę‚Č‚˘B
128 :
2008/04/07(ŒŽ) 03:32:54
>>127‚ł‚ń
>>126‚Ĺ‚ˇ
‚¨”ć‚ę‚Ě‚Ć‚ą‚둁X‚Ě‚˛‰đ“š˝‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
ƒRƒ“ƒo[ƒg‚Í•Ę‚Ěƒc[ƒ‹‚ōs‚¤
DOSŠÂ‹Ť‚Ĺ‚Ítype append.txt >> o—͐ćƒtƒ@ƒCƒ‹–ź‚ŒljÁ‘‚Ťž‚Ý
—š‰đ‚ľ‚Ü‚ľ‚˝
ƒGƒfƒBƒ^[‚͏GŠŰƒGƒfƒBƒ^[‚đŽg‚Á‚Ä‚˘‚Ü‚ˇ
ƒRƒ“ƒo[ƒg‚͏o—ˆ‚é‚Ě‚Ĺ‚ˇ‚ŞŒŸő‚Ĺƒ}ƒbƒ`‚ľ‚˝•śŽš—ń‚Í1‰ÓŠ‚¸‚ƒRƒs[‚Č‚ń‚Ĺ‚ˇ
sakuraƒGƒfƒBƒ^[‚ĹˆęŠ‡ƒRƒs[‚âŘ‚čŽć‚č‚Şo—ˆ‚é‚Ć‹ł‚Ś‚Ä‚­‚ę‚˝•ű‚ŕ‚˘‚Ä‚˝‚Ě‚Ĺ‚ˇ‚Ş
sakuraƒGƒfƒBƒ^[‚ÍŽŽ‚ľ‚˝‚ą‚Ć‚Ş–ł‚˘‚ń‚Ĺ‚ˇ
Ú‚ľ‚­‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝
129 :
2008/04/07(ŒŽ) 03:56:33
AAA.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ƀy[ƒXƒg‚ˇ‚é

BBB.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ě––”ö‚Ƀy[ƒXƒg‚ˇ‚é

CCC.txt‚đŠJ‚Ťh“Œ‹ž(.+?)†Žşh‚đŒŸő‚ˇ‚é
ƒ}ƒbƒ`‚ľ‚˝•Ą”‰ÓŠ‚đˆęŠ‡‚ĹƒRƒs[‚ľ‚ÄTEST.txt‚Ě––”ö‚Ƀy[ƒXƒg‚ˇ‚é

‚ć‚ë‚ľ‚­‚¨Šč‚˘‚ľ‚Ü‚ˇ
130 :
2008/04/07(ŒŽ) 04:02:07
>>127‚ÍŒ‹‹Çawk‚̉𓚂͂ľ‚Č‚˘‚Ě‚É‚Č‚ń‚Ĺ‚ľ‚á‚ľ‚á‚čo‚Ä‚Ť‚˝‚́H
‚Ĺ‚Ť‚Č‚˘‚ś‚á‚ń
131 :
2008/04/07(ŒŽ) 06:48:34
>>130
Žż–â‚É‹ď‘̐Ť‚Ş‚Č‚˘‚Š‚çˆę”Ę˜_‚đ‘‚˘‚˝‚ž‚Ż‚ž‚Ż‚ǁB

>>129
awk '/“Œ‹ž(.+?)†Žş/ {print > "TEST.txt";}' AAA.txt
awk '/“Œ‹ž(.+?)†Žş/ {print >> "TEST.txt";}' BBB.txt
ˆČ‰ş“Ż—l‚ɁB
132 :
2008/04/07(ŒŽ) 12:02:34
>>131
ƒŒƒX‚ ‚č‚Ş‚Ć
gawk '/“Œ‹ž(.+?)†Žş/ {print > "TEST.txt";}' AAA.txt
gawk '/“Œ‹ž(.+?)†Žş/ {print >> "TEST.txt";}' BBB.txt
ƒtƒ@ƒCƒ‹–źAƒfƒBƒŒƒNƒgƒŠ–źA‚Ü‚˝‚̓{ƒŠƒ…[ƒ€@ƒ‰ƒxƒ‹‚̍\•ś‚ŞŠÔˆá‚Á‚Ä‚˘‚Ü‚ˇB
gawk3.16‚Ĺ‚ÍŽg‚Ś‚Č‚˘H

133 :
2008/04/07(ŒŽ) 13:29:56
>>132
DOS‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚŽg‚˘•ű‚Í‘źŠ‚Ĺ•ˇ‚˘‚Ä‚­‚ęB
134 :
2008/04/07(ŒŽ) 13:38:24
–đŠ‚Ě‘‹Œű‚Ý‚˝‚˘‚ȑΉž‚ž‚ȁB
135 :
2008/04/07(ŒŽ) 13:43:47
DOS‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ɂ‚˘‚Ä‚Í‘˝‚­‚đ’m‚ç‚Č‚˘‚ń‚ž‚ćB
136 :
2008/04/07(ŒŽ) 16:36:42
DOS‚Ěę‡‚Í‹ó”’‚đŠÜ‚Ţę‡ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚ś‚áƒ_ƒ‚ž‚Š‚ç‚ȁB
ƒ_ƒuƒ‹ƒNƒH[ƒg‚ĹŠ‡‚Á‚Ä’†‚ĚƒR[ƒh‚Í
ƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚ŠAƒGƒXƒP[ƒv‚ľ‚ă_ƒuƒ‹ƒNƒH[ƒg“ü‚ę‚é‚ŠB

ˆę”ÔŠČ’P‚Ȃ̂́Aƒƒ“ƒ‰ƒCƒi[‚Ĺ‚ŕƒtƒ@ƒCƒ‹‚É‹N‚ą‚ľ‚Ä‚ľ‚Ü‚¤‚ą‚ƁB
gawk -f myscript.awk AAA.txt
‚Ć‚â‚Á‚Ä‚ľ‚Ü‚Ś‚΁AƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚Ć‚Šƒ_ƒuƒ‹ƒNƒH[ƒg‚Ć‚Š‹C‚É‚ˇ‚é•K—v‚Í‚Č‚˘B
137 :
2008/04/07(ŒŽ) 18:22:15
>>132
“ń‚–â‘č‚Ş‚ ‚éB
gawk‚̐ł‹K•\Œť‚Ĺ‚Í.+?‚Ć‚˘‚¤‚Ě‚ÍŽg‚Ś‚Č‚˘B
cmd.exe‚ł́AƒVƒ“ƒOƒ‹ƒNƒH[ƒg‚đˆř”‚đ
‚­‚­‚é‚Ě‚ÉŽg‚Ś‚Č‚˘B

‚Č‚ń‚Š‚ć‚­‚í‚Š‚ç‚ń‚ށAperl‚ĹƒeƒLƒXƒg‚đŠŰˆů‚Ý‚ľ‚Ä‚Š‚ç
ˆ—‚ˇ‚ę‚΂˘‚˘‚ń‚ś‚á‚Č‚˘‚Ě‚ŠH
138 :
2008/04/12(“y) 19:00:42
VisiCalc ‚Ć‚˘‚Ś‚΁AoŽn‚ß‚Ě ‚É TRS-80 —p ‚đ Radio Shack ‚ĹŒŠ‚š‚Ä‚ŕ‚ç‚Á‚˝‚ń‚ž‚Ż‚ǁAŠwś‚ž‚Á‚˝Ž„‚ɂ͉ż’l‚Ş‚í‚Š‚ç‚Č‚Š‚Á‚˝‚Č‚ŸB
‚Ü‚ŸA‚ą‚ę‚ÉŒŔ‚炸Aw‚Č‚ń‚Ĺ‚ą‚ń‚ČƒRƒ}ƒ“ƒh‚âƒIƒvƒVƒ‡ƒ“‚Ş‚ ‚é‚ń‚žHx‚Á‚Ä‚Ě‚Í‘˝‚˘B
Žg‚˘•ű‚ś‚á‚Č‚­A‚Č‚ş‚ť‚ę‚Ş‚ ‚é‚Ě‚Š‚đ•ďŠ‡“I‚ɉđŕ‚ľ‚˝–{‚â web site ‚Á‚Ä‚ ‚č‚Ü‚ˇ‚ŠB(‚˝‚Ć‚Ś‚Α˝‚­‚Ě unix ƒRƒ}ƒ“ƒh‚đ–Ô—…‚ľ‚Ä‚˘‚é‚Ć‚Š)
139 :
2008/04/12(“y) 19:01:22
‚ ‚ AƒXƒŒˆá‚˘‚ž‚Á‚˝B‚˛‚ß‚ń‚˛‚ß‚ńB
140 :
2008/04/12(“y) 19:58:47
‚Č‚ń‚Ć‚˘‚¤Œë”š
141 :
2008/05/06(‰Î) 02:42:04
>>132 ‚ŕ‚¤‹‚Č‚˘‚Š‚ȁBgawk3.1.6 + nkf2.0 Žg—p@cmd.exe

C:\work>type aaa.txt (ŚEUC‚Ȃ̂ʼnť‚Ż‚鎖‚đŠm”F)
¤Ű¤˛¤Ű¤˛
ŁEšćźź
ŁEŁ˛šćźź
ŁEŁąŁ°šćźź
ŁE¤Ű¤˛šćźź
ŁE¤Ő¤ŹšEŁEŐ¤Źšćźź
ŁEŁłšćźź¤ČŁEŁľšćźź

C:\work>nkf -Es AAA.txt
‚Ů‚°‚Ů‚°
“Œ‹ž†Žş
“Œ‹ž‚Q†Žş
“Œ‹ž‚P‚O†Žş
“Œ‹ž‚Ů‚°†Žş
“Œ‹ž‚ӂލ†
“Œ‚ӂލ†Žş
“Œ‹ž‚R†Žş‚Ć“Œ‹ž‚T†Žş

C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žş/{print $0}"
“Œ‹ž†Žş
“Œ‹ž‚Q†Žş
“Œ‹ž‚P‚O†Žş
“Œ‹ž‚Ů‚°†Žş
“Œ‹ž‚R†Žş‚Ć“Œ‹ž‚T†Žş

Šůo‚Ě’Ę‚č•śŽš•ĎŠˇnkf(>>127) ł‹K•\Œť‚̐§–ń‚ĹđŒ•ĎX(>>137)
ŽŔŰ‚ÉŽg‚¤ę‡‚Í‚ą‚ń‚ČŠ´‚ś‚Ĺƒoƒbƒ`ě‚é‚Ć‚ŠB
C:\work>nkf -Es AAA.txt| gawk "/“Œ‹ž.*†Žş/{print $0}" >>TEST.txt
142 :
2008/05/06(‰Î) 02:56:02
‚ƁA•ű–@‚đ‘‚˘‚Ä‚¨‚˘‚ăAƒŒ‚ž‚Ż‚ǁA
GŠŰŽg‚Á‚Ä‚é‚Č‚çgrep‚ĚŽŔs‚ĹŒŸő‚ˇ‚éƒtƒ@ƒCƒ‹‚É(ŒťÝ‚Ě“ŕ—e)‚Ĺ
ŒŸőŒ‹‰Ę‚Š‚çƒtƒ@ƒCƒ‹–ź‚ƍs”ԍ†‚đœ‹Ž‚ˇ‚é‚Ě‚Ĺ‚ŕ‚Ĺ‚Ť‚ť‚¤‚Č‹C‚Ş‚ˇ‚éB
ˇ‘ĺ‚ɃXƒŒˆá‚˘‚ž‚Ż‚ǁB
143 :
2008/05/06(‰Î) 14:28:43
>>142‚ł‚ń
‚ ‚č‚Ş‚Ć
‚Ü‚žŽv‚¤‚悤‚É‚Ĺ‚Ť‚Ä‚˘‚Č‚˘‚ń‚ž
ŽQl‚É‚Č‚é‚抴ŽÓ‚Ĺ‚ˇ
144 :
2008/06/16(ŒŽ) 01:50:26
‚Đ‚Ĺ‚Ś‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—‚—
145 :
2008/06/16(ŒŽ) 01:50:57
‚ˇ‚Ü‚ńŒë”š
146 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/06/25(…) 02:17:58
Žż–â‚Ĺ‚ˇI

ˆČ‰ş‚Ěƒtƒ@ƒCƒ‹hoge‚Š‚çawk‚ŁA‰żŠi‚𔲂Ťo‚ľ‚č‡Œv’l‚đo‚ľ‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇB
ƒtƒ@ƒCƒ‹‚Ě“ŕ—e‚́A‘Đ–ź‚ƉżŠi‚Ĺ‚ˇB‰żŠi‚͈ę”ÔŒă‚ë‚̐”Žš‚É‚Č‚č‚Ü‚ˇB

----------------------
$ cat hoge
‚ť‚ꂢ‚ŻI‚ ‚ń‚Ď‚ń‚Ü‚ń 1000
ƒƒ^ƒ{ƒŠƒbƒN‚đŒ‚‘Ţ‚š‚ć 1000
‰ş—ŹŽĐ‰ď 1000
ă—ŹŽĐ‰ď‚Ɖş—ŹŽĐ‰ď “ú–{‚Ě‚ą‚ę‚Š‚ç 1000
˜_•ś 2008 “ú–{‚Ě•ř‚Ś‚é–â‘č 1000
˜_•ś 2007 “ú–{‚Ě•ř‚Ś‚é–â‘č ‰ß‹Ž–â‘čW 1000
----------------------

“ď‚ľ‚˘‚Ě‚ŞA‘Đ–ź‚Ě2008‚â2007‚Ȃǂ̐”’l‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚ą‚Ć‚â‹ó”’‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚ą‚Ć‚Ĺ‚ˇB
1s–Ú‚Ěę‡2—ń–ڂމżŠi‚É‚Č‚č‚Ü‚ˇ‚ށA2s–Ú‚Ěę‡4—ń–ڂމżŠi‚Ć‚Č‚č‚Ü‚ˇB

‚ą‚̂悤‚Ɉę”ÔĹŒă‚Ě—ńi‰żŠij‚đŽć“ž‚ľA‡Œv’l‚đŒvŽZ‚ˇ‚é‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂悢‚Ĺ‚ľ‚傤‚ŠH

‚˛‹łŽŚ‚¨Šč‚˘‚˘‚˝‚ľ‚Ü‚ˇB


147 :
2008/06/25(…) 02:28:00
awk '{x+=$NF}END{print x}' hoge
148 :
2008/06/25(…) 09:33:15
x‚ś‚á‚Č‚­‚Äsum‚Ć‚Š‚É‚ľ‚悤‚ćB
149 :
2008/06/25(…) 13:36:51
ˆęs–ě˜Y‚͎萔i‘Ő”jdŽ‹‚Č‚ń‚ś‚á‚Ü‚˘‚Š
150 :
2008/06/25(…) 15:27:28
“ď‚ľ‚˘‚Á‚ă}ƒjƒ…ƒAƒ‹“Ç‚ß‚ÎĹŒă‚Ě—v‘f‚đŽw‚ˇ‚ŕ‚Ě‚Ş‰˝‚Š‘‚˘‚Ä‚ ‚é‚ĆŽv‚¤‚Ş
151 :
2008/06/25(…) 16:09:13
“Ç‚ń‚Ĺ‚˝‚ç‘źl‚É‚Č‚ń‚Š•ˇ‚Ť‚Ü‚š‚ńB
152 :
2008/06/25(…) 16:34:16
‚ś‚á‚ Aƒ}ƒjƒ…ƒAƒ‹“Ç‚ń‚Ĺ‚ŕ‚í‚Š‚ç‚Č‚Š‚Á‚˝‚炨Žčă‚°‚Š
153 :
2008/06/29(“ú) 21:37:04
Windows ”Ĺ‚Ě gawk-3.1.5 ‚Ĺ`‘o•űŒüƒpƒCƒv‚Ş‚¤‚Ü‚­“Žě‚ľ‚Ü‚š‚ńBˆČ‰şA
http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html#SEC182
‚Š‚ç‚ĚƒTƒ“ƒvƒ‹ƒtƒ@ƒCƒ‹‚Ĺ‚ˇ‚ށA“r’†‚ĹŽ~‚Ü‚Á‚Ä‚ľ‚Ü‚Á‚āA•ÔŽ–‚Ş•Ô‚Á‚Ä‚Ť‚Ü‚š‚ńB

BEGIN {
command = "sort"
n = split("abcdefghijklmnopqrstuvwxyz", a, "")

for (i = n; i > 0; i--)
print a[i] |& command
close(command, "to")

while ((command |& getline line) > 0)
print "got", line
close(command)
}

Cygwin ‚Ě gawk ‚Ĺ‚Í–â‘č‚ ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
154 :
2008/07/01(‰Î) 20:42:14
‚ą‚ęŽg‚¤‚Ć‚˘‚˘‚ć
ttp://www.pipeunish.jp/
155 :
2008/07/02(…) 01:35:15
‚Ç‚¤‚â‚Á‚˝‚ç Cygwin ‚Ě gawk(GNU Awk 3.1.6) ‚Ĺ print length("‚ ‚˘‚¤") ‚Ş 3 ‚É‚Č‚é‚Ě‚Ĺ‚ˇ‚ŠH
156 :
2008/07/02(…) 02:13:54
Windows‚Ěƒo[ƒWƒ‡ƒ“‚­‚炢‘‚ą‚¤‚ȁB‚Ĺ‚Č‚˘‚Ć’Ţ‚č‚ĆŽv‚í‚ę‚é‚ć
157 :
2008/07/02(…) 08:51:57
jgawk?
158 :
2008/07/02(…) 09:32:16
gawk.dll‚Á‚āA‚Ü‚ž’N‚Šƒƒ“ƒe‚ľ‚Ä‚­‚ž‚ł‚Á‚Ä‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
ĹV”Ĺgawk‚Ědll‚đ’T‚ľ‚Ä‚é‚ń‚Ĺ‚ˇ‚ށAŒŠ‚‚Š‚č‚Ü‚š‚ńB

‚Ü‚˝‚́Aƒ\[ƒX‚Ětar.gz‚Š‚çdll‚đě‚é•ű–@‚ލڂÁ‚Ä‚˘‚éƒy[ƒW‚đ
Œä‘ś’m‚Ě•ű‚Ş‚˘‚ç‚Á‚ľ‚Ⴂ‚Ü‚ľ‚˝‚çA‹ł‚Ś‚Ä‚˘‚˝‚ž‚Ż‚é‚Ə•‚Š‚č‚Ü‚ˇB
159 :
2008/07/02(…) 10:34:53
‚Č‚É‚đ‚˘‚Á‚Ä‚é‚Ě‚Š‚í‚Š‚ç‚ń
ƒ\[ƒX‚Ětar.gz‚Á‚ĂȂɁH
160 :
2008/07/02(…) 10:42:47
http://ftp.gnu.org/gnu/gawk/ ‚Š‚çƒ_ƒEƒ“ƒ[ƒh‚Ĺ‚Ť‚égawk-*.tar.gz‚Ě‚ą‚Ć‚Ĺ‚ˇ‚ށBB
source‚Š‚çgawk.exe‚đě‚Á‚˝‚č‚ľ‚Č‚˘‚Ě‚Ĺ‚ˇ‚ŠHH

dll‚Ə‘‚˘‚Ä‚˘‚é‚Ě‚Ĺ‚í‚Š‚é‚Š‚Ć‚ÍŽv‚˘‚Ü‚ˇ‚ށA
windowsŠÂ‹Ť‰ş‚Ĺ‚Ě˜b‚Ĺ‚ˇB•’i‚Ícygwin‚Ĺmake‚ľ‚˝gawk‚đŽg‚Á‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚ށA
dll‚Ş‚ ‚é‚Ć‘ź‚ĚŒžŒę‚Š‚çŒÄ‚яo‚ľ‚ÄŽg‚Ś‚é‚Ě‚Ĺ•Ö—˜‚Š‚ȁ[‚ĆŽv‚Á‚Ä‚Ü‚ˇB
161 :
2008/07/02(…) 10:45:49
cygwin‚Íwin—p‚Ěƒ\[ƒX‚ś‚á‚Č‚˘‚Š‚ç
win—p‚Ěƒ\[ƒX‚Ş‚˘‚é
162 :
2008/07/02(…) 11:53:32
>>160
Ě‚ ‚Á‚˝DLL”Ĺ‚ÍěŽŇ‚Ş“ĆŽŠ‚ɍě‚Á‚˝‚ŕ‚Ě‚Ý‚˝‚˘‚Ĺ
–{‰Ć‚É”˝‰f‚ł‚ę‚Ä‚Č‚˘‚Š‚ç–{‰Ć‚Ěƒ\[ƒX‚Š‚çDLL‚đě‚é‚Ě‚Í–ł—B
DLL”Ĺ‚Ěƒ\[ƒX‚đŽQl‚É‚ľ‚ÄŽŠ—Í‚Ĺě‚é‚Š
‚Ĺ‚Ť‚Č‚˘‚Č‚çěŽŇ‚ɘA—‚ľ‚Ä‹Ś—Í‚đ‹‚ß‚é‚ľ‚Š‚Č‚˘B
163 :
2008/07/02(…) 12:05:07
>>160
ŽŠ•Ş‚ʼnüC‚ˇ‚é‚ľ‚Š‚Č‚˘‚ž‚ë
164 :
2008/07/03(–Ř) 02:36:53
(ɁÍ`)@ą˛ŔŔŔ
165 :
2008/07/05(“y) 15:47:31
>156
XP [Version 5.1.2600] ‚Ĺ‚Â
166 :
2008/07/05(“y) 17:55:22
>>153
‚Ü‚žŒŠ‚Ä‚é‚Š?
‘˝•Ş‚Č‚¨‚Á‚Ä‚é‚ĆŽv‚¤‚ń‚ŐV‚ľ‚˘‚Ě‚ĹŽŽ‚ľ‚Ä‚Ý‚Ä‚­‚č‚âB
167 :
2008/07/06(“ú) 06:36:13
‚¤‚¨H
ěŽŇ~—Ő‚Š
168 :
2008/07/06(“ú) 07:02:21
‚ˇ‚ń‚΂炡‚Ą
169 :
2008/07/20(“ú) 00:40:48
AWK@Žg‚Á‚Ä‚P‚T”NH@‚R‚O”N‘O‚ĚƒR[ƒh‚Ş“f‚Ťo‚ˇƒf[ƒ^‚đ‚ż‚ĺ‚ą‚Á‚Əˆ—‚ľ‚悤‚Ć‚ľ‚āc
FS=/[ ()]+/ ‚ÍŠú‘Ň’Ę‚č‚Ě“Ž‚Ť‚đ‚š‚¸AFS="[ ()]+" ‚Ə‘‚Š‚˂΂Ȃç‚Č‚˘B
‰‚ß‚Ä’m‚Á‚˝B
@ŒŸő‚ľ‚Ä‚ŕA‚ą‚ę‚ɂ‚˘‚Ä–ž‰ő‚ɏ‘‚˘‚Ä‚ ‚éƒy[ƒW‚Ş‚Č‚Š‚Č‚ŠŒŠ‚‚Š‚ç‚Č‚Š‚Á‚˝‚Ş
„ł‹K•\Œť’萔‚Ş‚ť‚ꎊg‚Ć‚ľ‚ÄŒť‚ę‚˝‚Ć‚ŤA‚ť‚ę‚̓pƒ^[ƒ“’†‚ÉŒť‚ę‚˝‚Š‚̂悤‚ɁA
„‚‚܂č`($0 ~ /foo/)' ‚̂悤‚É‚Ý‚Č‚ł‚ę‚éB
<’†—Ş>
„ŒžŒę‚Ě‚ą‚Ě‹@”\‚́APOSIX•W€‚Ü‚ĹƒhƒLƒ…ƒƒ“ƒg‰ť‚ł‚ę‚Č‚Š‚Á‚˝B
orz
@‚ą‚ę‚Ĺ‚PŽžŠÔ‚Ž‚炢ƒ€ƒ_‚É‚ľ‚˝BŽ„‚Ş’m‚ç‚Č‚Š‚Á‚˝‚ž‚Ż‚Ĺ‚ˇ‚ŠHH
170 :
2008/07/20(“ú) 00:58:40
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKx‚É‚Íˆę‰žÚ‚Á‚Ä‚é‚Ż‚Ç‚Č
> iFS‚É‘ă“ü‚ł‚ę‚éj•śŽš—ń‚Ş1•śŽš‚ć‚č’ˇ‚˘‚Ć‚Ť‚́Cł‹K•\Œť‚Ć‚ľ‚Ĉľ‚í‚ę‚é
171 :
2008/07/20(“ú) 01:10:48
ƒxƒ‹Œ¤Œn“‚ĚŒžŒę‚Í‹Lq‚ĚŽŠ—R“x‚Í‚ ‚é‚Ş‹““Ž‚ނ‚Š‚݂Â炢
172 :
2008/07/20(“ú) 02:09:53
>>170
@hh‚ĹˆÍ‚ń‚ž•śŽš—ń‚ސł‹K•\Œť‚Ć‚ľ‚Ĉľ‚í‚ę‚é@‚Ć‚˘‚¤‚ą‚Ć‚Ć
@//‚ĹˆÍ‚ń‚žł‹K•\Œť’萔‚ŏ‘‚˘‚Ä‚Í‚˘‚Ż‚Č‚˘@‚Ć‚˘‚¤‚ą‚Ć‚Í“Ż‚ś‚Ĺ‚Í‚Č‚˘B
ŽŔŰAsplitŠÖ”‚́@‘ć‚Rˆř”‚É—^‚Ś‚鐳‹K•\Œť‚́@‚Ç‚ż‚ç‚Ĺ‚ŕ“Ž‚­
@‚ނނށA‚ą‚ą‚Ĺ‚Í($0~/foo/)‚É’u‚ŤŠˇ‚Ś‚Ä•]‰ż‚ł‚ę‚Č‚˘‚ń‚žc
171‚ĚˆÓŒŠ‚ސł‚ľ‚˘‚悤‚ž‚ˁ@ƒ`ƒƒƒ“ƒ`ƒƒƒ“

173 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/07/21(ŒŽ) 12:39:44
•Ą”‚Ěƒtƒ@ƒCƒ‹‚Ě“Ç‚Ýž‚Ý‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
print ƒtƒ@ƒCƒ‹1‚Ě$2 ƒtƒ@ƒCƒ‹2‚Ě$1
‚Ý‚˝‚˘‚ČŠ´‚ś‚Ĺ
174 :
2008/07/21(ŒŽ) 13:06:32
>>173
paste‚ĹŒq‚˘‚ś‚áƒ_ƒ?
Ž„‚Í‚ć‚­‚â‚é‚Ż‚ǁB
‰ź‚Ƀtƒ@ƒCƒ‹1‚Ş5ƒJƒ‰ƒ€ŒĹ’č‚Č‚çA
paste ƒtƒ@ƒCƒ‹1 ƒtƒ@ƒCƒ‹2| awk '{print $2 $6;}'
‚Ä‚ČŠ´‚ś‚ŁB
# ƒJƒ‰ƒ€”‰Â•Ď‚Č‚ç‚ŕ‚¤ˆę”P‚č•K—v‚ž‚Ż‚ǂˁB
175 :
2008/07/21(ŒŽ) 13:50:02
>>173
awk‚ž‚Ż‚Ĺ‚â‚č‚˝‚˘‚Č‚çgetline‚đŽg‚Ś‚΂łŤ‚éB
176 :
2008/07/22(‰Î) 18:37:52
awk‚ˇ‚˛‚˘•Ö—˜‚ŁAgnuplot‚Ć‘g‚ݍ‡‚í‚š‚ÄExcel‚Š‚ç‰đ•ú‚ł‚ę‚‚‚ ‚č‚Ü‚ˇB
ă‚Ě•ű‚É‚ ‚Á‚˝DFA‚ĆNFAŽg‚Á‚Ă鎖‚Š‚ç‚­‚éˆá‚˘‚Á‚Ä‚Č‚ń‚Ĺ‚ˇ‚ŠH
177 :
2008/07/23(…) 02:40:07
>>176

ˆę”Ô‚Ěˆá‚˘‚́ADFA‚ž‚ĆŒă•űŽQĆ‚Ş‚Ĺ‚Ť‚Č‚˘‚ą‚Ć‚Š‚ȁB
‚Ć‚č‚ ‚Ś‚¸

DFA
‘O€”ő‚ÉŽčŠÔ‚đŠ|‚Ż‚é‚Ż‚Ǐˆ—‚ť‚Ě‚ŕ‚Ě‚Í‘‚˘

NFA
‘ŚŔ‚ɏˆ—‚đŽn‚ß‚é‚Ż‚ǁAˆ—‚ÉŽžŠÔ‚Ş‚Š‚Š‚éę‡‚Ş‚ ‚éB

‚Ž‚炢‚ɍl‚Ś‚Ä‚¨‚Ż‚΂˘‚˘‚ĆŽv‚¤B
178 :
2008/08/02(“y) 00:57:57
•ŰŽç
179 :
2008/08/02(“y) 14:34:05
sh + awk ‚Í–ž‚ç‚Š‚ÉŠČ’P‚ž‚ĆŽv‚¤B
sh + awk ‚ŏo—ˆ‚é‚ą‚Ć‚đ perl ‚Ě‚Ý‚Ĺ‹Lq‚ˇ‚él‚Ě‹CŽ‚ż‚Ş‚Ç‚¤‚ľ‚Ä‚ŕ—‰đo—ˆ‚Č‚˘B
‚˝‚žAƒlƒbƒgƒ[ƒNƒvƒƒOƒ‰ƒ~ƒ“ƒOˆČă‚É‚Č‚é‚ĆC, perl, ruby ‚É‚Č‚ç‚´‚é‚đ“ž‚Č‚˘‚Ż‚ǁB

ƒ}ƒVƒ“’P‘Ě‚Ĺ‚ĚŽíX‚ĚŽč‘ą‚Ť‹Lq‚ž‚ƁA
sh + awk ‚Ş‚â‚Á‚Ď‚čˆę”ÔŠŽŒ‹‚É‚Č‚é‚ĆŽv‚¤‚ń‚ž‚Ż‚ǂȁ`B
180 :
2008/08/02(“y) 14:49:58
‚¨‚ę‚ŕawk‚Ĺ‚Ĺ‚Ť‚é‚ą‚Ć‚Č‚çawk‚Ĺ‚â‚éB
‚Ĺ‚ŕ‚ ‚Ü‚č‚ɃgƒŠƒbƒL[‚Č‚ą‚Ć‚É‚Č‚č‚ť‚¤‚ž‚Á‚˝‚çperl‚Ĺ‚â‚Á‚˝‚股‚é‚Š‚ȁB
181 :
2008/08/03(“ú) 01:39:18
l‚É“n‚ˇ‰Â”\Ť‚Ş‚ ‚é‚Č‚çAawk‚ÍŒ‹\‚‚炢‚ą‚Ć‚Ş‚ ‚éB
Perl‚Ĺ‚â‚ę‚Ίî–{“I‚É–â‘č‚Č‚˘‚Š‚çAPerl‚ŏ‘‚­•Č‚ނ‚­B
ShellScript‚Ĺ‚˘‚Á‚˝‚ńŽg‚¤‚ž‚Ż‚Č‚çAawk‚Í•Ö—˜‚ž‚Ż‚ǁB
182 :
2008/08/04(ŒŽ) 01:23:58
>>180
‰´‚ŕ@AWK ‚Ĺ‚Ĺ‚Ť‚é‚Č‚çAWKB
‚ƍl‚Ś‚é‚Ɓ@ƒoƒCƒiƒŠ[‚Ěƒf[ƒ^‚˘‚ś‚éˆČŠO‚ÍAWK‚Ĺ‚Ĺ‚Ť‚é‚̂ł́c
i­‚Č‚­‚Ć‚ŕ@‰´‚É“úí‚Ěƒj[ƒd‚ł́@‚ť‚¤‚žj
183 :
2008/08/04(ŒŽ) 02:16:24
>>182
“ŻŠ´B‚˝‚žƒoƒCƒiƒŠ‚ÍŽd•ű‚Č‚˘‚É‚ľ‚Ä‚ŕA
‘S”źŠpŹÝ‚ĚŒĹ’č’ˇƒtƒH[ƒ}ƒbƒg‚ވľ‚˘‚É‚­‚˘‚ń‚ž‚ć‚ȁB
ASCII‚É‚ˇ‚é‚Ć‘SŠp‚Ě‚Ý•”•Ş‚ޏˆ—‚ľ‚É‚­‚˘‚ľA
SJIS‚Ć‚Š‚É‚ˇ‚é‚Ɛł‚ľ‚­Ř‚čo‚š‚Č‚˘‚ľĽĽĽ
‚ ‚ę‚Í‚Č‚ń‚Ć‚Š‚Č‚ç‚ń‚ŕ‚Ě‚Š‚ȁB
184 :
2008/08/07(–Ř) 01:55:09
‚â‚Á‚Ď‚č ASCII ‚ž‚Ż‚Ě–â‘č‚É‚ľ‚Ä‚¨‚˘‚˝•ű‚Ş–ł“ďB
185 :
2008/08/11(ŒŽ) 15:38:13
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚Ĺƒ_ƒEƒ\‚Ĺ‚Ť‚é‚Ě‚ŞASCII‚ĆSJIS‚đ‚¤‚Ü‚­ˆľ‚Ś‚é‚â‚‚Ŕ‚á‚˂́H
186 :
2008/08/13(…) 00:38:23
>>185
‚˘‚âA‚ť‚ĚgawkŽg‚Á‚Ä‚é‚Ż‚ǁA‘S”źŠpŹÝ‚ĚŒĹ’č’ˇ‚͍˘‚é‚Í‚¸B
—ź•ű•ĘX‚Č‚ç–â‘č‚Č‚­ˆľ‚Ś‚é‚Ż‚ǁA“ŻŽž‚ɂ͈ľ‚Ś‚Č‚˘B
—á‚Ś‚΁BSJIS‚Ps5ƒoƒCƒg+‰üs‚ĚŒĹ’č’ˇƒtƒ@ƒCƒ‹‚Ĺ
‚Ps‚Í‚Q€–ځia:‘S”źŠpŹÝ4ƒoƒCƒg b:”źŠp‚Ě‚Ý1ƒoƒCƒgj‚Ěƒtƒ@ƒCƒ‹‚Ş‚ ‚é‚Ć‚ŤB
asciiƒ‚[ƒh‚Č‚ça, b‚đŘ‚č•Ş‚Ż‚ç‚ę‚é‚Şa‚Ě‘SŠp•śŽš‚͏ˆ—‚Ĺ‚Ť‚Č‚˘B
sjisƒ‚[ƒh‚Č‚ça, b‚đŘ‚č•Ş‚Ż‚ç‚ę‚Č‚˘B

”Y‚Ü‚ľ‚˘‚̂́A€–Ú‚đŘ‚č•Ş‚Ż‚éƒXƒNƒŠƒvƒg‚đascii ƒIƒvƒVƒ‡ƒ“‚Ĺ‹N“Ž‚ľ‚Ä
o—ÍŒ‹‰Ę‚đsjis‚ŏˆ—‚ˇ‚ę‚΁i‚ß‚ń‚Ç‚­‚ł‚˘‚Ż‚ǁjŒťó‚ŏˆ—‚Ĺ‚Ť‚Ä‚ľ‚Ü‚¤B
‚̂ŁAƒ}ƒjƒ…ƒAƒ‹‚ɏ‘‚˘‚Ä‚ ‚é’Ę‚čAěŽŇ‚đ‚¨‚Ë‚Ş‚˘‚ˇ‚ę‚Ή”\Ť‚Í‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚ށA
‚¨Šč‚˘‚ˇ‚é‚Ě‚ŞçSçO‚í‚ę‚銴‚ś‚Ȃ̂ˁB
187 :
2008/08/13(…) 22:12:09
awk‚ÍŽž‘ă‚̊֐”‚ž‚Š‚çŽg‚í‚ę‚Č‚­‚Č‚Á‚Ä‚˘‚­‚ń‚ž‚ë‚Č‚ 
188 :
2008/08/15(‹ŕ) 02:08:00
UTF-8‚Ěę‡‚Ĺ‚ŕŒĹ’č’ˇ‚Í”źŠp•‚ľ‚Š‘Ήž‚Ĺ‚Ť‚Ä‚Č‚˘B
•śŽš”‚ĆƒoƒCƒg”‚Ć•\ŽŚ•‚Ć‚ŠA“ú–{Œę‚Í–Ę“|‚ž‚Ě‚¤B

length()‚Ć‚Š‚ĹƒoƒCƒg”‚đE‚Ś‚Č‚˘‚Š‚玊‘O‚ŏˆ—‚ŕ‚â‚č‚É‚­‚˘B
189 :
2008/08/19(‰Î) 22:37:59
>>188
ˆęu”[“ž‚ľ‚Š‚Ż‚˝‚Ż‚ǁB
—âĂ‚ɍl‚Ś‚é‚ƁA‚ť‚ŕ‚ť‚ŕ‚P•śŽš‚Ş‰Â•Ď’ˇ‚Ĺ‚ ‚éUTF8‚đ
ŒĹ’č’ˇƒtƒ@ƒCƒ‹‚Ě•śŽšƒR[ƒh‚ÉŽg‚¨‚¤‚ƍl‚Ś‚˝“z‚đ’÷‚ßă‚°‚Ä
‹ƒ‚­‚قǖ₢‹l‚ß‚é•ű‚Şć‚ž‚ĆŽv‚¤‚͉̂´‚ž‚ŻH

l‚Ś‚Ä‚ŕl‚Ś‚Ä‚ŕƒƒŠƒbƒg‚ŞŽv‚˘‚‚Š‚Č‚˘‚ćc
190 :
2008/08/21(–Ř) 00:40:10
>>189
‚Ů‚Ć‚ń‚Ç‚Ě•śŽšƒR[ƒh‚Ş‰Â•Ď’ˇ‚ž‚Š‚ç‚Č‚ B
‘Š‘ΓI‚ÉŒŠ‚ę‚΃}ƒV‚Č•ű‚É“ü‚é‚ń‚ś‚á‚Č‚˘?
ƒzƒXƒg‚Ş—‚Ţ‚Ć•śŽšƒR[ƒhŽü‚č‚͔ߎS‚ž‚ćc
ƒzƒXƒg‚ś‚á‚Č‚˘‚Č‚ç‚ť‚ŕ‚ť‚ŕŒĹ’č’ˇ‚ś‚á‚Č‚­‚Ä—Ç‚˘‚ń‚ž‚Ż‚ǂˁB
191 :
2008/08/23(“y) 01:53:25
‚ ‚éƒtƒBƒ‹ƒ^ƒXƒNƒŠƒvƒg‚đgawk‚ŏ‘‚˘‚Ä‚˘‚é‚Ě‚Ĺ‚ˇ‚Ş
•śŽš‚ĚƒR[ƒh‚𐎐”’l‚É•ĎŠˇ‚ľ‚悤‚Ć‚ľ‚Ä‚¤‚Ü‚­‚˘‚Ť‚Ü‚š‚ń
‚˝‚Ć‚Ś‚΁ucv‚Ć‚˘‚¤•śŽš‚ĚƒR[ƒh‚𐎐”’l‚É‚ľ‚悤‚Ć‚ľ‚Ä
BEGIN {
@testChar = "c";
@printf("testChar=%d\n",testChar);
}
‚̂悤‚É‚ľ‚Ä‚ŕutestChar=0v‚Ć•\ŽŚ‚ł‚ę‚Ä‚ľ‚Ü‚˘‚Ü‚ˇ
—Ç‚˘•ű–@‚Ş‚ ‚ę‚΂¨‹ł‚Ś‚­‚ž‚ł‚˘
192 :
2008/08/23(“y) 03:21:15
>>191

awklib ‚É ord ‚Á‚ㆁ[ƒU[’č‹`‚Ěƒ‰ƒCƒuƒ‰ƒŠŠÖ”‚Ş‚ ‚é‚Š‚ç‚ť‚ę‚đŽg‚¤B
ŽŠ‘O‚ōě‚Á‚Ä‚ŕ‚˘‚˘‚Ż‚ǂˁB

‚­‚í‚ľ‚­‚Í info gawk ‚Ĺ’˛‚ׂāB
193 :
2008/08/23(“y) 03:28:08
>>192
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
‘‘ŹŒŸ“˘‚ľ‚Ä‚Ý‚Ü‚ˇ
194 :
2008/08/23(“y) 10:56:41
>>192
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_16.html
‚É‚ ‚Á‚˝‚ŕ‚Ě‚đŽŽ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝.Šú‘Ň‚Ç‚¨‚č‚Ě“Žě‚đ‚ľ‚Ä‚­‚ę‚Ü‚ˇ.
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝.
195 :
2008/09/15(ŒŽ) 01:12:37
“ü—Í“ŕ—e‚đawk‚ŐśŹ‚ˇ‚é‚ą‚Ć‚Ío—ˆ‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š
‚ŕ‚ľ‚­‚ÍBEGIN“™‚ĚƒuƒƒbƒN“ŕ‚Ĺ•śŽš—ń‚𐜐Ź‚ľ‚Ä
‚ť‚Ě•śŽš—ń‚Ěƒpƒ^[ƒ“–ˆ‚É•ŞŠňAƒtƒB[ƒ‹ƒh‚đŽg‚Á‚Ä‚Ěˆ—
i—v‚Íawk‚É“ü—̓tƒ@ƒCƒ‹“n‚ľ‚˝Žž‚ÉŠČ’P‚ɏ‘‚Ż‚鏈—j
‚đŠČ’P‚ɏ‘‚­‚ą‚Ć‚Ío—ˆ‚é‚Ě‚Ĺ‚ľ‚傤‚Š

—á‚Ś‚΁c‚Ç‚ń‚ȏˆ—‚Ş“KŘ‚Čŕ–ž‚Š”ť‚č‚Ü‚š‚ń‚Ş
BEGIN{for(i=0;i<10;i++) print int(rand()*10),int(rand()*10),int(rand()*10)}
‚ĚŒ‹‰Ę‚ɑ΂ľ‚Ä
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
c‚Ć‚Š‚ť‚ń‚ČŠ´‚ś‚ŁAƒeƒLƒXƒg‚𐜐Ź‚ľ‚˝Œ‹‰Ę‚ɑ΂ľ‚Ä
ƒtƒBƒ‹ƒ^[‚Ć‚ľ‚Ä”äŠrŽŽ‚␳‹K•\Œť‚Ĺ•ŞŠň‚ľ‚āAƒtƒB[ƒ‹ƒh‚đŽg‚Á‚ďˆ—‚ˇ‚銴‚ś‚Ĺ‚ˇB

‚â‚Á‚Ď‚čƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ćawkƒtƒ@ƒCƒ‹‚đ‚˘‚­‚‚ŕě‚Á‚˝‚č
ˆęsˆęs‚ɑ΂ľ‚Äif•ś‚Ĺ•ŞŠň‚ľ‚˝‚čsplit‚Ĺ•ŞŠ„‚ˇ‚é‚ľ‚Š–ł‚˘‚Ĺ‚ˇ‚Š‚ˁcB
196 :
2008/09/15(ŒŽ) 01:52:51
>>195
Š¸‚Ś‚Ä“ü—͂𐜐Ź‚ľ‚˝‚˘‚Ě‚Č‚çAawk‚đƒpƒCƒv‚ĹŒq‚°‚΂˘‚˘‚ĆŽv‚¤B
‚ť‚¤‚Ĺ‚Í‚Č‚­A’P‚É—”‚ŏˆ—‚đU‚č•Ş‚Ż‚˝‚˘‚̂Ȃ畁’Ę‚Éif•ś‚Ĺ‚˘‚˘‚ĆŽv‚¤B

‚ť‚ę‚Í‚ł‚Ä‚¨‚ŤA
--
$1+$2+$3<10{ print $1+$2+$3 }
$1+$2+$3>=10{ print ($1+$2+$3) % 10 }
--
‚Í•Ę‚Éă‚ĚđŒŽŽ‚Í—v‚ç‚ń‚ž‚ëBˆęŒ…‚̐”’l‚đ10‚ĹŠ„‚Á‚˝—]‚č‚ÍŒł‚Ě‚Ü‚Ü‚ž‚Š‚ç‚ȁB
197 :
2008/09/15(ŒŽ) 14:18:55
>196
‚˘‚â‚ ‚­‚Ü‚Ĺ—á‘č‚Č‚Ě‚Ĺ“ŕ—e‚͐[‚­l‚Ś‚Č‚˘‚Ĺ‚­‚ž‚ł‚˘corz

•’Ę‚Éif•ś‚Ć‚ÍŒž‚¤‚ŕ‚̂́AÜŠpawk‚Ş•W€‚Ĺ”ő‚Ś‚Ä‚é•Ö—˜‚Č‹@”\‚𖳎‹‚ľ‚Äç’ˇ‚ȏ‘‚Ť•ű‚ˇ‚é‚Ě‚ŕ“ď‚ž‚ľ
‚Š‚ĆŒž‚Á‚Ä.awkƒtƒ@ƒCƒ‹•Ą”ŒÂ‚Ćƒoƒbƒ`‚ŁAƒpƒCƒv‚ł‚Ȃ°‚ďˆ—‚ˇ‚é‚Ě‚ŕc‚¤`‚ńA‚Ć‚Č‚Á‚Ä‚ľ‚Ü‚¤B
—Ç‚˘‘‚Ť•ű–ł‚˘‚Š‚Č‚Ÿ‚ĆŽv‚Á‚˝‚Ě‚Ĺ•ˇ‚˘‚Ä‚Ý‚˝‚Ě‚Ĺ‚ˇ‚ށAif‚Ćsplit‚ĹŠć’Ł‚č‚Ü‚ˇB
198 :
2008/09/16(‰Î) 02:58:54
Žż–â‚Ş‚ć‚­‚í‚Š‚ç‚ń‚Ě‚ž‚ށABEGIN•”‚ŐśŹ‚ľ‚˝ƒtƒ@ƒCƒ‹‚đˆ—•”‚Ĺˆľ‚˘‚˝‚˘‚Ć‚˘‚¤‚ą‚Ć‚Š‚ȁH
—á‚Ś‚΁A
gawk 'BEGIN{ ARGV[1]="in_file.txt"; ARGC=2; }{ print }'
‚Á‚Ä‚â‚Á‚˝‚ç in_file.txt ‚đ•\ŽŚ‚Ĺ‚Ť‚é‚ź‚˘
199 :
2008/09/16(‰Î) 09:51:03
>198
III
–Ú‚Š‚ç—Ř‚Ĺ‚ˇB

‚ť‚Á‚ŠAƒtƒ@ƒCƒ‹śŹ‚ľ‚ż‚á‚Ś‚Îˆę”­‚ōs‚Ż‚é‚Ě‚Šc‚â‚Á‚Ä‚Ý‚Ü‚ˇ
200 :
2008/09/16(‰Î) 15:07:48
‚¤‚°Aˆę’Uƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í‚ ‚č‚Č‚Ě‚Š‚ćB
if‚đŽg‚¤‚Ě‚Íç’ˇ‚Ȃ̂ɁAƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Íç’ˇ‚ś‚á‚Č‚˘‚Á‚Ä‚Ç‚ń‚ČƒZƒ“ƒX‚Č‚ń‚žB
201 :
2008/09/16(‰Î) 17:48:16
>200
“ü—̓f[ƒ^‚Í‹K‘ĽŤ‚Ě‚ ‚é‚ŕ‚̂ŁAśŹ‚ľ‚Ä‚ľ‚Ü‚Ś‚é‚Ż‚Ç
‚ť‚ę‚ɑ΂ľ‚Ä‚Ě•ŞŠň‚Í‘˝‚˘c‚Ć‚˘‚¤ę‡
if‚âsplit‚đ—…—ń‚ˇ‚é‚ć‚č‚ŕAawk‚ŞŒłXŽ‚Á‚Ä‚é
ƒpƒ^[ƒ“‚ĆƒtƒB[ƒ‹ƒh•ŞŠ„‚đŽg‚Á‚˝•ű‚Ş
ƒXƒbƒLƒŠ‚ˇ‚é‚ĆŽv‚¤‚Ě‚Ĺ‚ˇ‚ŞŠÔˆá‚Á‚Ä‚é‚Ĺ‚ľ‚傤‚ŠcB
202 :
2008/09/16(‰Î) 19:39:26
>>201
•Ę‚É‚˘‚˘‚ń‚ś‚á‚Ë?
‹‘ĺ‚Č’†ŠÔƒtƒ@ƒCƒ‹‚đě‚é‚Á‚Ä‚í‚Ż‚Ĺ‚ŕ‚Č‚˘‚ń‚ž‚낤‚ľB
‚Ü‚ŸAŽŸ‚Ě——R‚ĹŽ„‚Í’†ŠÔƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í”đ‚Ż‚é‚Ż‚ǂˁB
Eƒtƒ‹ƒpƒX‚đŽw’č‚ľ‚Č‚˘ę‡AƒJƒŒƒ“ƒgƒfƒBƒŒƒNƒgƒŠ‚ɏ‘‚Ťž‚ÝŒ ŒŔ‚Ş‚ ‚é•Űá‚Ş‚Č‚˘B
E‚ť‚ŕ‚ť‚ŕ“Ż–źƒtƒ@ƒCƒ‹‚Ş‘śÝ‚ľ‚Ä‚˘‚ď‘‚Ťž‚ÝŒ ŒŔ‚Ş‚Č‚˘‚Š‚ŕ’m‚ę‚Č‚˘B
E‚[‚ŠA“ŻŽž‚É2Œ“Ž‚Š‚ľ‚˝‚çƒoƒbƒeƒBƒ“ƒO‚ľ‚Ä‚ľ‚Ü‚¤B
E‚ž‚Š‚ç‚ĆŒž‚Á‚āAˆęXƒ†ƒj[ƒN‚Č–ź‘O‚Ěƒtƒ@ƒCƒ‹–ź‚𐜐Ź‚ˇ‚é‚Ě‚ŕ–Ę“|‚žB
E‚ľ‚Š‚ŕA’†ŠÔƒtƒ@ƒCƒ‹‚ÍŒă‚ŏÁ‚ľ‚Ä‚¨‚­•K—v‚Ş‚ ‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘B

‚ť‚ę‚ƁAŽŠ‘O‚Ĺ“ü—͂𐜐Ź‚ˇ‚é‚Č‚çAĹ‰‚Š‚ç•ŞŠ„‚ł‚ę‚˝ó‘Ô‚Ĺě‚ę‚΂˘‚˘‚Š‚çsplit‚Í—v‚ç‚Č‚˘‚ˁB
ƒpƒ^[ƒ“‚đŽg‚¤‚Šif‚đŽg‚¤‚Š‚ÍŽď–Ą‚Ě–â‘č‚̂悤‚Č‹C‚Ş‚ˇ‚é‚Ż‚ǁB
# $1+$2+$3<10{print;}‚Ə‘‚­‚Šif($1+$2+$3<10){print;}‚Ə‘‚­‚Š‚Ěˆá‚˘‚ž‚ŕ‚ń‚ˁB
203 :
2008/09/18(–Ř) 01:19:00
FXl‚Ś•ű‚Ş‚ ‚é‚̂ˁB

ŽŠ•Ş‚Č‚çƒgƒŠƒbƒL[‚ȍ׍H‚ľ‚Ä‚P‚‚Ɏű‚ß‚¸•ŞŠ„‚ľ‚ÄifŽg‚킸‚ɏ‘‚­‚Ż‚ǁB
Žč‘‚­ƒJƒ^‚đ‚‚Ż‚ç‚ę‚é‚Ě‚Şawk‚Ě—Ç‚˘Š‚ž‚ĆŽv‚¤‚ľA
‹ZI‚É‘–‚é‚ĆŠÔˆá‚˘‚Č‚­–Y‚ę‚é‚Ě‚Ĺƒƒ“ƒe•s‰Â”\‚É‚Č‚é‰Â”\Ť‘ĺ

‚܁A‚ť‚ę‚Í‚ť‚ę‚Ć‚ľ‚Ä>>198‚̓pƒYƒ‹“I‚Č–Ę”’‚ł‚Ş‚ ‚Á‚Ä—Ç‚˘‚ˁB
204 :
2008/09/19(‹ŕ) 19:54:42
>202
‚¤`‚ńAŒž‚í‚ę‚Ä‚Ý‚ę‚΂ť‚¤‚Š‚ŕB
ˆę‰žAĄ‰ń‚Ě‚ÍŽdŽ–‚ĹŽg‚¤‚í‚Ż‚Ĺ‚ŕ‚Č‚Ż‚ę‚Αźl‚ÉŽg‚Á‚Ä‚ŕ‚炤—\’č‚ŕ‚Č‚˘
ŠŽ‘S‚ČŒÂl—pƒXƒNƒŠƒvƒg‚Č‚Ě‚Ĺ‚Ç‚¤‚É‚Ĺ‚ŕ‚Č‚č‚Ü‚ˇ‚Ş
‚ą‚ę‚Ş‹Ć–ą‚⎊•ŞˆČŠO‚ŕŽg‚¤‚ŕ‚Ě‚Ĺ‚ ‚ę‚Αf’ź‚Éif‚Č‚ń‚Ĺ‚ľ‚傤‚ˁB
205 :
2008/09/22(ŒŽ) 20:50:40
2008/09/15 13:17 61 20080915142145.txt
2008/09/16 13:17 316 2008091611529.txt
2008/09/22 20:09 24,028 2008_0922asahiindex.txt
2008/09/22 12:57 1,545 clean.txt

‚Ć‚˘‚¤ƒtƒ@ƒCƒ‹ˆę——‚Š‚çAgawk‚ōĄ“ú‚Ě“ú•t‚Ěƒtƒ@ƒCƒ‹‚ž‚Ż”˛‚Ťo‚ˇ‚É‚Í‚Ç‚¤‚ˇ‚č‚Ⴂ‚˘‚ń‚ž‚Á‚Ż?

BEGIN{month = strftime("%m",systime()); date = strftime("%d",systime())}

/month/ && /date/ {print $0}

‚Ĺ‚˘‚˘‚Š‚ĆŽv‚Á‚˝‚çA/ /‚Ě‚Č‚Š‚Émonth‚Ć‚Š‚ÍŽg‚Ś‚Č‚˘‚ç‚ľ‚˘B

/strftime("%d",systime())/ {print $0}
‚Ƃׂ˝‘‚Ť‚ľ‚Ä‚ŕ‚ž‚߁B
‚Ç–Y‚ę’†Bƒwƒ‹ƒvƒ~[B
206 :
2008/09/22(ŒŽ) 21:05:13
BEGIN{date=strftime("%m/%d")} $0 ~ date {print $0}
207 :
2008/09/22(ŒŽ) 21:45:34
>>206
thanks!
208 :
2008/10/10(‹ŕ) 19:41:51
Žż–â‚Ĺ‚ˇB
“ü—Í’†‚Ěƒtƒ@ƒCƒ‹–ź‚ÍFILENAME‚ɃZƒbƒg‚ł‚ę‚Ü‚ˇ‚ށA
“ü—Í’†‚Ěƒtƒ@ƒCƒ‹‚ĚƒpƒX‚đŽć“ž‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ˇ‚ŠB
209 :
2008/10/10(‹ŕ) 22:13:43
>>208
FILENAME‚Ĺ“ž‚ç‚ę‚éî•ń‚Ş‘S‚āBƒtƒ‹ƒpƒX‚Ş—~‚ľ‚˘‚Ć‚˘‚¤‚ą‚Ć‚Č‚çA
cwd‚đŽć“ž‚ľ‚Ä‚ť‚ą‚Š‚ç‚Ě‘Š‘΃pƒX‚ŞFILENAMEB
210 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2008/11/12(…) 19:19:08

awk‚ĚŒ‹‰Ę‚đ set ‚Š@setenv ‚̕ϐ”‚É‘ă“ü‚ľ‚˝‚˘‚Ĺ‚ˇB

awk '{ print $1+ $3 }' test.txt
‚Ő”’l‚ޏo‚Ü‚ˇB
‚ą‚ĚŒ‹‰Ę‚đ•Ď”‚É‘ă“ü‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚炢‚˘‚ń‚Ĺ‚ľ‚傤‚ŠH

set tmp=`awk '{ $1+ $3 }' test.txt`

‚ą‚ę‚ž‚ƏăŽč‚­‚˘‚Ť‚Ü‚š‚ńBprint ‚Í‚ť‚Ě‚Ü‚Ü‚Ĺ‚˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
211 :
2008/11/12(…) 20:24:22
‚Č‚ń‚Ĺ print ‚đČ—Ş‚Ĺ‚Ť‚é‚ƍl‚Ś‚˝‚Ě‚Š‚Ş“ä‚ž‚Ş
212 :
2008/11/12(…) 23:57:16
>print ‚Í‚ť‚Ě‚Ü‚Ü‚Ĺ‚˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚Ü‚¸ŽŽ‚š‚ć‚—
213 :
2008/11/13(–Ř) 14:17:14
V‹IŒłŽĐ‚ĚƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęawk‚Ş‚Ç‚ą‚ŕ”„‚čŘ‚ę‚Č‚ń‚ž‚Ż‚Ç
‚ŕ‚¤“ü‚ç‚Č‚˘‚Ě‚Š‚Č
214 :
2008/11/16(“ú) 03:02:56
>>211
print‚͉ć–Ę•\ŽŚ‚ˇ‚é‚ŕ‚́¨•Ď”‚É“ü‚ę‚é‚ž‚Ż‚Č‚ç•s—v
c‚ĆŽv‚Á‚˝‚ń‚ś‚á“ŕ‰Č‚Ë
215 :
2008/11/18(‰Î) 11:28:33
ƒJƒ“ƒ}‹ćŘ‚č‚Ěƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ş‚ ‚čA‚ť‚Ě’†‚ŁA‘ć‚PƒtƒB[ƒ‹ƒh‚Ć‘ć‚RƒtƒB[ƒ‹ƒh“ŕ‚É‚ŕ‚ľ
Žq‰šAŽq‰šAŽq‰šA•ę‰š‚Ş‘śÝ‚ˇ‚ę‚΂ť‚̍s‚ž‚Ż”˛‚Ťo‚ˇƒI[ƒN‚ĚƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹‚đ‚‚­‚č‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚¤‚ˇ‚ę‚΂悢‚Ĺ‚ˇ‚Š
216 :
2008/11/18(‰Î) 11:41:15
>>215
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚ĚƒTƒ“ƒvƒ‹‚Ć”˛‚Ťo‚ľ‚˝‚˘sƒˆƒ
217 :
2008/11/18(‰Î) 11:50:40
‚ą‚ń‚ČŠ´‚ś‚Ĺ‚ˇ
takeshi,fiad,fdjioaf,fdjsoafdsiŠŠY“–‚Č‚ľj
dddacea,fsaofsa,rrra,fjisaofdjsaiddda‚Ćrrra‚ŞŠY“–j
aexxxu,dsoifsa,yyyuo,fjsaofaixxxu‚Ćyyyu‚ŞŠY“–j
218 :
2008/11/18(‰Î) 12:12:55
ƒI[ƒNƒXƒNƒŠƒvƒg‚đŽŔs‚ˇ‚é‚Əî•ń‚đ•\ŽŚ‚ˇ‚é‚悤‚É‚ľ‚˝‚Ě‚Ĺ‚ˇ‚Ş‚Ps–Ú‚ĆĹŒă‚̍s‚ž‚Ż‚đ•\ŽŚ‚ľ‚Č‚˘‚悤‚É‚ˇ‚é‚É‚Í
END“ŕ‚ɉ˝‚ď‘‚Ż‚΋X‚ľ‚˘‚Ĺ‚ľ‚傤‚Š
219 :
2008/11/18(‰Î) 12:43:59
>>215
BEGIN{FS=","}
function term_check(term, lower_term) # lower_term ‚͋ǏŠ•Ď”
{
lower_term=tolower(term)
if(lower_term ~ /[bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][bcdfghjklmnpqrstvwxyz][aiueo]/) return 1
return 0
}
{
if(term_check($1) && term_check($3)) print
}

ƒpƒ^[ƒ“ŒJ‚č•Ô‚ľ‚Á‚Ä {3} ‚Ć‚Š‚Ĺ‚˘‚Ż‚é‚Í‚¸‚Č‚ń‚ž‚Ş
‘‚Ť•ű’m‚ç‚Č‚˘‚Ě‚ĹƒRƒsƒy‚ľ‚˝‚—
220 :
2008/11/18(‰Î) 12:47:37
>>218
’€ŽŸo—Í‚ľ‚Ä‚éH
END ‚Ĺ‚Ü‚Ć‚ß‚Äo—Í‚ľ‚Ä‚éH
221 :
2008/11/18(‰Î) 13:53:22
>>218
1s‚¸‚ƒoƒbƒtƒ@ƒŠƒ“ƒO‚ľ‚āAŽŸ‚̍s‚Ě“ü—Í‚Ĺ‘O‚̍s‚đo—Í‚ˇ‚ę‚ÎĹŒă‚̍s‚͏Á‚Ś‚Ä‚Č‚­‚Č‚éB
awk 'NR > 2 {print buffer;} NR > 1 {buffer = $0;}'
222 :
2008/11/18(‰Î) 14:20:29
>>215
gawk‚Č‚ç
awk -F "," -v r="[bcdfghj-np-tv-z]{3}[aiueo]" --posix '$1 ~ r && $3 ~ r'
$1‚Ć$3‚Ç‚ż‚ç‚Šˆę•ű‚É‚ ‚ę‚΂˘‚˘‚Č‚ç&&‚đ||‚É•Ď‚Ś‚Ä‚Ë
223 :
2008/11/18(‰Î) 16:29:37
>>219
•‚Š‚č‚Ü‚ľ‚˝I
224 :
2008/11/18(‰Î) 16:46:03
o—ˆ‚Ü‚ľ‚˝@‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
225 :
2008/11/19(…) 23:48:41
ž‚Ý“ü‚Á‚ĂĐŽ—‚Ĺ‚Ť‚Č‚˘‚Ě‚Ĺ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B
E‘ÎŰ‚ĚƒeƒLƒXƒg‚Í2s–Ú‚Ş‚Č‚˘(1s–Ú‚ľ‚Š‚Č‚˘)‚Š‚Â
E1s–Ú‚Í‚Đ‚ç‚Ş‚ČƒJƒ^ƒJƒiŠżŽš‚Ĺ15•śŽšˆČ“ŕ
‚Ć‚˘‚¤đŒ‚đ‘‚­‚Ě‚Á‚āAŽŸ‚̂悤‚É‚ľ‚˝‚Ě‚Ĺ‚ˇ‚ށA‚¤‚Ü‚­ƒqƒbƒg‚ľ‚Ü‚š‚ńB
‚Ç‚¤‘‚Ż‚΂˘‚˘‚Ĺ‚ľ‚傤?

NR==2 && length($0) == 0 && NR==1 && /[‚Ÿ-‚ńƒ@-ƒ–ˆŸ-˜r]{1,15}/
226 :
2008/11/19(…) 23:53:31
>>225
NR == 2 && NR == 1‚ś‚áAâ‘ΐŹ—§‚ľ‚Č‚˘‚ž‚ëB
227 :
2008/11/19(…) 23:54:54
awk‚͍s‚đ1s‚¸‚ˆ—‚ˇ‚é‚Š‚çAŽ–‘O‚Ƀg[ƒ^ƒ‹s”‚đ’m‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘B
ƒg[ƒ^ƒ‹s”‚Ş1s‚Ĺ‚ ‚é‚ą‚Ć‚đ•ŰŘ‚ľ‚˝‚˘‚Č‚çAENDƒuƒƒbƒN‚ŏˆ—‚ˇ‚é‚ľ‚Š‚Č‚˘B
228 :
2008/11/20(–Ř) 00:22:37
>Ž–‘O‚Ƀg[ƒ^ƒ‹s”‚đ’m‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘
BEGIN•”‚Ő”‚Ś‚ę‚΁H
229 :
2008/11/20(–Ř) 00:28:19
>>228
‚Ç‚¤‚â‚Á‚Ä? ‘ÎŰ‚Şƒtƒ@ƒCƒ‹‚Ĺ‚ ‚é•ŰŘ‚Ş‚ ‚é‚Č‚çwc‚Ĺ‚ŕŒÄ‚ׂ΂˘‚˘‚Ż‚Ç‚ť‚ę‚Č‚çawk‚Ĺ‚â‚é•K—v‚ł‚Ś‚Č‚˘‚ć‚ˁB
230 :
2008/11/20(–Ř) 03:49:07
{ a = $0 }
END { if (NR == 1 && a ~ /re/) print a }
‚Ć‚Š?
231 :
2008/11/20(–Ř) 23:58:06
‚Ç‚Č‚˝‚ŠA”CˆÓƒrƒbƒg•‚Ě2‚̕␔HEX‚đDEC‚É•ĎŠˇ‚ˇ‚éƒvƒƒOƒ‰ƒ€‚đ‘‚˘‚Ä‚ŕ‚ç‚Ś‚Ü‚š‚Ę‚ŠH
232 :
2008/11/22(“y) 12:02:58
Žd—l‚Ş•s–žŠm‚Č‚Ć‚ą‚ë‚Ş‚ ‚é‚ľA‚Č‚É‚ć‚č‚Č‚ń‚Ĺawk‚Ĺ?
233 :
2008/11/26(…) 22:53:51
>>232
‚ą‚ą‚ŞawkƒXƒŒ‚ž‚Š‚ç‚Ĺ‚ľ‚ĺB
234 :
2008/11/29(“y) 03:05:38
>>232
l‚Ś‚é‚ȁBŠ´‚ś‚ë‚—
235 :
2008/12/12(‹ŕ) 07:21:00
u‚ ‚Č‚˝‚͉˝ŒĚawk‚Ĺ‚â‚낤‚Ć‚ˇ‚é‚Ě‚Ĺ‚ˇ‚ŠHv
u‚ť‚ą‚Éawk‚Ş‚ ‚é‚Š‚çv
236 :
2008/12/13(“y) 04:23:45
awk‚Š‚çsystem()‚Ĺgrep‚Ć‚Šsed‚Ć‚ŠŒÄ‚ń‚ž‚股‚é•Č‚Ş•t‚˘‚Ä‚˘‚é
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚ˇ‚é•ű‚Ş‚Ţ‚ľ‚ëˆá˜aŠ´
237 :
2008/12/13(“y) 23:56:31
‚¨‚˘‚¨‚˘Agrep‚âsed‚Ž‚炢ŒÄ‚яo‚ł‚¸‚Éawk‚Ĺ‚â‚낤‚şB
238 :
2008/12/16(‰Î) 00:29:26
grep‚âsed‚̓pƒCƒv‚ł‚Ȃ°‚ÄŽg‚¤‚ŕ‚Ě‚ś‚á‚Č‚˘‚́H(^^;
239 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/01/10(“y) 22:10:41
gawk 3.1.4 mb@‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
240 :
2009/01/11(“ú) 00:38:51
‚Č‚ń‚Ĺ‚ť‚ń‚ČŒĂ‚˘ƒo[ƒWƒ‡ƒ“‚Ş—~‚ľ‚˘‚Ě?
241 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/01/11(“ú) 12:16:04
>‚Č‚ń‚Ĺ‚ť‚ń‚ČŒĂ‚˘ƒo[ƒWƒ‡ƒ“‚Ş—~‚ľ‚˘‚Ě?
length‚Ć‚Šsubstr‚ŁAujv•t‚Ť•śŽš—ńŠÖ”‚Ş‚ ‚é‚Š‚ç‚Ĺ‚ˇB
3.1.5ˆČ~‚ž‚ƁA“Ż‚śƒXƒNƒŠƒvƒgƒtƒ@ƒCƒ‹“ŕ‚ŁAƒoƒCƒg’PˆĘˆ—‚Ć
ƒLƒƒƒ‰ƒNƒ^[’PˆĘˆ—‚̍ŹÝ‚Ş“ď‹V‚Č‚Ě‚Ĺ‚ˇB
242 :
2009/01/11(“ú) 15:01:36
3.1.5‚Ĺ•śŽš‚Ěˆľ‚˘‚Ş•Ď‚í‚Á‚˝‚Ě‚Í‚ť‚Ě’Ę‚č‚ž‚Ż‚ǁA3.1.4‚ĚWindows”Ĺ‚Ä
jlength‚â‚ç‚ ‚Á‚˝‚Á‚Ż?
‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB
243 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/01/11(“ú) 15:48:22
>‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB
‚Ś‚ÁB3.1.4ˆČ‘O‚Ě‚ÍƒoƒCƒg’PˆĘƒIƒ“ƒŠ[‚Á‚ÄŽ–‚Ĺ‚ˇ‚ŠH
c‚ť‚ę‚Ĺ‚ŕ2ƒoƒCƒgŠˇŽZ‚Ĺˆľ‚Ś‚΂˘‚˘‚Š‚çA‚Ü‚žƒ}ƒV‚Š‚ŕB

j•t‚Ť‚ޒljÁ‚ł‚ę‚Ä‚˘‚˝‚Ż‚ǁA“Žě•ĎX‚É”ş‚Á‚Ä”pŽ~‚ł‚ę‚˝c
‚ĆŽv‚Á‚Ä‚˘‚Ü‚ľ‚˝B
‹L‰Ż‚É‚ ‚é‚̂́A‚Ç‚Č‚˝‚Š‚Ě“ĆŽŠŠg’Ł•ĘVer‚ž‚Á‚˝‚Ě‚ŠcH
244 :
2009/01/11(“ú) 17:54:21
> ‚Ś‚ÁB3.1.4ˆČ‘O‚Ě‚ÍƒoƒCƒg’PˆĘƒIƒ“ƒŠ[‚Á‚ÄŽ–‚Ĺ‚ˇ‚ŠH ‚ż‚ႤB
j‚Č‚ń‚Ć‚Š‚Ş‚ ‚Á‚˝‚̂́A
2.11ƒx[ƒX‚Ějgawk‚Ć2.15ƒx[ƒX‚Ějgawk
2.15ƒx[ƒX‚Ě‚Ćgawk+mb
3.0.xƒx[ƒX‚Ěgawk+mb
‚ŁA3.1.xƒx[ƒX‚Ě‚É‚Í‚Č‚Š‚Á‚˝‚Ć‚˘‚¤˜b‚ž‚Á‚˝‚ĆŽv‚¤B
‚ť‚ę‚ź‚ę‚â‚Á‚Ä‚él‚ވႤB
245 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/01/11(“ú) 19:05:17
>3.1.xƒx[ƒX‚Ě‚É‚Í‚Č‚Š‚Á‚˝‚Ć‚˘‚¤˜b‚ž‚Á‚˝‚ĆŽv‚¤B
‚ť‚¤‚Ĺ‚ˇ‚ŠcB
gawk 3.1.4 mb ‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
‚Ĺ‚Í‚Č‚­‚āA
3.0.xƒx[ƒX‚Ěgawk+mb ‚Ěwindows”Ĺ‚ĚEXEƒtƒ@ƒCƒ‹‚Ş—~‚ľ‚˘c
‚Ć‚˘‚¤Ž–‚É‚Č‚é–ó‚Ĺ‚ˇ‚ށc–ł—‚Á‚Ű‚˘B
‚ ‚Á‚Ä‚ŕŠÖ”‚â‘gž•Ď”‚ŞŒ¸­c‚ť‚Ě‘O‚É16bitDOS”ĹONLY‚Ě—\Š´cB
’ú‚ß‚Ü‚ˇB240‚ł‚ńA‚Ç‚¤‚ŕ‚Ĺ‚ľ‚˝B
246 :
2009/01/11(“ú) 19:50:26
>>245

http://www.hinadori.atnifty.com/~wills/
‚É‚ ‚é‚ćB3.0.6‚̂₁B
DOS”Ĺ‚ž‚Ż‚ś‚á‚Č‚­‚ÄWin32”Ĺ‚ŕ‚ ‚éB

3.0.6→3.1.x‚Ĺ‘‚Ś‚˝‹@”\‚Ĺ‚ŕŽg‚Á‚Ä‚ń‚Ě?

247 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/01/11(“ú) 22:30:39
>‚ ‚é‚ćB3.0.6‚̂₁B
‚¨‚¨B ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
>3.0.6¨3.1.x‚Ĺ‘‚Ś‚˝‹@”\‚Ĺ‚ŕŽg‚Á‚Ä‚ń‚Ě?
‚˘‚‰˝‚Ş‘‚Ś‚˝‚Ě‚Š‚ć‚­”cˆŹ‚ľ‚Ä‚˘‚Č‚˘‚ń‚Ĺ‚ˇ‚ށA
gensub‚Ć‚Šmktime‚Ć‚Šswitch-case‚Ć‚Šc‚ ‚č‚Ü‚ˇ‚Š‚ˁB
‚Ü‚ A‘ă‘ÖŽč’i‚Í‚ ‚é‚Ě‚ĹŽŽ‚ľ‚Ä‚Ý‚Ü‚ˇB‚Ç‚¤‚ŕ‚Ĺ‚ˇB
248 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/02/23(ŒŽ) 08:11:12
awk‚ŁA‘g‚ݍ‡‚í‚š‚Ě‘S‚Ä‚đě‚éA‚Ć‚˘‚¤Ž–‚Í‚Ĺ‚Ť‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
‚˘‚í‚ä‚én‚br‚́AŒÂ”‚Ĺ‚Í‚Č‚­‚āA’†g‚đ’m‚č‚˝‚˘‚Ć‚˘‚¤Ž–‚Č‚Ě‚Ĺ‚ˇ‚ŞĽĽĽB
imawk‚đŽg‚Á‚Ä‚˘‚Ü‚ˇj
249 :
2009/02/24(‰Î) 18:18:34
>>248
‚Ĺ‚Ť‚Ü‚ˇ
250 :
sage
2009/03/04(…) 15:23:19
248‚Ĺ‚ˇB
‚Č‚ń‚Ć‚Š‚Ĺ‚Ť‚Ü‚ľ‚˝B249‚ł‚ń‚Ç‚¤‚ŕ‚Ĺ‚ˇB
251 :
2009/03/04(…) 15:24:16
sageŠÔˆá‚Ś‚˝c
252 :
2009/03/23(ŒŽ) 11:47:59
int(0.5005*10000)‚Ş5004‚É‚Č‚é‚Ě‚Í‚Č‚ş‚Ĺ‚ˇ‚ŠB
253 :
2009/03/23(ŒŽ) 12:41:00
ŠŰ‚ßŒëˇ‚Ĺ‚ľ‚傤B
Ř‚čŽĚ‚Ä‘O‚É0.5‘Ť‚ˇ‚Ć‚ŠH•v‚ľ‚Ä‚Ý‚Ä‚Í”@‰˝‚Ĺ‚ľ‚傤‚ŠB
Ú‚ľ‚­‚́AIEEE‚ĆŠŰ‚ßŒëˇ•Ó‚č‚ĚƒL[ƒ[ƒh‚ĹŒŸő‚Ě‚ą‚ƁB
254 :
2009/03/23(ŒŽ) 19:57:34
>253
‚ ‚č‚Ş‚Ć‚¤
255 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/04/13(ŒŽ) 21:36:16
gawk‚ĹŒfŽŚ”ě‚č‚˝‚˘‚ń‚Ĺ‚ˇ‚Ż‚ǁA
gawk‚ŞŽg‚Ś‚é–ł—żŽI‚Ç‚ą‚Š‚É‚ ‚č‚Ü‚š‚ń‚ŠH
256 :
2009/04/13(ŒŽ) 21:58:14
Linux‚Ş“ü‚Á‚Ă郌ƒ“ƒ^ƒ‹ŽI‚Č‚ç“ü‚Á‚Ä‚é‚ń‚ś‚á‚Č‚˘‚Š‚Č‚ŸH
ƒŒƒ“ƒ^ƒ‹ŽI”‚łŤ‚˘‚Ä‚Ý‚˝‚çB
‚ł‚­‚ç‚ĚFreeBSD‚ÍFreeBSD‚Ěawk(!=gawk)‚ž‚Á‚˝B
257 :
2009/04/13(ŒŽ) 22:07:10
>>256
‚ł‚­‚ç‚Ígawk‚Ĺ‚ˇ‚ŠB
Windows‚ś‚á‚Č‚˘ƒŒƒ“ƒ^ƒ‹ŽI‚Č‚çawk‚ŞŽg‚Ś‚Ä‚ŕ—Ç‚ł‚ť‚¤‚Ĺ‚ˇ‚Ż‚ǁA
–ł—ż‚Ĺ‚Í‚Č‚Š‚Č‚ŠŒŠ‚‚Š‚ç‚Č‚˘‚ń‚Ĺ‚ˇ‚ć‚ˁB
perlCrubyCphp‚Í‘˝‚˘‚ń‚Ĺ‚ˇ‚Ż‚Ç‚Ë‚ĽBB
258 :
2009/04/13(ŒŽ) 22:14:30
Ž¸—çB
‚ł‚­‚ç‚Ígawk‚ś‚á‚Č‚˘awk‚Ĺ‚ˇ‚ŠB
259 :
2009/04/18(“y) 13:07:13
‚í‚炤w
ttp://awk.info/?doc/dsl/awkplusplus.html

object_variable = class_name.new[(optional parameters)]
object_variable.method_name(parameters)
object_variable.delete
260 :
2009/04/18(“y) 13:30:10
>>259
“Ż‚ś‚­ƒEƒP‚˝
awk‚͉i‘ą“I‚ÉŽg‚Á‚Ä‚˘‚āCC-->C++-->Java‚Əć‚čŒp‚˘‚Ĺ‚Ť‚˝‚ށCawk‚Í‚ą‚ę‚çƒRƒ“ƒpƒCƒ‰ŒžŒę‚đŽg‚¤ă‚Ĺ
—Ç‚˘ŠwKŢ—ż‚É‚Č‚Á‚Ä‚Ť‚˝‚ĆŽv‚˘Š´ŽÓ‚ľ‚Ä‚˘‚é(‚ŕ‚ż‚ë‚ń–˘‚ž‚Éscript‚Ěawk‚đawk‚ŏ‘‚˘‚Ä‚˘‚é)D
—Bˆęawk‚ŕ׋­‚Ĺ‚Ť‚Č‚Š‚Á‚˝‚Ě‚ŞOOP‚ž‚Á‚˝‚Š‚çCŠwKŢ—ż‚Ć‚ľ‚Ä‚Ěawk‚Ş‚ą‚¤‚˘‚¤•űŒü‚ÉŠˆ˜H‚đŒŠ‚˘‚ž‚ˇ‚Ě‚Í
—Ç‚˘‚ą‚Ć‚Š‚ŕ‚ľ‚ę‚Č‚˘D‚˝‚ž‚ľŽŔ—p‚ÉŒü‚Ż‚čl‚Ś‚Ä‚Ý‚é‚ƁCŒÂl“I‚É‚ÍOOP‚Ş–{—Ě‚đ”­Šö‚ˇ‚é‚Ě‚Í“Ş‚Ě’†‚Ĺalgorithm‚đ
”cˆŹ‚ľ‚Ť‚ę‚Č‚­‚Č‚é’ö“x‚É‘ĺ‚Ť‚ČƒVƒXƒeƒ€‚đ‘g‚Ýă‚°‚éę‡‚Ȃ̂ŁC‰Ę‚˝‚ľ‚Ä‚ť‚ę‚đawk‚ŏ‘‚­‚Š‚Ć‚˘‚í‚ę‚é‚ƁcD
261 :
2009/04/18(“y) 13:57:19
s/algorithm/ƒf[ƒ^\‘˘/
262 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/05/09(“y) 23:49:39
Ĺ‹ßruby‚̕׋­Žn‚ß‚˝‚ń‚ž‚ށA
uruby‚Ş‚ ‚ę‚ÎAWK‚˘‚ç‚ˁv‚Ć‚ÍŽv‚Ś‚ńB
‹t‚ÉAWK‚Ě•Ö—˜‚ł‚đÄ”FŽŻ‚ľ‚˝B

‚â‚Á‚Ď‚čAŠČ’P‚ČƒeƒLƒXƒgˆ—‚Í
AWK‚Ĺ‚â‚Á‚˝‚Ů‚¤‚ŞŠČ’P‚žB
263 :
2009/05/09(“y) 23:58:09
Šes‚ɑ΂ľ‚ďˆ—‚Á‚Äę‡‚Íawk‚Ş—Ç‚˘‚Ë
264 :
2009/05/10(“ú) 00:37:15
ruby‚̓IƒuƒWƒFƒNƒgŽwŒü‚đ‹­§‚ł‚ę‚é‚Š‚珬‰ń‚č‚Ş‚Ť‚Š‚ń
265 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/05/10(“ú) 01:20:35
JavaScript‚Ş“Ž‚­ HTMLŽŔŒą•”‰Ž
ttp://homepage2.nifty.com/tomoarai/java/exper.html
266 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/05/14(–Ř) 08:38:05
jawk‚Ě˜b‘č‚Ş‘S‘Ro‚Č‚˘‚ˁB
Žg‚Á‚Ä‚él­‚Č‚˘‚́H
267 :
2009/05/19(‰Î) 23:16:20
>>266
‚ł‚­‚Á‚Ć1s‚ĹĎ‚Ţ‚Ě‚Ş‹C‚É“ü‚Á‚Ă鉴‚É‚Í–ł—p‚ž‚Č
268 :
2009/06/01(ŒŽ) 15:22:34
>>266
JƒA(ƒI)[ƒNAƒvƒ‰ƒOƒAƒEƒbI
269 :
2009/06/08(ŒŽ) 01:31:39
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_167
Geocoding - ZŠ‚Š‚çˆÜ“xŒo“x‚đŒŸő ‚ž‚Á‚āB‰˝‚ą‚ꂨ‚ŕ‚낢B
270 :
2009/06/21(“ú) 16:39:12
{if(miso<$1){printf($1)}} miso=30
‚đŽŔs‚ˇ‚é‚Ć$1‚Ş‚PŒ…‚̐”Žš‚Ě‚Ć‚Ť‚É‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚ń‚Ĺ‚ˇ‚Ż‚Ç‚Č‚şH
271 :
2009/06/21(“ú) 19:43:04
•śŽš—ń‚Ĺ”äŠr‚ł‚ę‚Ä‚é‚ń‚ś‚á‚ˁH
miso<$1-0
‚Ĺ‚â‚Á‚˝‚ç‚Ç‚¤H
272 :
2009/06/21(“ú) 21:34:56
>>271
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‚Ĺ‚ŕ‚ž‚ß‚Ĺ‚ľ‚˝B
•śŽš—ń‚Ĺ”äŠr‚ł‚ę‚Ä‚é‚Á‚Ű‚˘‚Ĺ‚ˇ‚ˁB
273 :
2009/06/21(“ú) 22:04:19
>>270
‰˝‚đ“ü—Í‚ľ‚˝‚Ć‚Ť‚ɉ˝‚ޏo‚Ä—~‚ľ‚˘‚́H
‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚Á‚Ä‚Ç‚¤‚Č‚é‚́H
274 :
2009/06/21(“ú) 22:23:40
>>273
$1‚Ş4‚Ě‚Ć‚Ť‚ɏo‚Ä‚Ů‚ľ‚­‚Č‚˘‚Ě‚Éo‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇDDD
275 :
2009/06/21(“ú) 22:31:41
>>274
‚ą‚ń‚Č‚ńH
BEGIN{miso=30}{if(miso<$1){printf("%d\n",$1)}}
276 :
2009/06/21(“ú) 22:46:46
>>275
o‚Ä‚ľ‚Ü‚¤——R‚Ş‹C‚É‚Č‚č‚Ü‚ˇDDD‚Č‚ń‚Ĺ‚Ĺ‚ľ‚傤
‚â‚Á‚Ď‚č‚Q‚V‚P‚ł‚ń‚ĚŒž‚¤‚Ć‚¨‚č•śŽš—ń”äŠr‚ľ‚Ä‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
277 :
2009/06/21(“ú) 22:54:47
>>276
awk ‚Ěƒo[ƒWƒ‡ƒ“iŽí•Ęj‚Ş•Ş‚Š‚ç‚Č‚˘
‰˝‚đH‚í‚š‚Ä‚é‚Ě‚Š•Ş‚Š‚ç‚Č‚˘
ƒXƒNƒŠƒvƒg‚͈ęs‚ŏ‘‚˘‚Ä‚é‚Ě‚Šƒtƒ@ƒCƒ‹‚É‚ľ‚Ä‚é‚Ě‚Š•Ş‚Š‚ç‚Č‚˘
ˆęs‚ŏ‘‚˘‚Ä‚˘‚é‚Č‚çƒVƒFƒ‹‚ɉ˝‚đŽg‚Á‚Ä‚˘‚é‚Ě‚Š
278 :
2009/06/22(ŒŽ) 00:38:26
•śŽš—ń”äŠr‚ł‚ę‚Ä‚é‚Č‚çˆęŒ…‚Ě‚Ć‚Ť‚ɏăŽč‚­‚˘‚Š‚Č‚˘‚Ć‚˘‚¤‚ć‚č
“ńŒ…‚Ě‚Ć‚Ť‚ž‚ŻăŽč‚­‚˘‚­‚Ć‚˘‚¤Š´‚ś‚Č‚Ě‚Š‚ˁB
WindowsXP‚ĚƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Ĺgawk(3.1.5)Žg‚Á‚ĉş‹L‚đŽŽ‚ľ‚Ä‚Ý‚˝‚Ż‚Ç
‚ť‚ĚŒťŰÄŒť‚Ĺ‚Ť‚Č‚Š‚Á‚˝B
gawk "{if(miso<$1){printf($1)}}" miso=30
279 :
2009/06/22(ŒŽ) 07:43:07
$awk -W version
mawk 1.3.3 Nov 1996, Copyright (C) Michael D. Brennan

compiled limits:
max NF 32767
sprintf buffer 2040
$seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940
‚¤‚Ü‚­“Ž‚˘‚Ä‚˘‚é‚悤‚ž‚ށB
280 :
2009/06/22(ŒŽ) 18:20:09
>>279‚đƒ}ƒl‚ł‚š‚Ä‚ŕ‚ç‚Á‚˝
$ awk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

$ seq 1 40 | awk '{if(miso<$1)printf($1)}' miso=30
31323334353637383940
281 :
2009/06/22(ŒŽ) 19:59:10
miso=30‚Á‚Ä-v•t‚Ż‚Č‚­‚Ä‚˘‚Ż‚é‚ń‚žB‚ľ‚ç‚ń‚Š‚Á‚˝B
282 :
2009/06/23(‰Î) 01:02:55
gawk‚Í
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĹŽw’č‚ł‚ę‚˝ƒtƒ@ƒCƒ‹–ź‚Ş var=val ‚Ć‚˘‚¤Œ`ŽŽ‚Č‚ç‚΁A‚ť‚ę‚͕ϐ”‚Ö‚Ě‘ă“ü‚Ĺ‚ ‚é‚ƉđŽß‚ł‚ę‚Ü‚ˇB•Ď” var ‚Í’l val ‚ɐݒ肳‚ę‚Ü‚ˇ (‚ą‚ę‚́A‚ˇ‚×‚Ä‚Ě BEGIN ƒuƒƒbƒN‚đŽŔs‚ľ‚˝‚ ‚Ć‚És‚í‚ę‚Ü‚ˇ)B


‚â‚Á‚Ď‚č‚ŕ‚ę‚Ě XPƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒgŠÂ‹Ť‚Ĺ‚ŕ
>gawk -W version
GNU Awk 3.1.6
Copyright (C) 1989, 1991-2007 Free Software Foundation.

>seq 1 40 | gawk "{if(miso<$1) print}" miso=30
31
32
33
34
35
36
37
38
39
40

‚Á‚ÄŠú‘Ň’Ę‚č‚Ě“Ž‚Ť‚žYO!
283 :
2009/06/24(…) 00:39:07
ŒĹ’č’ˇ‚ʼnüs‚Č‚ľ‚Ěƒtƒ@ƒCƒ‹i6MB’´j‚đˆ—‚ˇ‚é‚ą‚Ć‚É‚Č‚čA
‘ź‚Ěƒ\ƒtƒg‚މüs‚ ‚č‚ĚŒĹ’č’ˇŁ‚É‚ľ‚Ä‚Š‚çAawk‚ŏˆ—‚ľ‚Ä‚˘‚˝‚Ě‚Ĺ‚ˇ‚ށc

ƒf[ƒ^ƒtƒ@ƒCƒ‹‚É‚ć‚­o‚Ä‚­‚é•śŽš‚đ‚Ć‚č‚ ‚Ś‚¸RS‚ÉŒŠ—§‚Ăēǂݍž‚Ý
¨RS‚ÉŽw’č‚ľ‚˝•śŽš‚đ˜AÚ
¨ŒĹ’č’ˇ‚Ě1s•Ş‚ć‚č’ˇ‚Š‚Á‚˝‚ç‚ť‚Ě•”•Ş‚đŘ‚čo‚ľ

‚ľ‚Ä‚˘‚­‚Ƣ‰üs‚ ‚č‚ĚŒĹ’č’ˇŁA‚Ĺ‚Ť‚ż‚Ⴂ‚Ü‚ľ‚˝B
RS‚ÉŽw’č‚ľ‚˝•śŽš‚Ş‚ľ‚΂炭o‚Ä‚ą‚Č‚Ż‚ę‚Εϐ”ƒpƒ“ƒN‚ľ‚ż‚Ⴄ‚ľA‘ĺ•ŞŠë‚Č‚Á‚Š‚ľ‚˘‚Ě
‚Ĺ‚ˇ‚ށA‚Ć‚č‚ ‚Ś‚¸awk‚Ĺ‚Ĺ‚Ť‚˝‚Ě‚Ş­‚ľ‚¤‚ę‚ľ‚˘B
284 :
2009/06/24(…) 03:25:12
‰üs‚ ‚č‚ĚŒĹ’č’ˇ‚đawk‚Ĺ“Ç‚ń‚ž‚Ě‚Č‚ç
substr($0, start, length) ‚ł΂炚‚ćw
285 :
2009/06/26(‹ŕ) 11:29:46
>>283
>284‚Ý‚˝‚˘‚ȓljđ—Í‚Č‚˘”nŽ­‚Ş—N‚Š‚Č‚˘‚悤‚ɁA”ť‚čˆŐ‚­‘‚Ť‚Ü‚ľ‚傤B
‚[‚ŠA‹ď‘Ě“I‚ČƒR[ƒh‚ŕo‚ł‚¸‚Ɂuawk‚Ĺ‚Ĺ‚Ť‚Ä‚¤‚ę‚ľ‚˘v‚Č‚ń‚Ä‚Ě‚Íƒ`ƒ‰ƒV‚Ě— ‚É‚Ç‚¤‚źB
286 :
2009/06/30(‰Î) 01:27:46
fold ‚Ć‚ŠH
287 :
2009/07/13(ŒŽ) 09:52:52
ł‹K•\Œť‚Ĺ‹ó”’‚Ĺ‹ćŘ‚ç‚ę‚˝ƒeƒLƒXƒg‚đHTML‚Ĺ‚˘‚¤table‚É‚ľ‚˝‚˘‚Ĺ‚ˇB
—áj

10i 2i 8i
000 000 000
001 001 001
002 010 002
003 011 003

ŤŤŤŤŤŤŤ

<table>
<tr><th>10i</th> <th>2i</th> <th>8i</th></tr>
<tr><td>000</td> <td>000</td> <td>000</td></tr>
<tr><td>001</td> <td>001</td> <td>001</td></tr>
<tr><td>002</td> <td>010</td> <td>002</td></tr>
<tr><td>003</td> <td>011</td> <td>003</td></tr>
</table>
288 :
2009/07/13(ŒŽ) 12:07:49
>>287
ł‹K•\Œť‚đŽg‚¤‚Ů‚Ç‚Ě‚ą‚Ć‚Ĺ‚Í‚Č‚˘
ƒRƒA‚Ě•”•Ş‚ž‚Ż‘‚­‚Ć‚ą‚ę‚ž‚Ż
for(i=1;i<=NF;i++) printf("<td>%s</td>", $i)
289 :
2009/07/13(ŒŽ) 16:12:21
ł‹K•\ŒťŽg‚Á‚ă^ƒO‚đŘ‚č‘Ö‚Ś‚˝‚˘‚Ě‚Š‚ȁH
290 :
2009/07/17(‹ŕ) 16:37:34
split ‚â asort ‚ľ‚˝‚ç‚Ç‚¤‚ľ‚Ä“YŽš‚Ş1‚Š‚ç‚É‚Č‚é‚ń‚žI
‚Č‚ń‚Ĺ‚žI
Žd—l‘“Ç‚Ý”ň‚΂ľ‚Ăăf[ƒ^Œ‡—Ž‚ł‚š‚é‚Ć‚ą‚ë‚ž‚Á‚˝(LĽƒÖĽM)

>>287
sed ‚Ĺ‚Ś‚Ś‚â‚ń
291 :
2009/07/17(‹ŕ) 18:35:54
Ą‚Ü‚Ĺawk '{print $3}'’ö“x‚ľ‚ŠŽg‚Á‚Ä–ł‚Š‚Á‚˝‚ށAĹ‹ß‚ą‚ę‚đ“Ç‚ń‚Ĺawk‚đŒŠ’ź‚ľ‚˝B

http://www.eecs.harvard.edu/cs152/lectures/CS152-Lecture_14-Kernighan.pdf
292 :
2009/07/26(“ú) 15:10:31
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
‚ą‚ą‚Ěgawk‚Ĺ>>17‚ĚƒTƒ“ƒvƒ‹‚đŽŽ‚ľ‚˝‚Ş“Ž‚Š‚Č‚Š‚Á‚˝B

gawk: test.awk:4: ’v–˝“I: “üo—Í—p‚Ě‘o•űŒüƒ\ƒPƒbƒg `/inet/tcp/0/www.yahoo.com/80' ‚ŞŠJ‚Ż‚Ü‚š‚ń (No such file or directory)B
293 :
2009/07/27(ŒŽ) 11:13:15
‚ť‚ę‚Í‚ť‚ą‚ĚƒTƒCƒg‚̐l‚ÉŒž‚Ś‚ć
294 :
2009/07/28(‰Î) 00:11:42
‚˘‚‚̂܂ɂŠgawk 3.1.7‚ޏo‚Ä‚˝B
295 :
2009/07/30(–Ř) 11:45:58
Ruby •×‹­’†‚ž‚Ż‚Ç AWK ‚Ě‚Ů‚¤‚ŞŠy‚ľ‚˘‚ş(LĽƒÖĽM)
296 :
2009/08/06(–Ř) 10:22:37
7ŒŽ7“ú¨[[7ŒŽ7“ú|07ŒŽ07“ú]]
7ŒŽ28“ú¨[[7ŒŽ28“ú|07ŒŽ28“ú]]
11ŒŽ3“ú¨[[11ŒŽ3“ú|11ŒŽ3“ú]]
12ŒŽ16“ú¨[[12ŒŽ16“ú|12ŒŽ16“ú]]

‚Ć’u‚ŤŠˇ‚Ś‚˝‚˘‚Ĺ‚ˇB
perl‚Č‚ç‚í‚č‚ĆŠČ’P‚Č‚Ě‚Ĺ‚ˇ‚ށAawk‚ĹŠČ’P‚É‚˘‚Ť‚Ü‚ˇ‚ŠH
ŽŠ•Ş‚Şawk‚Ě‚ą‚Ć‚đ•×‹­•s‘Ť‚ž‚Š‚ç‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ż‚ǁcB
297 :
2009/08/06(–Ř) 10:24:13
ŞŠÔˆá‚˘‚Ü‚ľ‚˝B
7ŒŽ7“ú¨[[7ŒŽ7“ú|07ŒŽ07“ú]]
7ŒŽ28“ú¨[[7ŒŽ28“ú|07ŒŽ28“ú]]
11ŒŽ3“ú¨[[11ŒŽ3“ú|11ŒŽ03“ú]]
12ŒŽ16“ú¨[[12ŒŽ16“ú|12ŒŽ16“ú]]
298 :
2009/08/06(–Ř) 11:03:17
—á‚Ş‚ć‚­‚í‚Š‚ç‚Č‚˘‚ń‚ž‚Ż‚ǁC”Žš1Œ…‚Ě•”•Ş‚đ2Œ…‚É‚ľ‚˝‚˘‚Á‚Ä‚ą‚ƁH
299 :
2009/08/06(–Ř) 11:13:12
{
gsub(/ŒŽ|“ú/," ");
printf("%02dŒŽ%02d“ú\n",$1,$2);
}
‚Ć‚ŠD
ƒtƒB[ƒ‹ƒhƒZƒpƒŒ[ƒ^‚ރfƒtƒHƒ‹ƒg(”źŠpƒXƒy[ƒX)‚Ěę‡‚ˁD
300 :
2009/08/06(–Ř) 11:15:10
>296
Perl‚ĹŠČ’P‚ɏ‘‚Ż‚é‚Č‚çAˆę’UPerlƒR[ƒhŽN‚ľ‚Ä‚­‚ę‚é‚ŠH
‚Ç‚¤‚ŕŽd—l‚Ş‚ć‚­‰đ‚ç‚ń‚Ě‚žc
301 :
2009/08/06(–Ř) 11:54:28
print gensub(/0([0-9])([0-9])/, "\\1\\2", "g", gensub(/([0-9]+)/, "0\\1", "g",
$1))

‰ä‚Č‚Ş‚ç‰˜‚Ë‚Ľ‚Č‚Ÿ(LĽƒÖĽM)
>>299‚Ě•ű‚Ş‚˘‚˘‚Č
302 :
2009/08/06(–Ř) 12:27:22
>>298,300 ’uŠˇ‚ľ‚Č‚˘‚Ĺ•Ď‚Ś‚˝‚˘‚Ć‚ą‚ž‚Żo—Í‚ˇ‚é‚Č‚ç‚ą‚¤‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
#!/usr/bin/perl
while(1){
$line = <STDIN>;
if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú/){
$month = $1; $day = $2;
if($month >= 10) {
if($day >=10){
print "$& -> [[$monthŒŽ$day“ú]]";
}
else {
print "$& -> [[$monthŒŽ$day“ú|$monthŒŽ0$day]]";
}
}
else{
if($day >=10){
print "$& -> [[$monthŒŽ$day“ú|0$monthŒŽ$day]]";
}
else{
print "$& -> [[$monthŒŽ$day“ú|0$monthŒŽ0$day]]";
}
}
}
}
1ŒŽ1“ú - ƒ†[ƒ“ą“ü10Žü”NB
1ŒŽ1“ú -> [[1ŒŽ1“ú|01ŒŽ01]]
12ŒŽ31“ú - ƒjƒ…[ƒˆ[ƒN‚Ěƒ}ƒ“ƒnƒbƒ^ƒ“‹´ŠJ’Ę100Žü”NB
12ŒŽ31“ú -> [[12ŒŽ31“ú]]
8ŒŽ21“ú - ƒnƒƒCBB§50Žü”NB
8ŒŽ21“ú -> [[8ŒŽ21“ú|08ŒŽ21]]
10ŒŽ1“ú - ƒpƒ‰ƒI“Ć—§15Žü”NB
10ŒŽ1“ú -> [[10ŒŽ1“ú|10ŒŽ01]]
303 :
2009/08/06(–Ř) 14:16:23
‚Č‚ń‚Š‘f’ź‚ÉPerl‚Ĺ‚â‚Á‚˝‚Ů‚¤‚ŞŠy‚ť‚¤‚ž‚Č‚ A‚ť‚ęB
‚ż‚Ȃ݂ɁA‚ť‚ĚƒR[ƒh‚ś‚á–łŒŔƒ‹[ƒv‚ˇ‚é‚źB
#!/usr/bin/perl
while($line = <STDIN>) {
    if($line =~ /(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú/) {
        $month = $1; $day = $2;
        if($month < 10 || $day < 10) {
            printf "%s -> [[%dŒŽ%d“ú|%02dŒŽ%02d]]\n", $&, $month, $day, $month, $day;
        }
        else {
            print "$& -> [[$monthŒŽ$day“ú]]\n";
        }
    }
}
304 :
2009/08/06(–Ř) 14:44:03
‚ž‚ß‚žcƒR[ƒh‚ĚˆÓ–Ą‚Í•Ş‚Š‚é‚ŞCŽd—l‚Ş—Ç‚­•Ş‚Š‚ç‚ńD
305 :
2009/08/06(–Ř) 14:47:14
7ŒŽ7“ú
‚Ć‚˘‚¤•śŽš—ń‚đ
[[7ŒŽ7“ú|07ŒŽ07“ú]]
‚Ć’u‚ŤŠˇ‚Ś‚éA‚Á‚Ä‚ą‚Ć‚Ĺ‚ľ‚ĺB
‚Č‚ń‚Ĺ•Ş‚Š‚ç‚ń‚Š‚Č‚ŸB‚ť‚Á‚ż‚Ě‚Ş•Ş‚Š‚ç‚ńB
306 :
2009/08/06(–Ř) 14:53:30
“ü—Í‚Ş07ŒŽ07“ú‚ž‚Á‚˝‚çC
o—Í‚Í[[07ŒŽ07“ú|07ŒŽ07“ú]]‚É‚Č‚é‚ć‚ˁH‚ą‚ę‚ÍOK?
‚ť‚ŕ‚ť‚ŕC‚ť‚¤‚˘‚¤“ü—Í‚Í‹N‚ą‚č‚Ś‚Č‚˘‚́H
307 :
2009/08/06(–Ř) 18:17:38
>>305
‚ť‚ń‚ČŠ´‚ś‚Ĺ‚ˇB
–Ú“I‚đŒž‚Á‚Ä‚˘‚Č‚˘‚̂ŁA‰˝‚Ş‚â‚č‚˝‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ç‚Č‚˘‚Ě‚ž‚ĆŽv‚˘‚Ü‚ˇB
‘‚˘˜bAWiki‚Ě‹L–@‚đŽg‚Á‚ăŠƒ“ƒN‚đ’Ł‚č‚˝‚˘‚Ě‚Ĺ‚ˇB
0‚đ‚­‚í‚Ś‚ÄŒ…‚𒲐Ž‚ľ‚Ä‚˘‚闝—R‚Í
•śŽš—ń‚Ć‚ľ‚ă\[ƒg‚ľ‚Đł‚ľ‚­¸‡‚É•Ŕ‚Ԃ悤‚É‚ˇ‚é‚˝‚ß‚Ĺ‚ˇB—á‚Ś‚ÎWikipedia‚Č‚ç
7ŒŽ7“ú‚Ě‚Ć‚Ť‚́A[[7ŒŽ7“ú|07ŒŽ07“ú]]‚Ć‚ˇ‚é‚ą‚Ć‚Ĺ
ƒŠƒ“ƒN‚Íhttp://ja.wikipedia.org/wiki/7ŒŽ7“ú
•\ŽŚ‚ł‚ę‚é•śŽš—ń‚Í 07ŒŽ07“ú@
‚Ć‚Č‚č‚Ü‚ˇB
‚ą‚ę‚đƒ\[ƒg‚Ĺ‚Ť‚éƒe[ƒuƒ‹‚Ě—v‘f‚É‚ľ‚Ü‚ˇBŽQl‚Ü‚Ĺ‚É
http://ja.wikipedia.org/wiki/Help:%E8%A1%A8%E3%81%AE%E4%BD%9C%E3%82%8A%E6%96%B9#.E5.86.8D.E6.95.B4.E5.88.97.E5.8F.AF.E8.83.BD.E3.81.AA.E8.A1.A8
‚ą‚̏ˆ—‚Íawk‚Ĺ‚ŕ‰Â”\‚Č‚ą‚Ƃ͉”\‚ž‚Á‚˝‚ń‚Ĺ‚ˇ‚ށA–ł’m‚Č‚š‚˘‚Š
‚¨‚ť‚ë‚ľ‚­•sŠiD‚É‚Č‚č‚Ü‚ľ‚˝B

>>306
‚ť‚ęŽv‚˘‚Ü‚ľ‚˝B‚Ĺ‚Ť‚ę‚Î
07ŒŽ07“ú->[[7ŒŽ7“ú|07ŒŽ07“ú]]
‚̂悤‚ɏˆ—‚ľ‚˝‚˘‚Ĺ‚ˇB
308 :
2009/08/06(–Ř) 18:26:07
>>303
‚ť‚ę‚Ĺ‚ˇB‚ť‚¤‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
309 :
2009/08/06(–Ř) 21:17:06
# gawk ‚É‚ć‚é match ŠÖ”‚ĚŠg’Ł‚đŽg‚Á‚Ä‚˘‚é.
# ˆęs‚É•Ą”‰ńŒť‚ę‚˝ę‡‚Í–łŽ‹.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ú|%02dŒŽ%02d“ú]]", $0, a[2], a[1], a[2], a[1]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ú]]", $0, a[2], a[1]));
        }
    }
    print $0;
}
310 :
2009/08/06(–Ř) 21:21:15
# ’ůł.

BEGIN {
    F = "(0?[1-9]|1[0-2])ŒŽ(0?[1-9]|[1-2][0-9]|3[01])“ú";
}

{
    if ($0 ~ F) {
        match($0, F, a);
        if (a[1]+0 < 10 || a[2]+0 < 10) {
            sub(a[0], sprintf("[[%dŒŽ%d“ú|%02dŒŽ%02d“ú]]", a[1], a[2], a[1], a[2]));
        } else {
            sub(a[0], sprintf("[[%dŒŽ%d“ú]]", a[1], a[2]));
        }
    }
    print $0;
}
311 :
2009/08/06(–Ř) 23:59:03
>>310 ŠŽŕř‚Ĺ‚ˇBĄ“x‚Š‚ç‚ą‚ę‚đŽg‚˘‚Ü‚ˇ—L“‚˛‚´‚˘‚Ü‚ľ‚˝B

$ cat test.txt
1ŒŽ1“ú #mŒŽd“ú
01ŒŽ1“ú #0mŒŽd“ú
1ŒŽ01“ú #mŒŽ0d“ú
01ŒŽ01“ú #0mŒŽ0d“ú

2ŒŽ10“ú #mŒŽdd“ú
02ŒŽ10“ú #0mŒŽdd“ú

11ŒŽ3“ú #mmŒŽd“ú
11ŒŽ03“ú #mmŒŽ0d“ú

12ŒŽ16“ú #mmŒŽdd“ú

$ awk -f test.awk test.txt
[[1ŒŽ1“ú|01ŒŽ01“ú]] #mŒŽd“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #0mŒŽd“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #mŒŽ0d“ú
[[1ŒŽ1“ú|01ŒŽ01“ú]] #0mŒŽ0d“ú

[[2ŒŽ10“ú|02ŒŽ10“ú]] #mŒŽdd“ú
[[2ŒŽ10“ú|02ŒŽ10“ú]] #0mŒŽdd“ú

[[11ŒŽ3“ú|11ŒŽ03“ú]] #mmŒŽd“ú
[[11ŒŽ3“ú|11ŒŽ03“ú]] #mmŒŽ0d“ú

[[12ŒŽ16“ú]] #mmŒŽdd“ú
312 :
2009/08/07(‹ŕ) 06:34:47
Ĺ‰‚É‚ť‚¤‚˘‚¤ƒeƒXƒgƒoƒ^[ƒ“‚đo‚ť‚¤‚Ë
313 :
2009/08/07(‹ŕ) 11:45:35
‚ą‚ą‚̏Zl‚ރR[ƒfƒBƒ“ƒOD‚Ť‚ž‚Š‚ç‚Á‚ÄŠĂ‚Ś‚â‚Ş‚Á‚Ä(LĽƒÖĽM)

> perl‚Č‚ç‚í‚č‚ĆŠČ’P‚Č‚Ě‚Ĺ‚ˇ‚ށAawk‚ĹŠČ’P‚É‚˘‚Ť‚Ü‚ˇ‚ŠH
‚Á‚ÄŒž‚Á‚Ä‚é‚ń‚ž‚Š‚çAu‚˘‚Ť‚Ü‚ˇv‚Á‚Ä“š‚Ś‚č‚Ⴂ‚˘‚ń‚ž‚ć‚Č
314 :
2009/08/07(‹ŕ) 11:46:39
>>312
‚Č‚É‚ť‚ĚŽ€‚̍si‚ą‚킢
315 :
2009/08/15(“y) 11:36:30
ƒoƒ^[ƒ“@ƒeƒXƒg‚ĚƒfƒXƒ}[ƒ`
316 :
2009/08/16(“ú) 09:46:09
>>294
3.1.7ƒx[ƒX‚ĚWindows—pƒoƒCƒiƒŠAo‚Ü‚ľ‚˝B
ttp://www.kt.rim.or.jp/%7Ekbk/gawk-3.1/index.html#GAWK-DOWNLOAD
317 :
2009/08/17(ŒŽ) 17:45:07
ŽŠ“ŽÄl š@@ŽŠ“Ž•ŰŽç ŸKAWORUKOFI@@ŽŠ“Ž•ŰŽç#K9K?_D[L

–źŒžW@‚ť‚Ě‚R
w‚˘‚‚ŕƒTƒ{‚Á‚Ă΂Š‚č‚ĚƒLƒƒƒbƒv‚ރEƒ[‚Śx

http://yutori7.2ch.net/test/read.cgi/news4vip/1249830540/@ID:PVAf+dux0@@ŽŠ“ŽÄl š
> 71 FˆČ‰şA–ź–ł‚ľ‚É‚Š‚í‚č‚Ü‚ľ‚ÄVIP‚Ş‚¨‘—‚č‚ľ‚Ü‚ˇ [sage] F2009/08/10(ŒŽ) 00:58:57.28 ID:PVAf+dux0
> >>69
> ‘ĺ•Ď‚Á‚ÄŒž‚¤‚Š
> –ˆ“úA•ń‚ł‚ę‚˝‚Ě‚đŒŠ‚ÄA”ť’f‚ľ‚āAˆ—‚ľ‚āAŠŽ—š•ń‚ľ‚āAˆČ‰şƒ‹[ƒvB
> ‚ż‚ĺ‚Á‚Ć‚Ĺ‚ŕƒ~ƒX‚ˇ‚é‚ƁA•’i‚͍ě‹Ć‚ŕ‚ľ‚Ä‚Č‚˘ƒLƒƒƒbƒv‚ł‚ń‚˝‚ż‚Ş‚ł‚ń‚´‚ń•ś‹ĺŒž‚Á‚Ä‚Ť‚Ä
> ‚ť‚ĚŒž‚˘‚í‚Ż‚đl‚Ś‚Č‚˘‚ƁAƒLƒƒƒbƒv‚Í‚­’D‚ł‚ę‚˝‚čƒAƒJƒEƒ“ƒg“€Œ‹‚ł‚ę‚˝‚股‚é‚Š‚ç
>
> “o˜^‚ł‚ę‚Ä‚Š‚çˆę”NˆČăŒo‚Á‚āA‚â‚Á‚Ć‚˘‚˘‚˝‚˘‚ą‚ĆŒž‚Ś‚é‚悤‚É‚Č‚Á‚Ä‚Ť‚˝‚ćB



----------------------------------------------
‚ą‚ĚŽŠ“ŽÄl šƒ[ƒ‹ƒ}ƒKƒWƒ“‚Ě”zM’âŽ~‚đ‚˛Šó–]‚ł‚ę‚é•ű‚Í
http://qb5.2ch.net/test/read.cgi/sec2chd/1250169591/
‚É‚ÄŽŠ“ŽÄl š‚Ü‚Ĺ‚˛˜A—‚­‚ž‚ł‚˘
318 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/10/24(“y) 17:23:04
ĹŒă‚Ě10s‚đˆ—‚ľ‚˝‚­‚Č‚˘ę‡A‚Ç‚¤‘‚Ż‚Ηǂ˘‚Ĺ‚ľ‚傤‚ŠH
319 :
2009/10/24(“y) 18:19:03
ĹŒă‚Ü‚Ĺ“Ç‚Ü‚¸‚ÉĹŒă‚Ě10s‚Š‚Ç‚¤‚Š”ť’股‚é•ű–@‚Í–ł‚˘‚ž‚낤‚Č
ˆ—‘ÎŰ‚Şƒtƒ@ƒCƒ‹‚Č‚çAŽ–‘O‚Éwc -l‚Š‰˝‚Š‚ōs”’˛‚×‚Ä awk ‚É“n‚ľ‚Ä‚Ý‚Ä‚Í
320 :
2009/10/24(“y) 18:52:07
Ź‚é’öA‚ą‚ęA‚Ć‚˘‚¤•ű–@‚Í–ł‚ł‚ť‚¤‚Ĺ‚ˇ‚Ë
‚ż‚ĺ‚Á‚ƍl‚Ś‚Č‚Ş‚ç‚â‚Á‚Ä‚Ý‚Ü‚ˇ
321 :
2009/10/24(“y) 19:15:52
‚Ć‚č‚ ‚Ś‚¸A‚ą‚ń‚ČŠ´‚ś‚É‚ľ‚Ü‚ľ‚˝
BEGIN {
SKIPTAILS = 10
}
{
line = buf[1]
for(i=1;i<SKIPTAILS;i++) buf[i] = buf[i+1]
buf[SKIPTAILS] = $0
}
NR > SKIPTAILS {
# line‚đˆ—
}
322 :
2009/10/24(“y) 22:11:41
>>321 l‚Ś•ű‚Í“Ż‚ś‚ž‚Ż‚ǁAfor‚Ş‹C‚É‚Č‚Á‚˝‚Ě‚Ĺ
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ŏˆ—‚ˇ‚é‚悤‚É‚ľ‚Ä‚Ý‚˝B

BEGIN {
@@SKIPTAILS = 10
@@ringpos = SKIPTAILS
}
{
@@ringpos = (ringpos + 1) % SKIPTAILS
@@line = buf[ringpos]
@@buf[ringpos] = $0
}
NR > SKIPTAILS {
@@# line‚đˆ—
}
323 :
2009/10/24(“y) 23:18:06
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
ƒŠƒ“ƒOƒoƒbƒtƒ@A•×‹­‚É‚Č‚č‚Ü‚ľ‚˝
Žg‚í‚š‚Ä’¸‚Ť‚Ü‚ˇ
324 :
2009/11/19(–Ř) 20:22:22
>>42
sed awk ‚ľ‚Ä‘DŽR‚É“o‚é@‚ž‚ëH
325 :
2009/11/23(ŒŽ) 12:06:14
Žż–â‚Ĺ‚ˇ
gawk‚Ĺ
{
printf("%d,%s\n", NR, $0 ) > FILENAME;
}
‚Ć‚˘‚¤s“ނɔԍ†‚đU‚Á‚Ä•Ű‘ś‚ˇ‚鏈—‚đ‚ľ‚Ä

batƒtƒ@ƒCƒ‹‚ĹˆęŠ‡ˆ—‚ł‚š‚悤‚Ć‚ľ‚˝‚ń‚Ĺ‚ˇ‚Ş
c:\windows\gawk\gawk -f g:\ě‹Ć—p\n.awk g:\ě‹Ć—p\*.txt

ŽŔsŒ‹‰Ę‚Ş
ƒtƒ@ƒCƒ‹1@@ƒtƒ@ƒCƒ‹2
1‚`@@@@@@4‚c@@
2‚a@@@@@@5‚d@
3‚b@@@@@@6‚e
‚É‚Č‚č‚Ü‚ˇ

ƒtƒ@ƒCƒ‹2‚ŕ
1‚c
2‚d
3‚e
‚É‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
326 :
2009/11/23(ŒŽ) 12:27:22
FNR
327 :
2009/11/23(ŒŽ) 12:35:21
>>326
‚¨‚¨Ao—ˆ‚˝I
v‘Ź‚ȉń“š‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇ
328 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2009/12/21(ŒŽ) 13:53:34
”N––‚Ƀpƒ\ƒRƒ“‚đ”ƒ‚˘Šˇ‚Ś‚悤‚ĆŽv‚Á‚Ä‹@Ží‘I‚Ń‚đ‚ľ‚Ä‚˘‚Ä‚Ó‚Ć‹C‚Ă‚˘‚˝A
‚ ‚ęAvaio‚ĚOS‚ŞWindows7 64bitƒo[ƒWƒ‡ƒ“‚ɁEEE
ƒ_ƒ‚ś‚á‚ńIgawk‚ŞŽg‚Ś‚Č‚­‚Č‚Á‚Ä‚ľ‚Ü‚¤EEE
‚¤[‚ńAAA‚Ü‚˝XP‚đ”ƒ‚¤‚ׂŤ‚ŠEEE”Y‚ށEEE
329 :
2009/12/21(ŒŽ) 14:21:01
>>328
ŽŠ•Ş‚ĹƒRƒ“ƒpƒCƒ‹‚ľ’ź‚š‚΂˘‚˘‚ž‚Ż‚ś‚á‚Č‚˘‚́H
330 :
2010/01/14(–Ř) 03:52:20
ƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWK•œŠ§‚ž‚Á‚ĂˁB
ttp://slashdot.jp/developers/article.pl?sid=10/01/06/0345207

‘˝•Ş•K—vŤ‚đŠ´‚ś‚Č‚˘’ö“x‚É‚ÍŽg‚Á‚Ä‚é‚Š‚çA”ƒ‚í‚Č‚˘‚Ż‚ÇŠđ‚ľ‚˘B
•z‹ł—p‚É”ƒ‚¤‚Á‚Ä‚Ě‚ŕ‚ż‚ĺ‚Á‚ƂȁB

331 :
2010/02/28(“ú) 11:08:56
AAA BBB CCC c -O ZZZ YYY XXX c

awkVŽQ‚Ĺ‚ˇB
-O(ƒIƒvƒVƒ‡ƒ“)‚đŒŸő‚ľA
-O‚Ć‚ť‚ęˆČ~‚đƒŠƒ_ƒCƒŒƒNƒg‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށc
—Ç‚˘•ű–@A‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š
332 :
2010/02/28(“ú) 15:36:31
ƒŠƒ_ƒCƒŒƒNƒg‚Á‚Ä‚Ç‚¤‚˘‚¤ˆÓ–Ą‚ĹŽg‚Á‚Ä‚é?

‚ť‚Ě AAA ‚ĹŽn‚Ü‚é•śŽš—ń‚ŕˆę‘Ě‚Ç‚¤‚˘‚¤‚ŕ‚̂Ȃ́B
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Č‚Ě‚ŠAƒtƒ@ƒCƒ‹‚Š‚ç“ǂݍž‚ń‚Ĺ‚­‚é‚Ě‚Ć‚ŠB

—pŒę‚Ćó‹ľ‚Í‚Ť‚ż‚ń‚Ə‘‚˘‚Ä‚­‚ęB
333 :
2010/02/28(“ú) 16:19:07
D:\My Documents\gawk\331>type 331.txt
AAA BBB CCC c -O ZZZ YYY XXX 0c
AAA BBB CCC c -O ZZZ YYY XXX 1c
AAA BBB CCC c -O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>type 331.awk
{match($0, " -O .*", a);
print a[0];}

D:\My Documents\gawk\331>gawk -f 331.awk 331.txt >a.txt

D:\My Documents\gawk\331>type a.txt
-O ZZZ YYY XXX 0c
-O ZZZ YYY XXX 1c
-O ZZZ YYY XXX 2c

D:\My Documents\gawk\331>
334 :
2010/02/28(“ú) 18:43:32
ƒŒƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>332‚ˇ‚Ý‚Ü‚š‚ńB‘‚Ť’ź‚ľ‚Ü‚ˇB
AAA BBB CCC c -O ZZZ YYY XXX c
‚Ə‘•Ą”s‘‚Š‚ę‚˝ƒtƒ@ƒCƒ‹‚Ş‚ ‚čA
u-OvˆČ~‚Ě•śŽš—ń‚đ•Ęƒtƒ@ƒCƒ‹‚É•Ű‘ś‚ˇ‚é
‚Á‚Ä‚ą‚Ć‚đ‚ľ‚˝‚Š‚Á‚˝‚Ě‚Ĺ‚ˇB

>>333
ƒGƒXƒp[‚Č•ś‚ž‚Á‚˝‚Ě‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‘z’č‚ľ‚Ä‚˝‚Ě‚Í‚ť‚ń‚ČŠ´‚ś‚Ĺ‚ˇB
‚˝‚žˆČ‰ş‚ĚƒGƒ‰[‚ޏo‚ďăŽč‚­‚˘‚Ť‚Ü‚š‚ńc

gawk: 331.awk:2: fatal: match() cannot have 3 arguments

matchŽg‚Á‚Ä‚é‚Ě‚Éa‚Ć‚˘‚¤3‚Â–Ú‚Ěˆř”‚đŽg‚Á‚Ä‚é‚Š‚çc‚Á‚Ä‚ą‚Ć‚Ĺ‚ľ‚傤‚ŠcH
335 :
2010/02/28(“ú) 19:00:04
Q: make spits out errors like Makefile.awk:256: fatal: match() cannot have 3 arguments

A: Your AWK is too old to recreate the Makefile. The build is done based on the distributed Makefile. Everything shall compile successfully though.
So if the compile succeeds just ignore such errors, please.
336 :
2010/02/28(“ú) 19:22:38
{print substr($0, match($0, " -O .*")+1);}
337 :
2010/02/28(“ú) 20:03:12
>>336
o—ˆ‚Ü‚ľ‚˝B‚Ü‚ł‚Š–{“ú’†‚É‰đŒˆ‚Ĺ‚Ť‚é‚Ć‚ÍŽv‚˘‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB‘ĺ•Ď•×‹­‚É‚Č‚č‚Ü‚ľ‚˝B
338 :
2010/02/28(“ú) 22:25:50
ÎŢż@–{“–‚ɕ׋­‚É‚Č‚Á‚˝‚Š‚Ç‚¤‚Š‚Í‹^–â‚žĽĽĽ
@‚¨‚Á‚ĆˆęŒžƒIƒE‚Š‚Á‚˝‚ŠB
339 :
2010/03/04(–Ř) 15:04:38
gsub()‚Ć‚Š‚Ĺˆř”‚ɕϐ”‚đ—˜—p‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
gsub(str1,str2)‚Ý‚˝‚˘‚ɁB
340 :
2010/03/04(–Ř) 21:44:52
>>339
man gawk‚ć‚č
gsub(r, s [, t])
For each substring matching the regular expression r in the string t,
substitute the string s, and return the number of substitutions.
If t is not supplied, use $0. An & in the replacement text is
replaced with the text that was actually matched. Use \& to get a
literal &. (This must be typed as "\\&"; see GAWK: Effective AWK
Programming for a fuller discussion of the rules for &'s and
backslashes in the replacement text of sub(), gsub(), and gen sub().)
341 :
2010/03/08(ŒŽ) 21:36:03
awk 'BEGIN{x="ABCDE";y="BCD";z="XXX";gsub(y,z,x);print x}'

‰˝‚Ş“ď‚ľ‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ç‚ńB
342 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/03/17(…) 22:07:37
ŽžXawk‚ž‚Ć’x‚˘‚Ě‚Ĺperl‚ɏ‘‚ŤŠˇ‚Ś‚é‚Ć‚˘‚¤l‚Ş‚˘‚Ü‚ˇ‚ށA
ŽŔŰ‚Ě‚Ć‚ą‚ë‘Ź‚­‚Č‚é‚ń‚Ĺ‚ľ‚傤‚ŠH
Ž„‚̊‹Ť‚Ĺ‚Íforƒ‹[ƒv‚â‰ÁŽZ‚Č‚Ç‚Íawk‚Ě‚Ů‚¤‚Ş‘Ź‚ť‚¤‚Ĺ‚ˇ‚ށA
‚ǂ̂悤‚ȏˆ—‚Ěę‡‚Éperl‚Ě‚Ů‚¤‚Ş‘Ź‚­‚Č‚č‚Ü‚ˇ‚ŠH

$ time mawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};printf("%f\n" ,x)}'
500000500000.000000

real 0m0.131s
user 0m0.120s
sys 0m0.000s
$ time gawk 'BEGIN{x=0;for(i=1;i<=1000000;i++){x=x+i};print x}'
500000500000

real 0m0.289s
user 0m0.284s
sys 0m0.000s
$ time perl -e '$x=0;for($i=1;$i<=1000000;$i++){$x=$x+$i};print $x'
500000500000
real 0m0.379s
user 0m0.376s
sys 0m0.004s
343 :
2010/03/17(…) 22:26:14
>>342
uawk‚ž‚Ć’x‚˘‚Ě‚Ĺperl‚ɏ‘‚ŤŠˇ‚Ś‚é‚Ć‚˘‚¤lv ‚É•ˇ‚Ż‚ΕނŠ‚é
344 :
2010/03/19(‹ŕ) 09:08:06
>>342
’x‚˘‚Ć‚˘‚¤awk‚Ígawk‚Č‚Ě?
‘f‚Ěawk‚ć‚čgawk‚Ě•ű‚Ş‘‚­‚Č‚Š‚Á‚˝‚Á‚ŻH
345 :
2010/03/20(“y) 01:03:01
ƒJ[ƒjƒnƒ“‚ĆƒpƒCƒN‚́wƒvƒƒOƒ‰ƒ~ƒ“ƒOě–@x‚Éawk‚Ćperl
i‚ĆC‚ĆC++‚ĆJAVAj‚Ě”äŠr‚Ş‚ ‚é‚Č

Ą‚Ěƒ}ƒVƒ“Žg‚Á‚ď‘‚ŤŠˇ‚Ś‚Č‚Ť‚á‚Č‚ç‚Č‚˘‚Ů‚Ç’x‚˘‚Á‚Ä
‚Ç‚ń‚ȏˆ—‚Č‚ń‚ž‚낤H
346 :
2010/03/21(“ú) 13:44:10
>342
awk “™‚đ‘g‚ݍ‡‚í‚š‚ÄŽŔs‚ˇ‚é‚ĆƒvƒƒZƒX‹N“Ž‚ĚƒRƒXƒg‚Ş‚Š‚Š‚é‚Ě‚Ĺ perl ‚Ĺˆę‚‚ɓZ‚ß‚éA‚Ć‚˘‚¤˜b‚ś‚á‚Č‚˘‚́H
347 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/03/22(ŒŽ) 17:35:11
•śŽšƒR[ƒh‚ĚƒR[ƒh‚đ•Ď”‚É‚ľ‚Ä•śŽš—ń‚đ‘€ě‚ˇ‚é‚ą‚Ć‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
•śŽš—ń’†‚Ě‘SŠp•śŽš‚𔟊p•śŽš‚É•Ď‚Ś‚é‰Ř—í‚Č•ű–@‚đ–͍ő‚ľ‚Ä‚˘‚Ü‚ˇB
348 :
2010/03/22(ŒŽ) 18:01:58
Use iconv.
349 :
2010/03/22(ŒŽ) 18:25:10
> •śŽšƒR[ƒh‚ĚƒR[ƒh‚đ•Ď”‚É‚ľ‚Ä•śŽš—ń‚đ‘€ě‚ˇ‚é‚ą‚Ć‚Á‚Ä‚Ĺ‚Ť‚Ü‚ˇ‚ŠH

‚Č‚É‚đ‚ľ‚˝‚˘‚Ě‚Š‚ć‚­‚í‚Š‚ń‚Č‚˘‚ń‚ž‚Ż‚ǁB

> •śŽš—ń’†‚Ě‘SŠp•śŽš‚𔟊p•śŽš‚É•Ď‚Ś‚é‰Ř—í‚Č•ű–@‚đ–͍ő‚ľ‚Ä‚˘‚Ü‚ˇB

‰Ř—í‚Č‚Ě‚ÍtrƒRƒ}ƒ“ƒh‚đŽg‚¤•ű–@B‚˝‚žtr‚ރ}ƒ‹ƒ`ƒoƒCƒg‚đ‚¤‚Ü‚­ˆľ‚Á‚Ä‚­‚ę‚é‚Š
‚Ç‚¤‚Š‚Í‚ą‚ą‚ë‚ŕ‚Ć‚Č‚˘B
Perl‚Č‚çtr‚đARuby‚Č‚ç•śŽš—ńƒNƒ‰ƒX‚Ětrƒƒ\ƒbƒh‚đA
Python‚Č‚çstringƒ‚ƒWƒ…[ƒ‹‚ĚmaketransŠÖ”‚Ć•śŽš—ń‚Ěƒƒ\ƒbƒhtranslete‚đŽg‚¤A
‚Ć‚˘‚¤Žč‚Ş‚ ‚éB
awk‚Č‚˘‚ľitrˆČŠO‚́jŒĂ“T“I‚Čƒc[ƒ‹‚ʼnؗí‚É‚â‚é•ű–@‚Í‚Č‚˘‚ĆŽv‚¤B
350 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/03/24(…) 17:11:16
Excel‚Ĺ
‘SŠp”źŠp•ĎŠˇ‚Í ASC()
”źŠp‘SŠp•ĎŠˇ‚Í JIS()
351 :
2010/03/25(–Ř) 08:34:11
>>347
1. EUC-JP‚É‚ľ‚Ä(nkf‚Ć‚Š)kakasi ‚ŁA–ß‚ˇ
2. ‚ť‚ę‚ž‚Á‚˝‚çĹ‰‚Š‚çAnkf -Z
3. gawk‘O’ń‚ŁA•śŽš–ˆ‚ɏˆ—(LANG‚đŽw’č‚ľ‚ÄŽqƒvƒƒZƒX‹N“Ž)

awk‚Ě’†‚ŕ‚ś‚Ä‚â‚é‚Ě‚Í‚ß‚ń‚Ç‚­‚ł‚ť‚¤
352 :
2010/03/29(ŒŽ) 23:34:27
gawk 3.1.6
system(cmd) ‚đŽg‚¤‚ƁAƒAƒ“ƒ`ƒEƒBƒ‹ƒXƒ\ƒtƒg(kaspersky)‚Ě
ƒAƒvƒŠƒP[ƒVƒ‡ƒ“—š—đ‚Ƀoƒbƒ`ƒtƒ@ƒCƒ‹‚Ş“o˜^‚ł‚ę‚é‚Ě‚đ”­ŒŠB
close(cmd) ‚ľ‚Ä‚ŕ“Ż‚śB

while(cmd|getline>0){}
‚Ĺ‘ă—p‚ˇ‚é‚ĆŽc‚ç‚Č‚­‚Č‚Á‚˝B??
353 :
2010/05/13(–Ř) 00:22:57
•§‚Ĺƒuƒ‹ƒJ”Ű’č‚ĚŒˆ‹cĚ‘đ@u‘‚̉ż’lŠĎ‚Ć‘Š—e‚ę‚Č‚˘v
http://www.cnn.co.jp/world/AIC201005120004.html

ƒeƒwƒ‰ƒ“‚ŁAƒuƒ‹ƒJ‚đ’…‚Ä“üo‘‚ˇ‚鎞‚Á‚āAŠç‚Ěƒ`ƒFƒbƒN‚Ç‚¤‚ˇ‚é‚ń‚ž‚낤B
‘źl‚â’j‚Ĺ‚ŕ‚΂ę‚Č‚˘‚́H
354 :
2010/05/13(–Ř) 00:23:49
>>353
Œë”šƒXƒ}ƒ“
355 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/05/14(‹ŕ) 13:38:24
356 :
2010/05/18(‰Î) 10:51:40
awk‚Ěprint‚ɂ‚˘‚Ä‚˛‹łŽŚ‰ş‚ł‚˘B

‰ş‚̂悤‚ȏo—Í‚Ş—L‚Á‚˝ę‡A—á‚Ś‚Î
lrwxrwxrwx 1 root root 70 May 18 10:37 hoge

ls -al | awk '{print$1$2$2$4$6$7$8$9}' ‚Ć‚ˇ‚ę‚΁u$5v‚Ě
u70v‚𔲂­‚ą‚Ć‚Şo—ˆ‚Ü‚ˇ‚ށA‚ą‚ę‚Ş$100‚Ć‚Š‚Ü‚Ĺ‘ą‚­ę‡A
u$5v‚ž‚Ż‚𔲂Ť‚˝‚˘ę‡‹Lq‚Ş‘ĺ•Ď‚É‚Č‚č‚Ü‚ˇB

‰˝‚Š—Ç‚˘•ű–@‚Í–ł‚˘‚ŕ‚Ě‚Ĺ‚ľ‚傤‚ŠH
357 :
2010/05/18(‰Î) 11:01:32
$n‚É‘ă“ü‚Ş‚ ‚é‚ƁA‚ť‚ĚŽž“_‚Ĺ$0‚ލč\Ź‚ł‚ę‚éB

‹ćŘ‚č‚Ě‹ó”’‚Ş$5‚Ě‚ ‚Á‚˝‚Ć‚ą‚ë‚ž‚Ż2ŒÂ‚É‚Č‚é‚Ě‚Ş‹C‚É‚Č‚ç‚Č‚Ż‚ę‚΁A
ls -al | awk '{$5 = ""; print}'
‚Ć‚ˇ‚ę‚΂悢B

‹ó”’2ŒÂ‚đCł‚ˇ‚é‚Č‚ç‚ą‚¤‚ˇ‚éB
ls -al | awk '{$5 = ""; print $0}' | awk '{$1 = $1; print}'
358 :
2010/05/18(‰Î) 11:03:15
$0 ‚Í—]Œv‚ž‚Á‚˝B
ls -al | awk '{$5 = ""; print}' | awk '{$1 = $1; print}'
359 :
2010/05/18(‰Î) 11:07:03
2‚‚߂Ěawk‚Ě$1 = $1‚͉˝‚Ě‚˝‚ß?
360 :
2010/05/18(‰Î) 11:34:06
‚Č‚É‚ŕ‚ľ‚Č‚˘‚ƁA$0‚͓ǂݍž‚ń‚ž‚ť‚Ě‚Ü‚Ü‚Č‚Ě‚Ĺ‹ó”’2ŒÂ‚Í‹ó”’2ŒÂ‚̂܂܁B
$1=$1‚Ĺ‘ă“ü‚ľ‚Ä‚â‚é‚ƁA$1, $2, ...‚đ‹ó”’1ŒÂ‚ł‚Ȃ˘‚ž‚ŕ‚Ě‚Ş$0‚É‘ă“ü‚ł‚ę‚é‚̂ŁA
‹ó”’2ŒÂ‚ž‚Á‚˝‚Ć‚ą‚ë‚Ş‹ó”’1ŒÂ‚É‚Č‚éB
361 :
2010/05/18(‰Î) 11:35:04
2‚‚߂Ěawk‚ɐH‚í‚š‚˝Žž“_‚Ĺ$n (n>0)‚Í‹l‚Ü‚é‚Ż‚Ç$0‚Í“ü—͍s‚ť‚Ě‚Ü‚Ü
‹ó”’2ŒÂ‚Č‚Ě‚Ĺ$0‚đÄ\Ź‚ˇ‚é‚Ć‹ó”’1ŒÂ‹ćŘ‚č‚É‚Č‚é
362 :
2010/05/18(‰Î) 12:21:12
>>357-358
”ńí‚ɉđ‚č‚₡‚˘‚˛ŕ–žA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚Č‚é‚Ů‚Ç‘ă“ü‚ˇ‚é‚ą‚Ć‚Ĺ‰đŒˆ‚ˇ‚é‚ń‚Ĺ‚ˇ‚ˁB
•×‹­‚É‚Č‚č‚Ü‚ľ‚˝B
363 :
2010/05/18(‰Î) 15:08:38
$1 = $1 ‚Á‚ăCƒ}ƒCƒ`‚ć‚­‰đ‚ç‚ń

$1‚Á‚ÄFS‚Ĺ‹ćŘ‚ç‚ę‚˝ˆę‚–ڂž‚ć‚ˁH
‚Č‚ń‚Ĺ‚ť‚ꎊg‚đŽŠ•Ş‚É‘ă“ü‚ľ‚˝‚çƒXƒy[ƒX‚ޏÁ‚Ś‚é‚ńH
364 :
2010/05/18(‰Î) 15:27:35
$0‚̍č\Ź‚ލs‚í‚ę‚é‚Š‚ç‚Á‚Äŕ–ž‚ł‚ę‚Ä‚é‚ž‚ëB

$0‚̍č\Ź‚Ć‚Í‚˘‚Á‚˝‚ń‚΂炾‚˝$1,$2,...‚đOFS‚đ‹˛‚ń‚Ĺ
‚‚Ȃ°’ź‚ˇ‚Á‚Ä‚ą‚ƂȂ̂ŁA‰˝‚Ĺ‹ćŘ‚ç‚ę‚Ä‚˘‚˝‚Š‚Í
•Ű‘ś‚ł‚ę‚Č‚˘B
365 :
2010/05/18(‰Î) 15:41:56
>>364
>$1=$1‚Ĺ‘ă“ü‚ľ‚Ä‚â‚é‚ƁA$1, $2, ...‚đ‹ó”’1ŒÂ‚ł‚Ȃ˘‚ž‚ŕ‚Ě‚Ş$0‚É‘ă“ü‚ł‚ę‚é

‚Á‚Ä–ń‘ŠŽ–‚đŠo‚Ś‚Ä‚¨‚Ż‚Á‚Ä‚ą‚Ć‚Š‚˘H
366 :
2010/05/18(‰Î) 15:42:39
‚ż‚ĺ‚Á‚Ć‹C‚É‚Č‚Á‚ÄŽŽ‚ľ‚Ä‚Ý‚˝B

% echo a b | gawk '{OFS="-";$1=$1;OFS="=";print}'
a=b

Ä\Ź‚Í$1=$1‚đ‚â‚Á‚Ä‚ˇ‚Ž‚ś‚á‚Č‚­‚āAŽŸ‚É$0‚ŞŽg‚í‚ę‚é‚Ć‚ŤA‚Á‚Ä‚ą‚Ć
‚Č‚Ě‚Š‚Č?
367 :
2010/05/18(‰Î) 16:27:59
‰đ‚Á‚˝

http://www.kt.rim.or.jp/~kbk/gawk-3.1/gawk.html

Œx: ˆę•”‚Ěƒo[ƒWƒ‡ƒ“‚Ěawk‚Í NF‚đŒ¸‚ś‚˝‚Ć‚Ť‚É$0‚̍č\’z‚đs‚í‚Č‚˘B
Œ‹‹Ç‚Ě‚Ć‚ą‚ëAawk‚ɃŒƒR[ƒh‘S‘Ě‚ĚÄ\’z‚đ‹­§‚ľ‚˝‚Ć‚Ť‚É‚Í‚ť‚ĚŽž“_‚Ĺ
ƒtƒB[ƒ‹ƒh‚Ě’l‚ĆOFS‚ŞŽg‚í‚ę‚éBÄ\’z‚đs‚¤‚˝‚߂ɂ́A‰˝‚ç‚Š‚Ě–łŠQ‚Č
‘ă“ü‚đs‚¤:

$1 = $1 # force record to be reconstituted


ŒŤ‚­‚Č‚Á‚˝B‚ ‚ń‚Ş‚ĆB
368 :
2010/05/18(‰Î) 16:46:58
awk‚Íšú‚ސ[‚˘‚Ě‚§
369 :
2010/05/19(…) 22:24:52
‹v‚ľ‚Ô‚č‚É‚˘‚˘‚ŕ‚ń‚đŒŠ‚ł‚š‚Ä‚ŕ‚炢‚Ü‚ˇ‚˝„ƒ
370 :
2010/05/24(ŒŽ) 09:55:14
’m‚ç‚Č‚Š‚Á‚˝B
•×‹­‚É‚Č‚Á‚˝B
371 :
2010/05/24(ŒŽ) 15:25:46
‚Ý‚ń‚Č>357‚Ě‚¨ˆü‚Ĺ‘˝‚­‚đŠw‚ń‚ž‚ȁB
372 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/05/29(“y) 04:53:07
–ź‘OF
E-mailF
“ŕ—eF
cygwin‚ž‚Ć
% cut -f1 -d, hoge.csv
‚ć‚č
% awk -F, '{print $1}' hoge.csv
‚Ě•ű‚Ş‘Ź‚Š‚Á‚˝B
#ŽŔsŽžŠÔ‚Ë
#PerlHƒVƒ‰ƒl
373 :
2010/06/07(ŒŽ) 11:45:38
>>372
sed -e 's/,.*//'‚Ĺ‚ŕawk‚Ć“Ż‚ś‚­‚炢‚ž‚Š‚çAcut‚ĚŽŔ‘•‚Ş’x‚˘‚ń‚ž‚ˁB
cut‚Ş–ł‘Ę‚ÉƒIƒvƒVƒ‡ƒ“‘˝‚˘Šˆ×‚ś‚á‚Č‚˘?
374 :
2010/06/07(ŒŽ) 12:04:05
ŽčŒł‚ĚlinuxŠÂ‹Ť‚ž‚Ćcut‚Ě•ű‚Ş‘Ź‚˘‚Ć‚˘‚¤•’Ę‚ĚŒ‹‰Ę‚Ĺ‚ľ‚˝‚ށB
hoge.csv‚Í6Œ…‚Ě—”3‚‚đu,]‚Ĺ‹ćŘ‚Á‚Ä•Ŕ‚ׂ˝100–œs‚Ě
ƒtƒ@ƒCƒ‹‚Ĺ‚ˇB

% time cut -f1 -d, hoge.csv >/dev/null
cut -f1 -d, hoge.csv > /dev/null 0.21s user 0.01s system 99% cpu 0.222 total
% time awk -F, '{print $1}' hoge.csv >/dev/nulll
awk -F, '{print $1}' hoge.csv > /dev/nulll 1.52s user 0.03s system 99% cpu 1.558 total

‚ż‚Č‚Ý‚Éƒo[ƒWƒ‡ƒ“‚Í

cut (GNU coreutils) 8.5
GNU Awk 3.1.7
375 :
2010/06/07(ŒŽ) 12:22:48
‚ [‚Č‚é‚قǁA‚Č‚ń‚Š”ť‚Á‚˝Bcygwin‚Ěfgetc()‚Ş’x‚˘‚Š‚ç‚ś‚á‚Č‚˘‚Š‚ȁB
fgetc()‚Ćfgets()‚ĹŽžŠÔ‚đŠr‚ׂ˝‚Ć‚Ť‚Éfgetc()‚Ě•ű‚Ş‚¸‚Á‚Ć’x‚Š‚Á‚˝‹L‰Ż‚Ş‚ ‚éB
376 :
2010/09/13(ŒŽ) 14:14:54
xgawk (gawk‚Ĺ‚Č‚­)‚É‚Ć‚ ‚éwebƒy[ƒW‚đH‚ׂł‚š‚é‚ƁAXMLERRR (not well-formed)‚Ĺ’†’f‚ľ‚Ü‚ˇB
‚ť‚Ěƒy[ƒW‚Şwell-formed‚Š‹ÉˆŤ‚Š‚ÍŽ„‚É‚Ć‚Á‚Ä‚Ç‚¤‚Ĺ‚ŕ‚ć‚­A’P‚É“ŕ—e‚đ“ž‚˝‚˘‚ž‚Ż‚Ȃ̂ŁA•ś––‚Ü‚Ĺˆ—‚ľI‚Ś‚Ä—~‚ľ‚˘‚Ě‚Ĺ‚ˇB
‚Ç‚¤‚É‚Š‚Č‚ç‚Č‚˘‚Ĺ‚ľ‚傤‚ŠB
377 :
2010/09/25(“y) 14:55:22
ƒVƒFƒ‹ƒXƒNƒŠƒvƒg“ŕ‚ĹƒpƒCƒv“ü—Í‚ł‚ę‚˝‚ŕ‚Ě‚đˆ—‚ˇ‚é
ƒAƒNƒVƒ‡ƒ“‚đƒqƒAƒhƒLƒ…ƒƒ“ƒg‚ŏ‘‚­Ž–‚͏o—ˆ‚é‚Ĺ‚ľ‚傤‚ŠB
378 :
2010/09/27(ŒŽ) 14:57:18
Žż–â‚Ĺ‚ˇB
ƒf[ƒ^‚Ş
|1|aaa|
|2|bbb|
|3|ccc|
‚Č‚Ç‚Ć‚Č‚Á‚Ä‚˘‚é‚Ć‚Ť
aaa
bbb
ccc
‚đŽć‚čo‚ť‚¤‚Ć‚ľ‚Ä
awk 'FS="|"{print $3}' ƒtƒ@ƒCƒ‹–ź
‚Ć‚ľ‚˝‚ń‚Ĺ‚ˇ‚ށA1s–Ú‚ž‚Ż‚Ş‚¤‚Ü‚­‚Ć‚ę‚Ü‚š‚ńB
ƒf[ƒ^ƒtƒ@ƒCƒ‹‚Ě1s–Ú‚đ‹ós‚É‚ˇ‚ę‚Î‰đŒˆ‚Ĺ‚Ť‚Č‚˘‚ą‚Ć‚Í‚Č‚˘‚ń‚Ĺ‚ˇ‚ށA
‹ós‚đ“ü‚ę–Y‚ę‚Ä‚ľ‚Ü‚¤Œœ”O‚Ş‚ ‚č‚Ü‚ˇB
‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚ń‚Ĺ‚ľ‚傤‚Š?
379 :
2010/09/27(ŒŽ) 15:01:46
‚â‚č‚˝‚˘‚ą‚Ć‚Í awk 'BEGIN {FS="|"} {print $3}' ‚ś‚á‚Č‚˘‚Š‚ĆŽv‚¤‚ń‚ž‚Ż‚Ç
380 :
2010/09/27(ŒŽ) 15:08:38
378‚Ĺ‚ˇB
>>379
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B
381 :
2010/09/27(ŒŽ) 18:42:12
gensub()‚ɂāAƒ}ƒbƒ`‚ľ‚˝10”Ô–ÚˆČ~‚ĚƒOƒ‹[ƒv‚ĚŽw’č‚ĚŽd•ű‚đ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B
‰ş‹LƒTƒCƒg‚ł́A17”Ô–Ú‚Ü‚Ĺ•’Ę‚ÉŽw’č‚Ĺ‚Ť‚é‚悤‚ČŽ–‚ޏ‘‚˘‚Ä‚ ‚é‚Ż‚ǁA
http://tounderlinedk.blogspot.com/2010/08/gensub-n-awk.html

gensub(pattern,"\\10","g",$2) ‚Ć‚Š‚­‚Ć
\\1(ƒ}ƒbƒ`‰ÓŠ)‚Ć0(•śŽš)‚Ć‚ľ‚ĉđŽß‚ł‚ę‚ż‚á‚Á‚ďăŽč‚­‚˘‚Č‚Š‚˘B

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg•—‚Š‚ĆŽv‚Á‚āA\\{10} ‚ம‚ľ‚˝‚Ż‚ǃ_ƒƒ_ƒbƒ^[B

GNU Awk 3.1.5‚Ĺ‚ˇB
382 :
2010/09/27(ŒŽ) 19:00:47
BSD‚Ějman‚ɂ́A1‚Š‚ç9‚܂ł̐”Žš‚Á‚Ä–ž‹L‚ł‚ę‚Ä‚é‚Č‚ B
ŽŔ‘•‚É‚ć‚Á‚ĈႤ‚Ě‚Š‚Č‚ 
ƒpƒ^[ƒ“‚đ“Ž“I‚ɐśŹ‚ľ‚ă}ƒbƒ`‚ł‚š‚悤‚Ć‚ľ‚Ä‚é‚Š‚猋\˘‚é(LEƒÖE`)
http://www.linux.or.jp/JM/html/GNU_gawk/man1/gawk.1.html
383 :
2010/09/27(ŒŽ) 19:04:47
>>381
ƒ}ƒjƒ…ƒAƒ‹‚É‚Í1‚Š‚ç9‚Ü‚Ĺ‚Á‚ď‘‚˘‚Ä‚ ‚é‚ľ

Within the replacement text s, the sequence \n, where n is a digit from 1 to 9, may be
used to indicate just the text that matched the n'th parenthesized subexpression.

ƒ\[ƒX‚ĚŠY“–‰ÓŠ(builtin.c‚Ě2542s–Ú‚ ‚˝‚č‚Š‚ç)‚Ý‚Ä‚ŕ1Œ…ŒŔ’č‚ĚƒƒWƒbƒN‚ž‚ćB(3.1.7’˛‚×)

int dig = scan[1] - '0';

‚Č‚ń‚Ä‚â‚Á‚Ä‚éB
384 :
2010/09/27(ŒŽ) 19:08:03
ˆę’U‚Ô‚Á‚˝Ř‚é‚ľ‚Š‚Č‚˘‚ń‚ś‚á‚Ë
385 :
2010/09/27(ŒŽ) 19:12:31
>>383
‚Ç‚¤‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>384
‚ż‚ĺ‚Á‚ĆŒŠ‰h‚ŚˆŤ‚­‚Č‚é‚Ż‚Ç‚ť‚¤‚ˇ‚é(LEƒÖE`)
386 :
2010/09/27(ŒŽ) 21:27:29
>>381
‚Č‚ń‚Ĺ‚ť‚ą‚Ě‚Đ‚Ć‚Í16‚Ü‚Ĺ‚Ĺ‚Ť‚˝‚ń‚žH
387 :
2010/09/28(‰Î) 00:32:52
10‚Ě‘ă‚í‚č‚É:‚đŽg‚Á‚Ä‚˘‚˝‚č‚ľ‚āB
388 :
2010/09/28(‰Î) 03:15:24
‚ą‚ĚƒXƒŒ‚ސˇ‹ľ‚Č‚Ě‚Ş’ż‚ľ‚˘‚Š‚ç
‹L”OƒpƒsƒRB
389 :
2010/09/28(‰Î) 03:41:50
15”NˆČă‘O‚ž‚Ż‚Çawk‚̕׋­Žn‚ß‚Ä“ŻŽž‚Éperl‚̕׋­‚ŕ‚ľ‚Ä‚˝‚ç
‹C•t‚˘‚˝‚çperl‚΂Á‚Š‚č‚â‚Á‚Ä‚Äawk‚ˇ‚Á‚Š‚č–Y‚ę‚Ä‚ľ‚Ü‚Á‚˝‚Č‚Ÿ
Ą‚ÍperlŽĚ‚ĂĐę‚çpython‚â‚Á‚Ä‚é‚Ż‚Çawk‚ŕ‚˘‚˘‚ć‚Ë
390 :
2010/09/28(‰Î) 09:40:13
Busybox‚É‘g‚ݍž‚߂΁A‚ť‚ę‚ą‚ť†”ŃŠí‚â—â‘ ŒÉ‚Ĺ‚ŕ“Ž‚­‚Š‚ç‚Č‚ B
ŽčŒy‚Ĺ‚ ‚é‚É‚ŕŠÖ‚í‚炸AŒ‹\‚“x‚ȏˆ—‚ŕƒKƒŠƒKƒŠ‘‚Ż‚é‚Š‚çD‚ŤB

C‚ĆƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ލD‚Ť‚ž‚Š‚çA•ś–@“I‚É‚ŕ‚ľ‚Á‚­‚č—ˆ‚éB
ăˆĘŒÝŠˇ‚ĚPerl‚ŕ‘ĺD‚ŤB
391 :
2010/09/28(‰Î) 14:37:59
>>376‚Ĺ‚ˇ‚ށA’N‚ŕ‚Š‚Ü‚Á‚Ä‚­‚ę‚Č‚˘‚Ě‚ĹŽâ‚ľ‚ł‚ĹŽ€‚É‚ť‚¤‚Ĺ‚ˇB
392 :
2010/09/28(‰Î) 14:52:08
>>391
‚Ç‚ę‚Ĺ‚ŕD‚Ť‚Č‚Ě‚đ‘I‚×

1. xgawk‚đ‰ü‘˘
2. ƒGƒ‰[‚É‚Č‚éXML‚đŽ–‘O‚ɏCł‚ľ‚Äwell-formed‚É‚ľ‚Ä‚Š‚çH‚í‚š‚é
3. xgawk‚ÍŽĚ‚Ä‚Ä•Ę‚ĚŒžŒęAƒ‰ƒCƒuƒ‰ƒŠ‚đŽŽ‚ˇ
393 :
2010/09/28(‰Î) 17:23:08
jawk‚Şjwalk‚ÉŒŠ‚Ś‚Ä‚ľ‚Ü‚¤
394 :
2010/10/01(‹ŕ) 11:21:26
“Ž‚­ŠÂ‹Ť‚Ě‘˝‚ł‡‚ɃCƒ“ƒ^ƒvƒŠƒ^‚đ‘I‚Ô‚ń‚Č‚çA

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg > awk >>> perl >>>>> python >>>>> ruby >>> haskel etc.

‚Ć‚Č‚é‚ž‚낤‚ȁB

ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚̓VƒFƒ‹ˆË‘ś‚Č•”•Ş‚Ş‘˝‚­Aperl ‚Ů‚Ç‚‹@”\‚Č‚ŕ‚Ě‚ŕ—v‚ç‚Č‚˘B
‚ť‚ń‚ČŽžAŹ‚ł‚Č’[––‚Ĺ‚ŕƒXƒ}[ƒg‚É“Ž‚˘‚Ä‚­‚ę‚é awk ‚É‚ż‚ń‚ą–u‚B

>>389
ŒžŒę‚ÉŽĚ‚Ä‚é‚ŕE‚¤‚ŕ‚Č‚˘‚ćB‚ť‚ĚŽžX‚É“s‡‚Ě—Ç‚˘‚ŕ‚Ě‚đ‘g‚ݍ‡‚í‚š‚ÄŽg‚¤‚Ě‚ŞUNIX“I‚Č”­‘zB
395 :
2010/10/01(‹ŕ) 15:33:40
>>394
uˆę”­‚â‚낤v‚Ĺ‚ˇ‚ˁI
396 :
2010/10/09(“y) 04:40:48
awkĹ‹ß•×‹­‚ľ‚Ä‚éBperl‚ć‚č‘S‘RŠČ’PB
‚ą‚ę‚Ȃ牴‚Ĺ‚ŕÁÜ‚ľ‚Č‚­‚Ä‚ˇ‚Ý‚ť‚¤
397 :
2010/10/09(“y) 04:57:14
>>396@‚Ş‚ń‚΁I
398 :
2010/10/21(–Ř) 20:16:46
sjis‚ŏ‘‚˘‚˝
/[/{print}
‚đŽŔs‚ˇ‚é‚Ć

awk:
awk: ^ ł‹K•\Œť‚ޏI’[‚ł‚ę‚Ä‚˘‚Ü‚š‚ńB
awk: ’v–˝“I: [ ‚Ü‚˝‚Í [^ ‚ޑΉž‚ľ‚Ü‚š‚ńB: /[/{print}/

‚ĚƒGƒ‰[‚É‚Č‚Á‚Ä‚ľ‚Ü‚˘‚Ü‚ˇB
[‚Ě2ƒoƒCƒg–Ú‚Ş[‚Č‚š‚˘‚ž‚ĆŽv‚˘‚Ü‚ˇ‚ށA‚Ç‚¤‘Ήž‚ľ‚˝‚炢‚˘‚Ĺ‚ľ‚傤‚ŠH
“ü—̓tƒ@ƒCƒ‹‚Ísjis‚ŏ‘‚Š‚ę‚Ä‚˘‚āA•śŽšƒR[ƒh•ĎŠˇ‚Í‚Ĺ‚Ť‚Ü‚š‚ńB
399 :
2010/10/21(–Ř) 20:55:41
>>398
ŠÂ‹Ť‚Ě–â‘č‚Č‚ń‚ž‚Š‚çAŽŔsŠÂ‹Ť‚­‚炢‚Ü‚Ć‚ŕ‚ɏ‘‚Ż‚ćB
400 :
2010/10/21(–Ř) 21:38:24
>>398
gawk ‚đŽg‚¤
401 :
2010/10/21(–Ř) 22:52:57
ŠÂ‹Ť‚ÍCentOS-5.5-x86_64‚ĹGNU Awk 3.1.5‚Ĺ‚ˇB
/bin/awk‚̓Vƒ“ƒ{ƒŠƒbƒNƒŠƒ“ƒN‚ŁAŽŔ‘Ě‚Ígawk‚Ĺ‚ľ‚˝B
402 :
2010/10/21(–Ř) 23:49:35
>>401
--help ‰Ĺ
403 :
2010/10/22(‹ŕ) 01:41:07
Windows‚V(64bit)‚ĹŽg‚Ś‚éawk‚ ‚č‚Ü‚ˇ‚ŠH
404 :
2010/10/22(‹ŕ) 02:19:30
32bit”Ĺ‚Ěawk‚đ‚đŽg‚¤‚ń‚ś‚áƒ_ƒH
405 :
2010/10/22(‹ŕ) 07:32:34
‚ą‚¤‚ˇ‚é‚ą‚ƂőΉž‚Ĺ‚Ť‚Ü‚ľ‚˝B
/\x81\[/{print}
406 :
2010/10/22(‹ŕ) 09:41:36
‚ť‚ę‚Ĺ‚˘‚˘‚Č‚çA/[[]/‚Ĺ‚ŕ‚˘‚˘ŠóƒKƒXB
Ş–{“I‚Č‰đŒˆ‚É‚Č‚Á‚Ä‚Č‚˘‚Ż‚Ç‚Ë‚ĽB
407 :
2010/10/22(‹ŕ) 13:52:10
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚âƒ_ƒuƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“‚ĚŽg‚˘•Ş‚Ż‚ś‚á‚ˁ`
408 :
2010/10/22(‹ŕ) 19:55:53
Ş–{“I‚Č‰đŒˆ‚ˇ‚é‚Ć‚ľ‚˝‚ç•śŽšƒR[ƒh‚đ•Ď‚Ś‚é‚ą‚Ć‚Ĺ‚ľ‚傤‚ŠH
409 :
2010/10/22(‹ŕ) 20:03:18
“ú–{Œę‚Ě•śŽšƒR[ƒh‚ɑΉž‚ľ‚Ä‚éawk‚đŽg‚¤A‚Ć‚˘‚¤•ű–@‚ŕ‚ ‚éB
Ą‚ ‚é‚Ě‚Š‚Ç‚¤‚Š’m‚ç‚Č‚˘‚Ż‚ǁB
410 :
2010/10/22(‹ŕ) 20:28:38
Ą‚Ěgawk‚Í•’Ę‚ÉUnicode‘Ήž‚ľ‚Ä‚é‚Ý‚˝‚˘

$ echo '‚Ä‚ˇ‚Ć' | gawk '/[‚Ÿ-‚ń]/ { print length($0) }'
3

UTF-8ƒƒP[ƒ‹‚Ĺ‚ľ‚ŠŽŽ‚ľ‚Ä‚Č‚˘‚Ż‚Ç
cygwin‚Ĺ‚ŕ‘ĺä•v
411 :
2010/10/23(“y) 01:29:00
>>404
gawk‚Ĺ‚˘‚˘‚Š‚Č
412 :
2010/10/23(“y) 06:55:10
>>405

–â‘č‚Í‰đŒˆ‚ľ‚˝‚Ě‚Š‚ŕ‚ľ‚ç‚ń‚ށAˆę‰žB
ˆČ‰ş2‚‚ĚWin—pƒoƒCƒiƒŠ‚Í–â‘č‚Č‚˘‚̂ŁAƒ\[ƒX‚ŕ‚ç‚Á‚ÄLinuxă‚ĹƒRƒ“ƒpƒCƒ‹‚ľ‚Ä‚Ý‚˝‚çH

ttp://gnuwin32.sourceforge.net/packages/gawk.htm
ttp://www.kt.rim.or.jp/~kbk/gawk-3.1/
413 :
2010/10/23(“y) 10:53:14
ƒT[ƒoŠÇ—ŽŇ‚ś‚á‚Č‚˘‚Ě‚ĹƒT[ƒo‚đ‚˘‚ś‚é‚ą‚Ć‚Í‚Ĺ‚Ť‚Č‚˘‚Ĺ‚ˇB
‚ą‚ę‚É‚ľ‚˝‚çsjis‚Ĺ‚ŕ“Ž‚­‚悤‚É‚Č‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
414 :
2010/10/23(“y) 12:27:19
>>413
­‚Č‚­‚Ć‚ŕŽŠ•Ş‚ŞŽŽ‚ľ‚˝Windows2003ă‚ł͂ȁB

¤tes.awk Śsjis
/[/{print}
˘

CentOS5.5ă
$ gawk -f tes.awk readme.ja
awk: tes.awk:1:
awk: tes.awk:1: ^ ł‹K•\Œť‚ޏI’[‚ł‚ę‚Ä‚˘‚Ü‚š‚ńB
awk: tes.awk:1: ’v–˝“I: [ ‚Ü‚˝‚Í [^ ‚ޑΉž‚ľ‚Ü‚š‚ńB: /[/{print}/

Windows2003ă
> gawk -f tes.awk readme.ja
Ëƒ}ƒbƒ`‚ľ‚˝•¨‚Ş•\ŽŚ‚ł‚ę‚é

Linuxă‚ĹƒƒP[ƒ‹‚đsjis.japanese‚Ć‚Š‚É‚ˇ‚ę‚΂˘‚˘‚Ě‚Š‚ĆŽv‚Á‚˝‚ށAƒƒP[ƒ‹•ĎXŽŠ‘Ě‚Ş‚¤‚Ü‚­‚˘‚Š‚Č‚Š‚Á‚˝‚íB
˘‚Á‚Ă鎖‚Ş‚ ‚é‚Č‚çAĹI“I‚ɉ˝‚Ş‚ľ‚˝‚˘‚ŠŒž‚Á‚˝‚Ů‚¤‚Ş‚˘‚˘‚ćB
415 :
2010/10/23(“y) 12:40:31
Windows2003‚ž‚Ć‚ż‚á‚ń‚Ć“Ž‚­‚ń‚Ĺ‚ˇ‚ˁB
˘‚Á‚Ä‚˘‚˝‚ą‚Ć‚Í405‚Ĺ‰đŒˆ‚ľ‚˝‚Ě‚Ĺ‘ĺä•v‚Ĺ‚ˇB
Ą‚́uŞ–{“I‚Č‰đŒˆv‚É‹ť–Ą‚Ş‚ ‚Á‚˝‚Ě‚Ĺ‚¨•ˇ‚Ť‚ľ‚˝ŽŸ‘ć‚Ĺ‚ˇB
416 :
‰SŽŇ
2010/11/04(–Ř) 22:14:10
awk‚ĹƒVƒFƒ‹‚ĚPATH•Ď”‚đƒ}ƒbƒ`‚ł‚š‚é‚Ć‚Ť‚ɃXƒ‰ƒbƒVƒ…//‚đŽg‚í‚Č‚˘•ű–@‚đ‹ł‚Ś‚Ä‚˘‚˝‚ž‚Ż‚Ü‚š‚ń‚ŠH
417 :
2010/11/04(–Ř) 23:14:10
>>416
‰SŽŇ‚ž‚Š‚çƒ}ƒ‹ƒ`‚Ş‹–‚ł‚ę‚é‚Ć‚Ĺ‚ŕŽv‚Á‚˝‚ŠH
418 :
‰SŽŇ
2010/11/05(‹ŕ) 06:32:09
‚˛‚ß‚ń‚Č‚ł‚˘I
’m‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
419 :
2010/12/15(…) 01:54:35
”z—ń‚Ě—v‘f”‚𒲂ׂé‚Č‚çAƒ‹[ƒvˆ—‚ľ‚Č‚˘‚Ć•Ş‚Š‚ç‚Č‚˘H
length ‚Ý‚˝‚˘‚Č‚Ě‚Í–ł‚˘H
420 :
2010/12/15(…) 02:27:50
‚ ‚é‚ćB‚Ü‚ł‚ľ‚­Alength(array)B
421 :
2010/12/15(…) 02:42:46
‚ť‚ń‚Č‚ŕ‚ń‚Ë‚Ľ‚ć‚—
‚ĆŽv‚Á‚˝‚çgawk‚É‚Í‚ ‚é‚Ě‚Š

length([s]) Returns the length of the string s, or the
length of $0 if s is not supplied. Starting
with version 3.1.5, as a non-standard exten-
sion, with an array argument, length() returns
the number of elements in the array.
422 :
2010/12/15(…) 04:20:37
‚Ţ‚ľ‚ë”z—ń‚Ş‘śÝ‚ˇ‚é‚Á‚Ä‚ą‚Ć‚Í‚ť‚Ě”z—ń‚đěŹ‚ˇ‚é‰ß’ö‚Ş‚ ‚é‚ž‚ëH
ěŹ‚ˇ‚é‚Ć‚Ť‚ɐ”‚Ś‚ę‚΂˘‚˘‚ń‚ś‚á‚ˁH
423 :
2010/12/15(…) 08:40:15
˜A‘z”z—ń‚ž‚Á‚˝‚琔‚Ś‚Č‚˘‚Ě‚Ş•’Ę‚ž‚Ş‚Č
424 :
2010/12/25(“y) 03:12:23
function ‚ŏˆ—‚ˇ‚鎞A”z—ń‚ž‚Ż‚Ĺ‚Íƒ_ƒ‚Ĺ—v‘f”‚Ü‚Ĺ•K—v‚Č‚ń‚ž‚Š‚Č‚ŸA
‚Á‚ÄŽ–‚Ş•Ş‚Š‚č‚Ü‚ˇ‚˝
425 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/12/28(‰Î) 11:29:35
function ‚É“n‚ˇ‚ž‚Ż‚Č‚ç—v‘f”‚Č‚ń‚Ä‚˘‚ç‚Č‚˘‚ń‚ś‚á‚Č‚˘H
426 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2010/12/28(‰Î) 13:55:13
$1 = $1‚Ý‚˝‚˘‚ČƒgƒŠƒbƒN‚đŒŠ‚é“x‚ɉœ‚ސ[‚˘‚ĆŒž‚¤‚ć‚č‚Í•ł‚ÉŒŠ‚Ś‚Ä‚Ť‚Ü‚ˇ
–|‚ˇ‚ĆUNIX•ś‰ť‚ť‚Ě‚ŕ‚Ě‚Ş
‚Ü‚ A‚ ‚­‚Ü‚Ĺ‚¨‚ę‚ĚŽĺŠĎ‚Ĺ‚ˇ‚Ş‚Ë
427 :
2010/12/28(‰Î) 15:24:21
>>426
‚‚—‚‹‘ĺD‚Ť‚ČƒIƒCƒ‰‚ÉŒ–‰Ü”„‚é‚Ě‚Š‚—
ƒEƒjƒbƒNƒX•ś‰ťĹ‚Ii‚m‚sŒn‚Í‚t‚m‚h‚w‚ĚƒpƒNƒŠj
428 :
2010/12/28(‰Î) 15:28:13
>>427
‘SŠp‰pŽšŽg‚¤“z‚Ş awk ‘ĺD‚Ť‚ž‚Ć‚Í“ž’ęŽv‚Ś‚ń
429 :
2011/01/05(…) 23:22:55
‚Ü‚ “~‹x‚ÝŠúŠÔ‚ž‚ŕ‚̂ˁB
430 :
2011/01/06(–Ř) 00:22:04
Ľtes09.awk
BEGIN{
@@if (ARGV[1]=="")
@@@@ARGV[1]="hoge.txt"
@@while (getline < ARGV[1] > 0) print "BEGIN\t"$0
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

šŽż–â
ă‹LƒXƒNƒŠƒvƒg‚đˆř”‚đ•t‚Ż‚˝ę‡‚Ć•t‚Ż‚Č‚˘ę‡‚đ‚ť‚ę‚ź‚ęŽŔs‚ľ‚Ü‚ľ‚˝B

Ľgawk -f tes09.awk hoge.txt
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com
BODY@@arima_yuuichi@example.com
BODY@@ooizumi_sadawo@example.com
BODY@@taguchi_kenji@example.com

Ľgawk -f tes09.awk
BEGIN@ arima_yuuichi@example.com
BEGIN@ ooizumi_sadawo@example.com
BEGIN@ taguchi_kenji@example.com

‚ą‚ą‚ŁABEGIN‹ĺ‚Ĺ‚Ě ARGV[1]="hoge.txt" ‚Ć‚˘‚¤‘ă“ü‚đ–{•Ň(?)‚Ĺ‚ŕ—LŒř‚É‚ˇ‚éˆ×
‚É‚Í‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ľ‚傤‚ŠH
431 :
2011/01/06(–Ř) 00:31:45
‚Č‚É‚ŕ‚ľ‚Č‚­‚Ä‚ŕ—LŒř‚ž‚ĆŽv‚¤‚ń‚ž‚Ż‚Ç
Žż–â‚ĚŽďŽ|‚Ş‚í‚Š‚ç‚ń
432 :
2011/01/06(–Ř) 06:20:53
•Ş‚Š‚čh‚­‚Ä‚ˇ‚Ý‚Ü‚š‚ńB
hoge.txt‚Ě’†g‚͉ş‹L‚Ĺ‚ˇB
Ľ
arima_yuuichi@example.com
ooizumi_sadawo@example.com
taguchi_kenji@example.com

>>430‚ÍWin32‚ĚƒoƒCƒiƒŠuGNU Awk 3.1.7(windows special Nov 24 2009)v‚đŽg—p‚ľ‚˝Œ‹‰Ę‚Ĺ‚ˇB
‰ş‚Ě‚Ů‚¤‚ĚŽŔsŒ‹‰Ę‚ł́ABEGIN‹ĺ‚Ĺ‚ĚARGV[1]‚Ö‚Ě‘ă“ü‚ÍBEGIN‹ĺ‚Ĺ‚Í—LŒř‚Ĺ‚ˇ‚ށA
–{•Ň‚Ĺ‚Í—LŒř‚É‚Č‚Á‚Ä‚˘‚Č‚˘‚Ě‚Ĺo—Í‚ł‚ę‚Ä‚˘‚Č‚˘‚悤‚ÉŒŠ‚Ś‚Ü‚ˇB

‚ż‚Ȃ݂ɁACentOS5.5ă‚Ě GNU Awk 3.1.5 ‚ł͉ş‹LƒGƒ‰[‚É‚Č‚č‚Ü‚ľ‚˝B

Ľ
gawk: tes09.awk:2: @@if (ARGV[1]=="")
gawk: tes09.awk:2: ^ •\Œť‚Ě char 'E' ‚Í•sł‚Ĺ‚ˇB
433 :
2011/01/06(–Ř) 08:57:49
“ü—̓ŒƒR[ƒh‚Ş1Œ‚ŕ–ł‚˘‚Š‚ç‚Ĺ‚ľ‚ĺ

>gawk: tes09.awk:2: ^ •\Œť‚Ě char 'E' ‚Í•sł‚Ĺ‚ˇB
‚ą‚ę‚Í‘SŠpƒXƒy[ƒX
434 :
2011/01/06(–Ř) 09:12:00
>BEGIN@ arima_yuuichi@example.com
>BEGIN@ ooizumi_sadawo@example.com
>BEGIN@ taguchi_kenji@example.com
ƒRƒŒ‚Ígetline‚Ĺ“Ç‚ń‚ŏo—Í‚ľ‚˝‚ŕ‚Ě

>BODY@@arima_yuuichi@example.com
>BODY@@ooizumi_sadawo@example.com
>BODY@@taguchi_kenji@example.com
ƒRƒŒ‚̓Rƒ}ƒ“ƒh‚ĹŽw’č‚ľ‚˝ƒtƒ@ƒCƒ‹‚Š‚ço—Í‚ľ‚˝‚ŕ‚Ě

‚˝‚Ć‚Ś‚Î
{
@@print "BODY\t"$0
}
‚Ć‚ľ‚Ä‚â‚ę‚Ζž‚ç‚Š
435 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/01/06(–Ř) 13:46:53
Žż–â‚ĚŽďŽ|‚́AƒvƒƒOƒ‰ƒ€iƒXƒNƒŠƒvƒgj‚Ě’†‚Ĺ“ü—̓tƒ@ƒCƒ‹“™‚Ě
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚đ’ljÁ‚ľ‚˝‚˘‚Ć‚˘‚¤Ž–‚Ĺ‚ˇ‚ŠB

ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Ě”z—ń‚Í ARGV ‚Ĺ‚ˇ‚ށAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ˆř”‚Ě
ŒÂ”‚đŠi”[‚ˇ‚é ARGC ‚Ć‚˘‚¤‘g‚ݍž‚ݕϐ”‚Ş‚ ‚č‚Ü‚ˇB

ARGV”z—ń‚đ’ljÁ‚ľ‚˝‚çˆę‚É ARGC ‚đCł‚ľ‚Ä‚ ‚°‚Č‚˘‚ƁAawk‚Í”z—ń‚Ş
’ljÁ‚ł‚ę‚˝Ž–‚đ”FŽŻ‚ľ‚Ü‚š‚ńB

BEGIN“ŕ‚ĹARGV”z—ń‚đ’ljÁ‚ľ‚˝•Ş‚ž‚ŻARGC‚đƒCƒ“ƒNƒ‹ƒƒ“ƒg‚ľ‚Ä‚ ‚°‚ę‚Î
’ljÁ‚ł‚ę‚˝ARGV”z—ń‚ĹŽw’č‚ł‚ę‚˝ƒtƒ@ƒCƒ‹‚ŕ–{•ś‚̏ˆ—‚É“n‚ł‚ę‚Ü‚ˇB

ŽÖ‘Ť‚Ć‚ľ‚ẮA
ŒťÝˆ—’†‚Ěƒtƒ@ƒCƒ‹–ź‚ŞŠi”[‚ł‚ę‚Ä‚˘‚é”z—ń ARGV ‚ĚƒCƒ“ƒfƒbƒNƒX‚đ
ŽŚ‚ˇ‘g‚ݍž‚ݕϐ”‚Í ARGIND ‚Ĺ‚ˇB

Ž„‚Ě‚Í Win”Ĺ‚Ě gawkm115 ‚Ĺ‚ˇBƒXƒNƒŠƒvƒg“ŕ‚ĹARGV/ARGC‚đ‘€ě‚ľ‚Ä‚ŕ
Šú‘Ғʂ萳í‚É“Ž‚Ť‚Ü‚ˇ‚ćB

ŽŽ‚ľ‚Ă݂ĂˁB
436 :
2011/01/06(–Ř) 23:56:01
ŠF—lƒŒƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

>>433
>‚ą‚ę‚Í‘SŠpƒXƒy[ƒX

‚¨’p‚¸‚Š‚ľ‚˘ŒŔ‚č‚Ĺ‚ˇ(Šž) o‹Î‘O‚ÉŽv‚˘‚‚Ť‚ĹŽŽ‚ľ‚˝‚ŕ‚̂ŁAƒXƒŒ—p‚ɏ‘‚˘‚˝
•¨‚đ‚ť‚Ě‚Ü‚ÜƒRƒs‚Á‚Ä‚Ü‚ľ‚˝EEE

>>434
BEGIN‹ĺ‚Ěgetline‚Ĺ‚ÍARGV[1]‚Ö‚Ě‘ă“ü‚Ş‚Ĺ‚Ť‚Ä‚˘‚é‚̂ɁA–{•ś‚Ĺ‚Í—LŒř‚É
‚Č‚ç‚Č‚˘‚Ć‚˘‚¤Ž–‚đ“`‚Ś‚˝‚Š‚Á‚˝‚Ě‚Ĺ‚ˇB
437 :
2011/01/06(–Ř) 23:56:17
>>435
ŽŠ•Ş‚ĚŽż–â‚đŒŠ’ź‚ľ‚Ä‚Ý‚é‚Ć‘S‚­Žż–â‚É‚Č‚Á‚Ä‚˘‚Č‚Š‚Á‚˝‚É‚ŕŠÖ‚í‚炸ƒGƒXƒp[
‚ľ‚Ä‚­‚ž‚ł‚Á‚Ä‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB

ARGC‚ɂ‚˘‚Ä—‰đ‚Ĺ‚Ť‚Ü‚ľ‚˝B

BEGIN{
@@ARGV[1]="hoge.txt"
@@ARGC=2
}
ARGV[1]=="hoge.txt"{
@@print "BODY\t"$0
}

‚ą‚ń‚ČŠ´‚ś‚ĹˆÓ}‚ľ‚˝’Ę‚č‚ɏo—Í‚ł‚ę‚Ü‚ľ‚˝B

‚¨‚Š‚°‚ł‚Ü‚ĹĄ‚Ü‚Ĺawk‚Ě•â•‚Ć‚ľ‚Äsh‚đŽg‚Á‚Ä‚Ü‚ľ‚˝‚ށAawk‚ž‚Ż‚ŏ‘‚Ż‚鎖‚Ş
‘˝‚­‚Č‚č‚Ü‚ľ‚˝B

ˆř”‚ɃƒCƒ‹ƒhƒJ[ƒh‚đŽw’č‚ľ‚āAARGIND ‚Ĺ“Á’čƒpƒ^[ƒ“‚Ěƒtƒ@ƒCƒ‹–ź‚Ě
•¨‚Ě‚Ýˆ—‚đ‚ˇ‚é‚Ć‚Š‚Ĺ‚Ť‚ť‚¤‚Ĺ‚ˇ‚ˁB
438 :
2011/01/09(“ú) 22:38:39
Žż–â‚Ĺ‚ˇB
My Documents\2011\01\09(“ú)
‚Ć‚˘‚¤‚悤‚ɃtƒHƒ‹ƒ_‚đŘ‚Á‚Ä‚˘‚āAĄ“ú‚Écd‚ˇ‚é‚˝‚߂ɁA

today.bat
gawk -f today.awk > tmp.bat
tmp.bat
del tmp.bat

today.awk
BEGIN{year = strftime("%Y",systime()+9*60*60);
month = strftime("%m",systime()+9*60*60);
date = strftime("%d",systime()+9*60*60);
day = strftime("%a",systime()+9*60*60);

gsub(/(Sun)/, "(“ú)", day);
gsub(/(Mon)/, "(ŒŽ)", day);
gsub(/(Tue)/, "(‰Î)", day);
gsub(/(Wed)/, "(…)", day);
gsub(/(Thu)/, "(–Ř)", day);
gsub(/(Fri)/, "(‹ŕ)", day);
gsub(/(Sat)/, "(“y)", day);

print "cd \"My Documents\" year "\" month "\" date day
}

‚Ć‚˘‚¤‚悤‚ɏˆ—‚ľ‚Ä‚˘‚Ü‚ˇB
‚ą‚ę‚Á‚āA‚Đ‚ĺ‚Á‚Ć‚ľ‚āAgawk‚Ě“ŕ•”‚Š‚çprint‚š‚¸‚ÉŽŔs‚ˇ‚é‚ą‚Ƃ͉”\‚Ĺ‚ľ‚傤‚Š?
439 :
2011/01/09(“ú) 22:54:33
systemŠÖ”‚ŏo—ˆ‚é‚ń‚ł́Hwin‚Í•Ş‚Š‚ç‚Č‚˘‚Ż‚Ç
440 :
2011/01/09(“ú) 23:06:13
system("cd \"My Documents\" year "\" month "\" date day);
‚Ć‚Š‚Ĺ‚Í‚ž‚ß‚Ĺ‚ľ‚˝B
441 :
2011/01/10(ŒŽ) 03:54:21
>440
‚Č‚ń‚Š " ‚Ć \ ‚̐”‚Ş‚¨‚Š‚ľ‚­‚ˁH
My Documents\2011\01\09(“ú)
Ť
"My Documents\\2011\\01\\09(“ú)"
Ť
"My Documents\\" year "\\" month "\\" date day
‚ž‚ć‚ȁH
442 :
2011/01/10(ŒŽ) 11:42:11
ƒAƒhƒoƒCƒX‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚Í‚˘B
\‚Í‚¨‚Á‚ľ‚á‚é‚Ć‚¨‚č‚Ĺ‚ˇ‚ށAˆË‘R‚Ć‚ľ‚Ä‚ž‚ß‚Ĺ‚ˇB

today.bat‚đƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚Š‚çŽŔs‚ˇ‚é‚ƁA
print‚ľ‚Ä‚ť‚Ětmp.bat‚đŽŔs‚ˇ‚é438‚Ěƒpƒ^[ƒ“‚ž‚ƁA
‚ż‚á‚ń‚Ćcd‚Ĺ‚Ť‚āAĄ“ú‚ĚƒtƒHƒ‹ƒ_‚ɈړŽ‚ˇ‚é‚Ě‚Ĺ‚ˇ‚ށA
system("cd \\"My Documents\\" year "\\" month "\\" date day);
‚ž‚ƁAˆÚ“Ž‚š‚¸‚ɏI—š‚ľ‚Ä‚ľ‚Ü‚˘‚Ü‚ˇB
‚Č‚ń‚Ĺ‚ž‚ë[‚ȁB
443 :
2011/01/10(ŒŽ) 12:32:20
cygwin‚đ“ü‚ę‚Ä‚â‚Á‚Ä‚Ý‚˝

system‚Ísh‚Ĺ“Ž‚­‚Á‚Ű‚˘‚Ě‚Ĺ
rm /cygdrive/c/Documents\ and\ Settings/test.txt
‚Ý‚˝‚˘‚ɏ‘‚­‚Ć‚ż‚á‚ń‚ƏÁ‚Ś‚é‚Ý‚˝‚˘
444 :
2011/01/10(ŒŽ) 13:24:47
>>438,442

438‚ŏ‘‚˘‚Ä‚égawk‚Ĺ‚â‚č‚˝‚˘‚ą‚Ć‚Á‚Ä‚Ě‚Íƒoƒbƒ`ƒtƒ@ƒCƒ‹‚Ĺ‚â‚Á‚Ä‚é‚Ě‚Ć“Ż‚ś‚ą‚Ć?
‚ž‚Á‚˝‚ç–ł—B
system() ‚Ĺcd‚ľ‚Ä‚ŕsystem()‚Š‚ç•Ô‚Á‚Ä‚Ť‚˝‚Ć‚ą‚ë‚ĹŒł‚É–ß‚éB
445 :
2011/01/11(‰Î) 01:15:49
‚Ç‚¤‚š•łnixƒc[ƒ‹‚ž‚Š‚ç“ú–{Œę‚â‹ó”’‚̓_ƒ‚Č‚ń‚ž‚ë
446 :
2011/01/11(‰Î) 09:05:01
>>444
‚Č‚é‚قǁBgawk“ŕ•”‚Ĺ‚ÍƒVƒXƒeƒ€‚đŽŔs‚ľ‚Ä‚˘‚Ä‚ŕAgawk‚đo‚é‚ƁA‚ť‚ę‚ŕI‚í‚Á‚ż‚Ⴄ‚ń‚Ĺ‚ˇ‚ˁB‚Č‚é‚قǁB
‚ć‚­‚í‚Š‚č‚Ü‚ľ‚˝B‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
447 :
2011/01/19(…) 02:44:33
‚Ć‚č‚ ‚Ś‚¸AWK‚ŏ‘‚˘‚˝‹‘ĺ‚ČƒXƒNƒŠƒvƒg‚đAŽI‚ʼnń‚ľ‘ą‚Ż‚é‚Ě‚Í‚â‚ß‚Ä‚­‚ž‚ł‚˘B
”ńŒř—Ś‹É‚Ü‚č‚Č‚˘
448 :
2011/01/19(…) 15:27:12
‚ť‚ę‚Í‚ť‚̐l‚ÉŒž‚Á‚ĉş‚ł‚˘
449 :
2011/01/19(…) 21:03:10
‚ť‚̏ę‚ĹŽg‚Ś‚é‚Ě‚Şawk‚ž‚Ż‚ž‚Á‚˝‚ń‚Ĺ‚ˇ
450 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/01/19(…) 23:56:54
•śŽš‚Š‚ç•śŽšƒR[ƒhŽć‚čo‚š‚Č‚˘‚Ě‚ŞŽc”O
‹t‚Ísprintf("%c", 0x41)‚Ć‚Šo—ˆ‚é‚Ě‚É‚Č
451 :
2011/01/20(–Ř) 00:40:40
>>447
Œř—Ś‚Ě‚˘‚˘ƒvƒƒOƒ‰ƒ€‚ŏ‘‚Ť’ź‚ľ‚Ä‚â‚ę‚΂˘‚˘‚ś‚á‚Č‚˘B
452 :
2011/01/20(–Ř) 09:05:02
>>450
‚Âord.awk

gawk•t‘Ž‚Ěƒ‰ƒCƒuƒ‰ƒŠ‚ŁAascii‚Ě”ÍˆÍ‚Ě‘Î‰ž•\ě‚Á‚Ä‚Đ‚­‚Ć‚˘‚¤
ŠČ’P‚ČŽd‘g‚݁B

453 :
2011/01/20(–Ř) 23:49:13
#!/bin/gawk --re-interval -f

Ş‚Ěƒtƒ@ƒCƒ‹‚đŽŔs‚ˇ‚é‚ĆƒIƒvƒVƒ‡ƒ“‚Ş•sł‚ĆŒž‚í‚ę‚ÄŽŔs‚Ĺ‚Ť‚Č‚˘‚Ě‚Ĺ‚ˇ‚Ş
ƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚƒIƒvƒVƒ‡ƒ“‚ĹŽw’股‚éˆČŠO‚É‚â‚č•ű‚Í‚ ‚č‚Ü‚ˇ‚ŠH
454 :
2011/01/21(‹ŕ) 05:12:58
>>453
–ł—‚ÉawkƒXƒNƒŠƒvƒg‚É‚š‚¸‚É

#!/bin/sh
awk '
#awkƒR[ƒh
'

‚Á‚Ä‚˘‚¤ƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚É‚ľ‚˝‚ç‚Ç‚¤‚Š‚Č
455 :
2011/01/21(‹ŕ) 08:45:02
#!‚ĹƒCƒ“ƒ^ƒvƒŠƒ^‚É“n‚ˇˆř”‚Ěˆľ‚˘‚ÍŽŔ‘•ˆË‘ś‚ž‚Š‚ç‚ȁB
linux‚ž‚Ć‹ó”’‚đŠÜ‚ń‚ž‘S‚Ä‚Ě•śŽš—ń‚ވę‚Â‚Ěˆř”‚Ć‚ľ‚Ä
“n‚ł‚ę‚é‚̂ŁA•Ą”‚ĚƒIƒvƒVƒ‡ƒ“‚Í“n‚š‚Č‚˘B•s•Ö‚ž‚Ż‚Ç
‚ť‚¤‚˘‚¤‚ŕ‚Ě‚Č‚Ě‚Ĺ‚ ‚Ť‚ç‚ß‚Ä‚­‚ž‚ł‚˘B‘f’ź‚ɃVƒFƒ‹‚đ
ŠÔ‚É“ü‚ę‚é‚Ě‚Ş‚˘‚˘‚ĆŽv‚¤‚ćB
456 :
2011/01/21(‹ŕ) 12:45:00
gawk '$3!="*"' in.txt>out.txt
‚Ć‚˘‚¤ˆ—‚ŁA20GB‚Ž‚炢‚Ěin.txt‚𐔕SMB‚Ž‚炢‚ɃXƒŠƒ€ƒAƒbƒv‚ľ‚Ä‚Ü‚ˇB
–â‘č‚́A‚ť‚̏ˆ—‚đ10–{‚Ů‚Ç•Ŕs‚ɍě‹Ć‚ł‚š‚Ä‚˘‚é‚ń‚Ĺ‚ˇ‚Ş
top‚ĹŒŠ‚Ä‚Ý‚é‚Ć‚Ů‚Ć‚ń‚Ç‚ĚgawkƒvƒƒZƒX‚Şsleep‚Šstacked‚É‚Č‚Á‚Ä‚˘‚Ä
‚ ‚ń‚Ü‚č‚ŕ‚č‚ŕ‚č“­‚˘‚Ä‚­‚ę‚Ü‚š‚ńBIO‚Ş—Ľ‘Ź‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
CPU‚ŕƒƒ‚ƒŠ‚ŕĹ‘ĺŒŔĎ‚ń‚Ĺ‚Ü‚ˇB
457 :
2011/01/21(‹ŕ) 12:50:02
stacked -> stuck‚Ĺ‚ľ‚˝B‚ˇ‚˘‚Ü‚š‚ńB
458 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/01/21(‹ŕ) 13:26:09
'$3!="*"'
‚ą‚ę‚Á‚ď‘‚ŤŠÔˆá‚˘H
459 :
2011/01/21(‹ŕ) 13:47:33
í‚ç‚ę‚éƒf[ƒ^‚Ě—á
745_17_70_F3 4 * 0 0 * * 0 0 GGAGTGCCCCACACTTGGAGGCGAGCGCCCGGCAGACTTCCCCGCCGCC &+))8'1%+%-%%'((-)%%)8+,&+*7'+/%5''%%%%%-')-/'%/( XM:i:0

Žc‚éƒf[ƒ^‚Ě—á
745_377_43_F3 0 chr1 181855450 255 48M * 0 0 CATGTATGTGGCCAAAGGAACAACGCTATGTTTCCTAAAAGGCCTAGA G`[[`a`ab`^\ZYZ[SIR\Z[L7I_L>HU^bOKSDES[PO9-HNG7= XA:i:2 MD:Z:26C21 NM:i:1 CM:i:3

‚ą‚¤‚˘‚¤‚Ě‚Ş80–œs‚Ž‚炢‚ ‚é‚悤‚Ĺ‚ˇB
460 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/01/21(‹ŕ) 13:52:48
ƒXƒNƒŠƒvƒg‚Ě’†g‚ÍŽŔŰ‚͈Ⴄ‚í‚Ż‚Ë

‚˝‚Ô‚ńAƒf[ƒ^‚ĚŠi”[ęŠ‚ރvƒƒOƒ‰ƒ€ŽŔsƒ}ƒVƒ“‚Ć•Ę‚Ěƒ}ƒVƒ“‚Ě
ƒfƒBƒXƒN‚Č‚ń‚ś‚á‚Č‚˘‚Š‚ȁB
ƒlƒbƒgƒ[ƒN‚ރrƒW[ó‘Ô‚ž‚ĆŽv‚¤B
461 :
2011/01/21(‹ŕ) 16:09:37
>454-455

‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B
‹““Ž‚đ•Ď‚Ś‚é‘g‚ݍž‚ݕϐ”‚ŕ–ł‚˘‚悤‚Ĺ‚ˇ‚ˁB
462 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/01/21(‹ŕ) 16:47:10
‚Ć‚č‚ ‚Ś‚¸ df ƒRƒ}ƒ“ƒh‚ōě‹ĆƒfƒBƒŒƒNƒgƒŠ‚Ć /var/tmp ‚Ě‹ó‚Ť—Ěˆć‚Ş
Šm•Ű‚ł‚ę‚Ä‚˘‚é‚ą‚ƂƁAo—̓tƒ@ƒCƒ‹‚ĚƒTƒCƒY‚âƒ^ƒCƒ€ƒXƒ^ƒ“ƒv‚ޏ™X‚É
XV‚ł‚ę‚Ä‚˘‚é‚ą‚Ć‚đŠm”F‚ˇ‚é‚­‚炢‚ľ‚Š‚Č‚˘‚ń‚ś‚á‚Č‚˘‚Š‚ȁB
ƒ[ƒJƒ‹ƒfƒBƒXƒN‚Ĺ‚â‚ę‚΂ŕ‚Á‚Ć‘‚˘‚ĆŽv‚¤‚Ż‚ǁB
463 :
2011/01/21(‹ŕ) 17:42:04
>>460
‚Č‚é‚قǁB
xgrid‚đ‚‚Š‚Á‚āA2‘ä‚Ěƒ}ƒVƒ“‚Ĺ10–{‚¸‚‚قǕŔs‚ľ‚Ägawk‚đ‘–‚ç‚š‚Ä‚¨‚č‚Ü‚ľ‚˝B
NFS‚đ‚‚Š‚Á‚Ä5GB‚قǂ́ić‚Ů‚Ç‚Í20GB‚Ə‘‚Ť‚Ü‚ľ‚˝‚ŞŠÔˆá‚˘‚Ĺ‚ˇjin.txt‚Ě
‚Ěƒf[ƒ^‚đ“ǂݍž‚ń‚ŁAˆ—Œă‚Ěƒf[ƒ^‚đout.txt‚ɏ‘‚Ťo‚ľ‚Ä‚˘‚é‚̂ŁA
ƒlƒbƒgƒ[ƒNƒrƒW[‚É‚Č‚Á‚Ä‚ľ‚Ü‚¤‚Ć‚˘‚¤‚í‚Ż‚Ĺ‚ˇ‚ˁB
ƒlƒbƒgƒ[ƒN‚Ě–â‘č‚Ƃ́BBB
ˆę‰žAƒGƒ‰[‚Ĺ‚ą‚Ż‚é‚ą‚Ć‚Č‚­A‚ľ‚ă‚­‚ľ‚ă‚­‚Əˆ—‚͐i‚Ţ‚Ě‚Ĺ‹C‚É‚ľ‚Č‚˘‚ą‚Ć‚É‚ľ‚Ü‚ˇB
464 :
2011/01/21(‹ŕ) 17:44:39
2‘ä‚Ěƒ}ƒVƒ“‚Ĺ20–{‚Ĺ‚ľ‚˝i10+11jBBB
ˆęƒvƒƒZƒX‚ ‚˝‚č5GB‚Ěƒtƒ@ƒCƒ‹‚đ“ǂݍž‚ނ̂ŁAƒlƒbƒgƒ[ƒN‚ޔߖ‚đă‚°‚Ä‚˘‚é‚ƁB
465 :
2011/01/24(ŒŽ) 21:31:50
Ą”NAgawk‚đ‘ĺŠw‚ŏK‚Á‚ĐFX˜M‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁAperl‚Ć‚Š‚ć‚莊—R“x‚Ş’á‚˘‚ĆŒž‚í‚ę‚˝B‚ť‚ń‚Č‚Éˇ‚Ş‚ ‚é‚́H
466 :
2011/01/24(ŒŽ) 21:46:54
>>465
ŠČˆŐŒžŒę‚Ć‚ľ‚Ä‘¨‚Ś‚é‚Šƒc[ƒ‹‚Ć‚ľ‚Ä‘¨‚Ś‚é‚Š‚Ěˆá‚˘‚ś‚á‚ˁ`
‰´ƒp[ƒ‹‚ć‚čƒI[ƒN‚Ě•ű‚ލD‚Ť‚ž‚Ż‚ǁB
467 :
2011/01/24(ŒŽ) 22:19:29
>>466
‚Č‚é‚قǁB‚Ü‚ŸA‚ť‚ń‚Č‚É•ĄŽG‚Č‚ą‚Ć‚đ‚ą‚Č‚ˇƒXƒLƒ‹‚đŽ‚ż‡‚í‚š‚Ä‚Č‚˘‚Š‚ç‚ŕ‚¤Žb‚­awk‚Ĺ—V‚ń‚Ĺ‚Ý‚é‚ŠB
468 :
2011/01/24(ŒŽ) 23:30:11
ŽŠ—R“x‚Ć‚˘‚¤‚ć‚č‚Í‹@”\‚ޏ­‚Č‚˘‚ś‚á‚Č‚˘‚Ě‚ŠH
469 :
2011/01/25(‰Î) 05:02:06
‚ą‚ĚƒXƒŒƒbƒh‚Í“VËƒ`ƒ“ƒpƒ“ƒW[uƒAƒC‚ż‚á‚ńv‚Ş
ŒžŒęŒP—ű‚Ě‚˝‚ß‚É—§‚Ä‚˝‚ŕ‚Ě‚Ĺ‚ˇB

ƒAƒC‚ĆŒ¤‹†ˆő‚Ć‚Ě‚â‚čŽć‚č‚É—˜—p‚ˇ‚éƒXƒŒƒbƒh‚Ȃ̂ŁA
ŠÖŒWŽŇˆČŠO‚͏‘‚Ť‚ą‚Ü‚Č‚˘‚ʼnş‚ł‚˘B

@@@@@@@@@@@@@@@@@@‹ž“s‘ĺŠw—ě’ˇ—ŢŒ¤‹†Š
470 :
2011/01/25(‰Î) 11:23:33
>>467
perlƒ†[ƒU‚Í‚ˇ‚ׂĂđperl‚ž‚Ż‚Ĺ‚â‚낤‚Ć‚ˇ‚éBC/C++/Java‚ŕŽg‚¤ƒ†[ƒU‚Íawk‚Ě•ű‚đD‚ށB
C/C++/Java‚ÉŽč‚đ‰„‚Î‚ˇ‚‚ŕ‚č‚Č‚ç‚Ţ‚ľ‚ëawk‚Ě‚Ů‚¤‚Ş‚˘‚˘‚ćBperl‚ž‚ĆŽŠŒČŠŽŒ‹‚ľ‚Ä‚ľ‚Ü‚¤‚Š‚çB
471 :
2011/01/25(‰Î) 16:02:25
perl‚ć‚čawk‚Ě•ű‚Ş‘Ź‚˘Ž–‚Á‚Ä‚Č‚˘‚ś‚á‚ńB
Ą‚Ěawk‚ĚŽg‚˘“š‚̓ƒ“ƒ‰ƒCƒi[‚đƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĚƒpƒCƒv‚ɍŹ‚ş‚é’ö“x‚Ĺ‚ľ‚ćB
‰´‚́A256”{–{‚Ě’ˇ•ŃƒXƒNƒŠƒvƒg‚đ‚˘‚­‚‚Š‘‚˘‚˝‚Ż‚ǁA
“–Žž‚Í‚Ü‚žperl‚Č‚ń‚ÄŽg‚í‚ę‚Ä‚Č‚Š‚Á‚˝BŽž‘ă‚Şˆá‚¤B
472 :
2011/01/25(‰Î) 18:11:52
>>470
‚ť‚ę‚Í•ÎŒŠ‚ž‚ë
autoconf‚Č‚Ç‚Ě”ńí‚ÉŠî–{“I‚Čƒc[ƒ‹‚Ĺ‚ŕPerl‚ŞŽg‚í‚ę‚Ä‚˘‚é‚ľ
openssl‚̂悤‚Éconfigure‚́iŽĺ‚ÉWindows—p‚́jƒ|[ƒ^ƒrƒŠƒeƒB‚đă‚°‚é‚˝‚ß‚É
Perl‚đ—˜—p‚ľ‚Ä‚˘‚é‚ŕ‚Ě‚ŕ‚ ‚é

ŒžŒę‚Ě“KŤ‚đ‚í‚Š‚Á‚˝ă‚Ĺ“KŢ“KŠ‚ĹŽg‚Ś‚΂˘‚˘‚ń‚ž‚ć
473 :
2011/01/25(‰Î) 21:08:21
“ú–{‘ŰÜ
u•Äƒxƒ‹Œ¤‹†Š“Á•Ę–ź—_‹ZŽt‚ĚƒfƒjƒXEƒŠƒbƒ`[”ŽŽmi‚U‚Xj‚Ć•ÄƒO[ƒOƒ‹ŽĐ“Á•Ę‹ZŽt‚ĚƒPƒ“Eƒgƒ“ƒvƒ\ƒ“”ŽŽmi‚U‚Vjv

–ˆ“ú‚Š‚ - –ˆ“úV•ˇ‚Ěƒjƒ…[ƒXEî•ńƒTƒCƒg
http://mainichi.jp/select/science/news/m20110126k0000m040012000c.html
474 :
2011/01/25(‰Î) 21:29:34
>>471
>Žž‘ă‚Şˆá‚¤B

Žž‘ă‚ĆŒž‚¤ˆÓ–Ą‚ł́AĹ‹ß‚̓fƒtƒH‚Ĺ Python ‚Ş“ü‚Á‚Ä‚˘‚˝‚股‚é‚Ě‚Ĺ
Perl ‚đŽg‚¤‚Č‚ç Python ‚đ‘I‚ń‚ś‚Ⴄ‚ȁB

‚ ‚ń‚Ü‚č‘Ź‚ł‚đ‹Ł‚¤ŽdŽ–‚đ‚ľ‚Ä‚˘‚Č‚˘‚̂ƁAƒƒ“ƒ‰ƒCƒi[‚đ‘‚­Ž–‚Ş
‘˝‚˘‚̂ŁAawk ‚ŕâŽ^‘ĺŠˆ–ô‚ľ‚Ä‚˘‚é‚Ż‚ǁB

Perl ‚ރtƒ‹ƒZƒbƒg‚ĚŒžŒę‚Č‚ç awk ‚Í DSL ‚Ý‚˝‚˘‚Č•¨‚ŁAŒÂl“I‚É‚Í
awk ‚Ě•ű‚Ş‹CˆŔ‚­‘‚Ż‚é‹C‚Ş‚ˇ‚éB
475 :
2011/01/25(‰Î) 21:57:07
python‚́AƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚ĹŽg‚˘‚É‚­‚˘B
-c‚Ĺˆř”‚Éˆę‰žƒRƒ}ƒ“ƒh“n‚š‚é‚Ż‚ǁAƒCƒ“ƒfƒ“ƒg‚Ě–â‘č‚Ş‚ ‚é‚ľA
perl‚Ě-p‚â-n‚Ý‚˝‚˘‚É•W€“ü—Í‚Ěƒ‹[ƒv“n‚š‚Č‚˘‚Š‚çB
476 :
2011/01/25(‰Î) 22:04:34
Žż–â‚ł‚š‚ĉş‚ł‚˘

ŽŸ‚̂悤‚ČƒeƒLƒXƒg‚Ş‚ ‚é‚Ć‚ľ‚Ü‚ˇ
aaaaa 10 20 10 5
aaabb 5 10 10 10
aaabb 5 5 5 5
aabaa 5 20 20 30
aabbb 10 10 5 5
bbaaa 10 10 10 10
bbbaa 5 10 10 5
bbbbb 10 5 5 30

‚ą‚ą‚ŁAaaaaa‚Č‚Ç‚ÍŒÂl‚Ě–ź‘O‚Ĺ‚Š‚A3•śŽš–Ú‚Ü‚Ĺ‚ŞŠA4`5•śŽš–Ú‚Ş–ź‘OA‚Ü‚˝”Žš‚ޏo”ď‚ž‚Ć‚ľ‚Ä
Še˘‘Ń‚Ěo”ď‚đo—Í‚ľ‚˝‚˘‚ƍl‚Ś‚Ä‚˘‚Ü‚ˇB

aaa 20 35 25 20
aab 15 30 25 35
bba 10 10 10 10
bbb 15 15 15 35

‚Ć‚Č‚Á‚Ä—~‚ľ‚˘–ó‚Ĺ‚ˇB
477 :
2011/01/25(‰Î) 22:18:47
‚ōĄl‚Ś‚Ä‚˘‚é•ű–@‚Ć‚ľ‚Ä‚Í

substr($1,1,3) ‚ŐŠ‚𔝒肾‚Ä
“Ż‚śŠ‚Č‚çA˘‘Ń‚đ‰ÁŽZ‚ľ‚čs‚­
ˆá‚¤Š‚É‚Č‚Á‚˝ƒ^ƒCƒ~ƒ“ƒO‚Ĺ1‚‘O‚Ě‰Ć‚Ě‰ĆŒv‚đ@print@‚ľ‚Ä
‚ł‚ç‚ÉŠeo”ď‚đ‰Šú‰ť‚ˇ‚é
ŽŸ‚̍s‚ɈڂÁ‚Ä“Ż‚ś˘‘Ń‚Č‚ç‰ÁŽZ

‚Ć‚˘‚¤Š´‚ś‚ĹƒXƒNƒŠƒvƒg‚đ‘g‚Ý‚˝‚˘‚ń‚Ĺ‚ˇ‚ލޖ{“I‚Č‚Ć‚ą‚ë‚Ĺ‚â‚č•ű‚Ş•s–Ą‚˘‚Ĺ‚ľ‚傤‚ŠH
478 :
2011/01/25(‰Î) 22:34:21
˜A‘z”z—ń‚Ć‚Š‚ś‚á‘Ę–Ú‚Č‚Ě‚ŠH

name[$1] += 1
479 :
2011/01/26(…) 01:13:08
>>476-477
‘S‚ĘA‘z”z—ń‚É—­‚ߍž‚ń‚ŁA ĹŒă‚Ĺˆę‹C‚ɏo—Í‚ľ‚˝•ű‚Ş—Ç‚­‚Č‚˘‚Š?
>>477 ‚Ě•ű–@‚ž‚ƁA o—Í‚đs‚¤‰ÓŠ‚Ş
"Š‚Ş•Ď‚í‚Á‚˝‚Ć‚Ť" ‚Ć "ƒeƒLƒXƒg‚ޏI‚í‚Á‚˝‚Ć‚Ť" ‚É•ŞŽU‚ľ‚Ä‚ľ‚Ü‚¤B

{
    a = substr($1,1,3);
    b[a] += $2;
    c[a] += $3;
    d[a] += $4;
    e[a] += $5;
}
END {
    for (f in e) print f,b[f],c[f],d[f],e[f];
}
480 :
2011/01/26(…) 20:18:53
>>474
OS(Linux)‚đƒfƒtƒH‚ž‚Ż‚ĹŽg‚¤‚ą‚Ć‚Í‚Ü‚¸‚ ‚č‚Ś‚Č‚­‚āA
‰˝‚Š‚ľ‚ç’ljÁƒpƒbƒP[ƒW‚Ş•K—v‚É‚Č‚é‚Í‚¸‚ž‚Š‚çA
Python‚ރfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚鎖‚ÍŽŔ—p–Ę‚Ĺ•]‰ż‘ÎŰ‚É‚Í‚Č‚ç‚ń‚ĆŽv‚¤B

ŽŠ•Ş‚ÍDebian‚đƒƒCƒ“‚ÉŽg‚¤‚Ż‚ǁAƒCƒ“ƒXƒg[ƒ‹Žž‚ɂ̓x[ƒXƒVƒXƒeƒ€‚ž‚Ż‚đ‘I‚сA
‚ť‚ę‚Ésshd‚Ćruby‚đ’ljÁ‚ˇ‚é‚Ě‚ŞƒfƒtƒH‚Č‚ń‚Ĺ‹C‚É‚Č‚ç‚Č‚˘B
Mac‚Č‚çPython/Ruby‚Ć‚ŕƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚é‚Š‚ç–ł–â‘č‚ž‚ľA
Win‚Č‚ç‚Ç‚ż‚ç‚ŕƒfƒtƒH‚ś‚á“ü‚Á‚Ä‚˘‚Č‚˘‚Š‚ç“Ż‚śB

‚Ü‚˝“úí“I‚ČƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ÉŠÖ‚ľ‚āARuby‚Ěę‡‚ÍˆČ‰ş‚̂悤‚ɃŠƒXƒg\‘˘‚đ
ƒVƒFƒ‹‚ĚƒpƒCƒvƒ‰ƒCƒ“Š´Šo‚ŏ‘‚Ż‚é‚Ě‚ŞŠđ‚ľ‚˘B
@hoge_list.select { |x| ....}.sort { |x,y| .... }.map { |x| .... }.inject(n) {|x, i| .... }
ƒuƒƒbƒN(ƒNƒ[ƒWƒƒ)‚Ě–ł‚˘Pyton/Perl‚ł́A‚ą‚¤‚˘‚Á‚˝‚¨‹CŒy‚ȏ‘‚Ť•ű‚Í‚Ĺ‚Ť‚Č‚˘B

‚ž‚Š‚ç“úí“I‚ČŠˆ–ô“x‚Ĺ”äŠr‚ˇ‚é‚ƁAŽŠ•Ş‚Ěę‡‚́Abash > awk > ruby ‚É‚Č‚éB
Šî–{‚Íbash‚ŁA–Ę“|‚Č•śŽš—ńˆ—‚Ş‚ ‚ę‚Îawk‚đƒƒ“ƒ‰ƒCƒi[‚Ĺ–„‚ߍž‚Ţ‚Ě‚Şƒpƒ^[ƒ“B
‚ŁAFX‚Ć‹@”\‚đ’ljÁ‚ľ‚Ä‚Ť‚ÄbashƒvƒƒOƒ‰ƒ~ƒ“ƒO‚ޏd‰×‚ÉŠ´‚ś‚ç‚ę‚é‚悤‚É‚Č‚čA
‚Č‚¨‚Š‚”ėpŤ‚Ě‚ ‚é(Ä—˜—p‚̉”\Ť‚Ş‚ ‚é)ƒc[ƒ‹‚Ĺ‚ ‚ę‚΁Aˆę‹C‚Éruby‚ɏ‘‚ŤŠˇ‚Ś‚éB

Python‚Í–{Ši“I‚ČŠJ”­‚Ĺ‚ ‚ę‚Î(Ruby‚ć‚č‚ŕ)—D‚ę‚˝–Ę‚Ş‘˝X‚ ‚é‚ĆŽv‚¤‚Ż‚ǁA
(>>475‚ĚŽw“E‚ŕŠÜ‚ß‚Ä)‚¨ŽčŒy‚ł/‚¨‹CŒy‚ł‚ÉŒŔ‚é‚Ć(Ruby‚ć‚č‚ŕ)Žg‚˘‚Ă‚ç‚­Š´‚ś‚éB
‚ŕ‚ż‚ë‚ńbashƒXƒNƒŠƒvƒg(or Makefile)‚É–„‚ߍž‚Ţƒƒ“ƒ‰ƒCƒi[‚Ĺ‚ ‚ę‚΁Aawk ‚ރxƒXƒgB
481 :
2011/01/26(…) 21:22:28
>>474‚Ć‘S‚­“Ż‚śˆÓŒŠ‚ž‚íB

‹Ć–ą‚ĹŽg‚¤Ž–‚Ş‘˝‚˘RHEL‚Í—]Œv‚Č•¨‚Í‚Ů‚Ć‚ń‚Ç“ü‚ę‚Ä‚Č‚˘B
PythonAPerl‚ރfƒtƒH‚Ĺ“ü‚Á‚Ă銴‚śB

ĚAUNIX‚đˆľ‚Á‚Ä‚˝ ‚ÍPerl‚Č‚çƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˝‚̂ŁAŠo‚Ś‚悤‚Ć‚ľ‚˝‚Ż‚ÇŒ‹‹Çg‚ɂ‚Š‚¸B
shAsedAawk‚Ĺ‚Ş‚ń‚΂Á‚Ä‚˝B
482 :
2011/01/27(–Ř) 00:10:46
>>480
ƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚é‚Ě‚ŞŠđ‚ľ‚˘‚̂́AŽŠ•Ş‚̊‹Ť‚ž‚Ż‚Ĺ‚Č‚­A‘źl‚̊‹Ť‚Ĺ‚ŕ
Žg‚Ś‚鎖‚Ş•ŰŘ‚ł‚ę‚Ä‚˘‚鎖‚ž‚ćB’N‚Š‚ÉŽg‚Á‚Ä‚ŕ‚炤ˆ×‚ĚƒR[ƒh‚đ‘‚­Žž‚ɁA
ƒpƒbƒP[ƒW‚̒ljÁ‚đ‚¨Šč‚˘‚ľ‚Č‚­‚Ä—Ç‚˘‚Ě‚Í‚Ć‚Ä‚ŕŠyB“Á‚ɁA‚ť‚ę‚ŞŽdŽ–‚Ĺ
Žg‚í‚ę‚Ä‚˘‚éŠÂ‹Ť‚Č‚çŽXB

ƒTƒ|[ƒg‚âƒgƒŒ[ƒjƒ“ƒO‚ĚŽdŽ–‚đ‚ľ‚˝Ž–‚Ş‚ ‚él‚Č‚ç—‰đ‚ľ‚Ä‚ŕ‚ç‚Ś‚é‚ĆŽv‚¤B
483 :
2011/01/27(–Ř) 03:47:36
AWK‚́ANEC PC-9801‚ĚMS-DOS‚Ĺ‚ŕ‚¤‚˛‚˘‚˝BAWK95.exe‚́A“ú–{Œę‚ɑΉž‚ľ‚Ä‚Č‚˘
484 :
2011/01/27(–Ř) 05:04:18
AWK‚ĚŠˆ–ô‚ˇ‚éę–ʂ́A‚â‚Á‚Ď‚čƒeƒLƒXƒgˆ—‚ž‚ĆŽv‚¤B
‚ť‚Ě‚ż‚ĺ‚Á‚Ć•ĄŽG”Ĺ‚Ć‚ľ‚ÄŽg‚¤‚Č‚çPerl‚Š‚ȁB
‘g‚ݍž‚݃‰ƒCƒuƒ‰ƒŠ‚ރeƒLƒXƒgˆ—‚É“Á‰ť‚ľ‚Ä‚é‚Š‚çB

Python‚͐ł‹K•\Œť‚ŞŒžŒę‚É‘g‚ݍž‚Ü‚ę‚Ä‚Č‚Š‚Á‚˝‚č‚Ć
ƒeƒLƒXƒgˆ—‚͎ኹ‚â‚č‚É‚­‚˘ˆóŰ‚Ş‹­‚˘B
‚ť‚Ě•ŞAƒeƒLƒXƒgˆ—ˆČŠO‚Č‚çŒ‹\Žg‚¤‚Ż‚ǂˁB
485 :
2011/01/27(–Ř) 05:27:26
>>482
‚ ‚ A‚ť‚ę•Ş‚Š‚é‚íB‹Ć–ąƒ}ƒVƒ“‚Ć‚ľ‚ÄŽg‚¤¤—pUNIX(HP-UX/Solaris/AIX)‚ž‚Ć
Ruby‚Ç‚ą‚ë‚ŠPython/Perl‚ˇ‚çƒfƒtƒH‚ś‚á“ü‚Á‚Ä‚˘‚Č‚˘‚ľA‚ť‚¤‚˘‚Á‚˝
ƒtƒŠ[ƒ\ƒtƒg‚Ě—Ţ‚˘‚ÍŒ´‘Ľ‚Ć‚ľ‚ĈęŘƒCƒ“ƒXƒg[ƒ‹‹ÖŽ~‚Ć‚˘‚¤ŠÂ‹Ť‚ŕ‚ ‚éB
(Web/Mail‚Ć‚˘‚Á‚˝InternetŒnƒT[ƒo‚͕ʂˁB‚ ‚­‚Ü‚Ĺ‹Ć–ąƒ}ƒVƒ“ŒŔ’č‚Ě˜bB)

‚ž‚Š‚珤—pUNIXƒ†[ƒU‚́AƒfƒtƒH‚Ĺ“ü‚Á‚Ä‚˘‚éƒc[ƒ‹‚É’ˇ‚Ż‚é‚ą‚Ć‚É‚Č‚éB
‚â‚Á‚Ď‚č–{•¨‚ĚUNIXƒvƒ‚đŽŠĚ‚ˇ‚é‚Ě‚Č‚çApython/ruby‚Ĺ‚Í‚Č‚­sh/awk‚ž‚ľA
emacs/vim‚Ĺ‚Í‚Č‚­viAlatex‚Ĺ‚Í‚Č‚­roff‚đ‘I‚ԂׂŤ‚ž‚ć‚ˁB
486 :
2011/01/27(–Ř) 06:50:40
>>484
>Python‚͐ł‹K•\Œť‚ŞŒžŒę‚É‘g‚ݍž‚Ü‚ę‚Ä‚Č‚Š‚Á‚˝‚č‚Ć

‚ցH
487 :
2011/01/27(–Ř) 07:07:12
>>486
‚ńHŒžŒę‚É‚Í‘g‚ݍž‚Ü‚ę‚Ä‚Č‚˘‚ž‚ëHƒ‰ƒCƒuƒ‰ƒŠ‚Ć‚ľ‚Ä‘g‚ݍž‚Ü‚ę‚Ä‚é‚ž‚Ż‚ŁB
‚ž‚Š‚琳‹K•\ŒťƒŠƒeƒ‰ƒ‹‚Ć‚Š–ł‚˘‚ľAimport‚Č‚ľ‚É‚ÍŽg‚Ś‚Č‚˘B
488 :
2011/01/27(–Ř) 07:10:47
ƒŠƒeƒ‰ƒ‹‚ž‚Ɖ˝‚Š—Ç‚˘‚ą‚Ć‚ ‚é‚́H
489 :
2011/01/27(–Ř) 07:13:35
•śŽš—ń‚Šƒpƒ^[ƒ“‚Š‹ć•Ę‚ľ‚₡‚˘B
490 :
2011/01/27(–Ř) 07:16:17
‚ ‚ƁAƒ}ƒbƒ`ƒ“ƒO‚Ě•\‹L‚ŞŽŠ‘RB
491 :
2011/01/27(–Ř) 09:03:47
>>485
Solaris ‚̓fƒtƒH‚Ĺ Perl ‚ŕ Python ‚ŕ“ü‚Á‚Ä‚é‚ć
‚ŕ‚ż‚ë‚ń“ü‚ę‚Č‚˘Ž–‚ŕo—ˆ‚é‚Ż‚Ç
492 :
2011/01/28(‹ŕ) 15:46:44
>>491
‚ť‚ę‚ÍŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚Ĺ—p“r‚Ć‚ľ‚ăfƒXƒNƒgƒbƒv‚ ‚邢‚̓Cƒ“ƒ^[ƒlƒbƒgƒT[ƒo‚đ
‘I‘đ‚ľ‚˝ę‡‚Ě˜b‚ś‚á‚Č‚˘‚Ě‚Š‚ȁBŠî–{ƒVƒXƒeƒ€‚Éperl/python‚ÍŠÜ‚Ü‚ę‚Ä‚˘‚Č‚˘‚Í‚¸B
‚ť‚ĚŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚ŕŠÜ‚߂ăfƒtƒH‚Ĺ‚ ‚é‚Ć‚ˇ‚é‚Č‚çADebian‚ŕ“Ż‚śB
ƒJƒeƒSƒŠ‚ĹƒfƒXƒNƒgƒbƒv‚đ‘I‚ׂ΁uruby‚ŕƒfƒtƒHv‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚éB(RHL‚Í’m‚ç‚ń)
ŽŠ•Ş‚Í—]Œv‚Č•¨‚Í“ü‚ę‚˝‚­‚Č‚˘‚Š‚çŠî–{ƒVƒXƒeƒ€‚đ‘I‚ń‚Ĺ‚é‚Ż‚ǂˁB

‚‰Â—pŤ‚đ—v‹‚ł‚ę‚éŠîŠ˛‹Ć–ąƒVƒXƒeƒ€‚Ěę‡AŽŠ•Ş‚ÍHP-UX‚đˆľ‚¤ƒP[ƒX‚Ş‘˝‚˘‚Ż‚ǁA
ƒfƒtƒH‚Ĺ‚ÍŠî–{ƒVƒXƒeƒ€‚đ‘I‚ŃŽ–‘O‚ɐ݌v‚ľ‚˝ƒpƒbƒP[ƒW‚Ě‚Ý‚đ’ljÁ‚ˇ‚é‚Ě‚Ş“S‘ĽB
‚Č‚ş‚Č‚çƒ[ƒJ‚ĚƒTƒ|[ƒg‚ŞŽó‚Ż‚ç‚ę‚Č‚˘A‚ ‚邢‚Í‚ ‚Š‚ç‚ł‚Ü‚ÉŒ™‚ČŠç‚đ‚ł‚ę‚é‚Š‚çB
‚ť‚ń‚Ȋ‹Ť‚ž‚ƁAu^‚ɃfƒtƒHv‚Čsh/csh/sed/awk‚Ş‘ĺŠˆ–ô‚ľ‚Ä‚˘‚˝‚股‚éB
493 :
2011/01/28(‹ŕ) 17:06:59
>>492
Solaris ‚ĚƒfƒtƒHƒ‹ƒg‚Í "Entire Distribution" ‚Ć‚˘‚¤ƒpƒbƒP[ƒW‚ĚƒZƒbƒg‚ž‚ćB
ƒCƒ“ƒXƒg[ƒ‰[‚ĹƒfƒtƒHƒ‹ƒg‚Ĺ‘I‘đ‚ł‚ę‚Ä‚˘‚é‚Ě‚Ş‚ą‚ę‚ž‚ľAƒvƒŠƒCƒ“ƒXƒg[ƒ‹
‚ł‚ę‚Ä‚˘‚é‚Ě‚ŕ‚ą‚ę‚É‹ß‚˘‚ŕ‚́B‚ť‚ą‚É‚Í Perl ‚ŕ Python ‚ŕ“ü‚Á‚Ä‚éB
ƒCƒ“ƒXƒg[ƒ‹‚ˇ‚éŰ‚Ě‘I‘đŽˆ‚Ĺ "Core System" ‚đ‘I‚ׂΠPerl ‚â Python ‚Í
“ü‚ç‚Č‚Š‚Á‚˝‚ĆŽv‚¤‚Ż‚ǁA‚ą‚ę‚đƒfƒtƒHƒ‹ƒg‚ĆŒÄ‚Ô‚Ě‚Í‚ż‚ĺ‚Á‚Ć–ł—‚Ş‚ ‚é‚ĆŽv‚¤‚íB

‚ť‚ę‚ƁAŠČˆŐƒCƒ“ƒXƒg[ƒ‹‚Ć‚ŠƒJƒeƒSƒŠ‚ĹƒfƒXƒNƒgƒbƒv‚Ć‚Š^‚ɃfƒtƒH‚ĆŒž‚Á‚˝•¨‚Í
Solaris ‚É‚Í‘śÝ‚ľ‚Č‚˘BDebian ‚Í’m‚ç‚ńB
494 :
2011/01/28(‹ŕ) 20:11:40
Solaris2.6‚ ‚˝‚č‚ĚƒfƒtƒH‚ĹPerl‚Í“ü‚Á‚Ä‚˝‹L‰Ż‚Ş‚ ‚éB
15”N‚­‚炢‘O‚ĚHP-UX‚ž‚ĆPerl‚Ş“ü‚Á‚Ä‚Č‚Š‚Á‚˝‹L‰Ż‚ށB
495 :
2011/01/29(“y) 00:42:19
‰´‚ŕHP-UXƒƒCƒ“‚ž‚Ż‚ÇPerl“ü‚Á‚Ä‚Č‚˘‚í
496 :
2011/01/29(“y) 00:47:55
Šm‚Š‚ɁASolaris‚ÉŠľ‚ę‚Ä‚˘‚ÄHP-UXŽg‚í‚ł‚ę‚é‚ĆŽg‚˘‚É‚­‚˘‚í[
497 :
2011/01/29(“y) 07:33:12
‚ĆŒž‚¤‚í‚Ż‚ŁAUN*XƒT[ƒoŠÇ—ŽŇ‚Ěę‡‚Íawk‚đŽg‚Ś‚é‚悤‚É‚Č‚Á‚Ä‚¨‚Ż‚ÎŠÔˆá‚˘‚ ‚č‚Ü‚š‚ń‚ˁB
498 :
2011/01/29(“y) 10:56:30
ŠÂ‹Ť‚đ‘I‚΂Ȃ˘ƒT[ƒoŠÇ—‚ž‚Á‚˝‚çAsh,grep,sed,tr,cut,paste,sort,uniq‚ ‚˝‚č‚ŁB
nawk‚Ćgawk‚ĚŽd—lˇ‚ŞŒ‹\‚ ‚é‚̂ŁAawk‚ÍŽg‚˘‚É‚­‚˘B
499 :
2011/01/29(“y) 13:15:51
‚ą‚¤‚˘‚¤˜b‘č‚ĚŽž‚ÉSolaris‚Ć‚ŠHP-UX‚͏o‚é‚Ě‚ÉAIX‚͏o‚Č‚˘ƒCƒ[ƒW
500 :
2011/01/29(“y) 13:40:55
“ú–{’jŽ™‚Č‚çHI-UXA“Á‚ÉHI-UX/WE2‚ž‚ëBíŽŻ‚â‚Ë
501 :
2011/01/29(“y) 14:15:09
‚¤‚Ţ
502 :
2011/01/29(“y) 16:56:12
‚˘‚â‚ą‚ą‚ÍedƒXƒNƒŠƒvƒg‚Ĺ
503 :
2011/01/29(“y) 18:47:15
Solaris‚́A/usr/bin/awk /usr/bin/nawk /usr/xpg4/bin/awk
3‚•ʁX‚Č‚Ě‚Ş“ü‚Á‚Ä‚˝‹C‚Ş‚ˇ‚é‚ȁB
‚ŁAˆę”Ô‚Ü‚Ć‚ŕ‚Č‚Ě‚Ş3”ԖڂȂ̂ŁA‚ć‚ť‚Š‚玝‚Á‚Ä‚Ť‚˝ƒXƒNƒŠƒvƒg‚́Ać“Ş‚Ě#!‚đ
‘‚ŤŠˇ‚Ś‚Č‚˘‚Ć‚˘‚Ż‚Č‚˘‚Ć‚˘‚¤AƒJƒIƒX‚ȏó‘Ô‚ś‚á‚Č‚Š‚Á‚˝‚ž‚낤‚ŠB
504 :
2011/01/29(“y) 19:23:53
>>503
ŽŠ•ŞƒAƒJƒEƒ“ƒg‚ĚƒpƒX‚͐^‚Áć‚É /usr/xpg4/bin/‚đŽ‚Á‚Ä‚Ť‚Ä‚˝‚íB
505 :
2011/01/29(“y) 19:25:17
ƒXƒNƒŠƒvƒg‚đ‘g‚ŢŽž‚Í‚ž‚˘‚˝‚˘ nawk ‚đŽg‚¤
‘źl‚ĚƒXƒNƒŠƒvƒg‚đŠŰƒpƒNƒŠ‚ˇ‚é‹@‰ď‚Ş–ł‚˘‚Ě‚ĹƒJƒIƒX‚ÍŠ´‚ś‚˝Ž–‚Ş–ł‚˘
506 :
2011/01/29(“y) 19:32:53
>>505
˜b‚Ě—Ź‚ę‚Ş>>497 >>498‚Ȃ̂ŁA‰Â”ŔŤ‚Ş–â‘č‚Č‚ń‚ž‚ćB
507 :
2011/01/29(“y) 19:39:08
ƒEƒ`‚Í RHEL ‚Ć Solaris ‚ž‚Żl‚Ś‚ę‚Ηǂ˘‚Š‚çAawk ‚Ĺ–â‘č‚Ş‚ ‚鎞‚Í Perl ‚Š Python ‚ĹĎ‚Ü‚ˇ‚í
508 :
2011/01/30(“ú) 05:43:19
#!/usr/bin/env [gn]*awk
‚ž‚ëíl
509 :
2011/02/01(‰Î) 10:39:45
shebangs‚É /usr/bin/env ‘‚­‚Ě‚Á‚Ä‚ ‚ń‚Ü—Ç‚˘‚ĆŽv‚Ś‚Č‚˘‚ń‚ž‚ć‚Č‚ 
•Ą”‚Ěˆř”‚Ěˆľ‚˘‚Ć‚ŠAŠÂ‹Ť•Ď”‚đ‚ť‚ą‚܂ŐM—p‚ľ‚Ä—Ç‚˘‚ŕ‚Ě‚Č‚Ě‚Š‚Ć‚Š
‚ ‚Ć /usr/bin/ ‚É env ‚Ş‚ ‚é‚ą‚Ć‚Í–{“–‚É•ŰŘ‚Ĺ‚Ť‚é‚Ě‚Š‚Ć‚Š
/bin/sh ‚đ‘‚˘‚˝‚Ů‚¤‚Ş—Ç‚˘‚ń‚ś‚á‚Č‚˘‚Š‚Á‚ÄŽv‚Á‚Ä‚ľ‚Ü‚¤
510 :
2011/02/01(‰Î) 11:45:20
‚ą‚Ě˜b‘č‚ŕ’č”Ô‚ž‚ȁB‘OƒXƒŒ‚Ě558-564‚Ĺ‚ŕ‚â‚Á‚Ä‚˝‚źB‚Ć‚č‚ ‚Ś‚¸Œ‹˜_‚ž‚Ż‚đˆř—p‚ľ‚Ć‚­‚íB

>’˛‚ׂĂ݂˝‚ç#!‚ɃCƒ“ƒ^[ƒvƒŠƒ^‚Ěˆř”‚đ2‚ÂˆČă—^‚Ś‚˝‚Ć‚Ť‚Ě
>‹““Ž‚ÍOS‚É‚ć‚Á‚ĈႤ‚悤‚ž‚Á‚˝B
>
>FreeBSD4.2: 2‚ÂˆČă‚ ‚Á‚Ä‚ŕ“n‚é(/usrbin/env gawk -f foo)
>Linux(2.6.8): ‹ó”’‚đŠÜ‚ß‚Ä1‚Â‚Ěˆř”‚Ć‚ľ‚Ä“n‚é(/usr/bin/env "gawk -f" foo)
>Soraris(5.8): 2‚Â‚ßˆČ~‚Ěˆř”‚Í–łŽ‹(/usr/bin/env gawk foo)
>
>Œ‹‹Ç/usr/bin/envŽg‚Á‚˝‘‚Ť•ű‚Ígawk‚ĚƒCƒ“ƒXƒg[ƒ‹ˆĘ’u‚̍ˇ‚đ
>‹zŽű‚ľ‚悤‚Ć‚ľ‚Ä‚é‚ń‚ž‚낤‚ށA“Žě‚ÍOS‚É‚ć‚Á‚Ä‚Ä‚ń‚ł΂ç‚΂ç
>‚Č‚Ě‚Ĺ‚ ‚܂肨ŠŠ‚ß‚Ĺ‚Ť‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć‚ž‚낤‚ŠB
511 :
2011/02/02(…) 00:12:39
ruby ŠEŒG‚Ĺ‚ŕ—Źs‚Á‚Ä‚é‚Č
ˆÓ–Ą‚ŕ”ť‚炸u‚¨‚Ü‚ś‚Č‚˘v‚ĆĚ‚ľ‚ÄŽg‚Á‚Ă邤‚ż‚É
“sŽs“`ŕ‰ť‚ľ‚Ä‚˘‚­‚ń‚ž‚Č
512 :
2011/02/03(–Ř) 22:33:59
‚Č‚ş gawk ‚É‚Í tr ‚Ş–ł‚˘‚Ě‚ž
tr("‚`-‚y","A-Z")‚Ć‚Š‚ľ‚˝‚˘‚ź
513 :
2011/02/04(‹ŕ) 03:31:02
‚Â Python
514 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/02/04(‹ŕ) 09:10:06
>>512

BEGIN {
hankaku="0 1 2 3 4 5 6 7 8 9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z a b c d e f g h i j k l m n o p q r s t u v w x y z "
zenkaku="‚O‚P‚Q‚R‚S‚T‚U‚V‚W‚X‚`‚a‚b‚c‚d‚e‚f‚g‚h‚i‚j‚k‚l‚m‚n‚o‚p‚q‚r‚s‚t‚u‚v‚w‚x‚y‚‚‚‚ƒ‚„‚…‚†‚‡‚ˆ‚‰‚Š‚‹‚Œ‚‚Ž‚‚‚‘‚’‚“‚”‚•‚–‚—‚˜‚™‚š"
}
{
for (i=0; i<length(hankaku); i+=2) {
gsub(substr(hankaku,i+1,1),substr(zenkaku,i+1,2))
}
}
515 :
2011/02/04(‹ŕ) 09:20:39
‚ť‚ę‚ž‚Ćtr('ab', 'ba')‚Ş‚¤‚Ü‚­‚˘‚Š‚Č‚˘‚ń‚ž‚ć‚Č‚ŸB
516 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/02/04(‹ŕ) 09:54:40
“Ż‚śŽ–‚ś‚á‚ń
517 :
2011/02/04(‹ŕ) 19:22:21
”Ä—p“I‚É‚P‚ě‚Á‚Ć‚Ż‚΂˘‚˘‚ś‚á‚ń
518 :
2011/02/05(“y) 20:23:34
>514‚Ý‚˝‚˘‚Čƒxƒ^‘Ĺ‚ż‚ś‚á‚Č‚­‚Ä

A-Z‚ -‚ń

‚ą‚¤‚˘‚¤•\‹L‚Ĺ’uŠˇ‚ˇ‚é•ű–@‚ ‚éH
519 :
2011/02/05(“y) 20:37:26
>>518
tr Žg‚Ś‚΁H
520 :
2011/02/06(“ú) 03:05:39
tr ƒRƒ}ƒ“ƒh‚Á‚Ċ‹Ť‚É‚ć‚Á‚ă}ƒ‹ƒ`ƒoƒCƒg‚Ěˆľ‚˘‚ވá‚í‚ˁHƒEƒ`‚Ěę‡
Ubuntu10.04‚É“ü‚Á‚Ä‚étr(GNU coreutils)7.4‚Í‚Ç‚¤‚â‚ç2•śŽšˆľ‚˘‚É‚ľ‚ż‚Ⴄ‚ç‚ľ‚˘‚Ş
MacOSX10.5‚É“ü‚Á‚Ä‚étriƒo[ƒWƒ‡ƒ“”ť‚ç‚ń‚ŞmanŒŠ‚é‚ĆBSDŒn‚Ű‚˘j‚Í1•śŽšˆľ‚˘‚É‚ľ‚Ä‚­‚ę‚˝
521 :
2011/02/06(“ú) 05:00:06
UNICODE = •śŽš”
mbcs = ƒoƒCƒg”
522 :
2011/02/07(ŒŽ) 08:10:44
‚ń[‚ƁA‚Ç‚ä‚ą‚ƁH
gnome-terminal‚̓†ƒjƒR[ƒhÝ’č‚Ě‚Í‚¸‚Č‚ń‚ž‚ށc
‘ź‚É‚â‚ç‚Č‚Ť‚Ⴂ‚Ż‚Č‚˘‚ą‚Ć‚Ş‚ ‚é‚Á‚Ä‚ą‚ƁH
523 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/02/09(…) 23:11:37
awk++Žg‚Á‚Ä‚él‚˘‚éH
http://awk.info/?doc/dsl/awkplusplus.html
524 :
2011/02/10(–Ř) 14:20:51
Ĺ‹ßAawk‚Ě‘śÝ‚đ’m‚č‚Ü‚ľ‚˝B
‚˘‚ë‚ń‚ČŒžŒę‚đG‚Á‚Ă͍ÁÜEEEG‚Á‚Ă͍ÁÜEEE‚đŒJ‚č•Ô‚ľ‚Ä‚˘‚Ü‚ľ‚˝B
awk‚͉˝‚Ć‚Č‚­ƒ}ƒXƒ^[o—ˆ‚ť‚¤‚Č‹C‚Ş‚ľ‚Ü‚ˇB
‚ą‚ę‚Š‚çŠć’Ł‚č‚Ü‚ˇII
‚Q‚T‚U”{‚Ě–{‚đĄ‚Í“Ç‚ń‚Ĺ‚¨‚č‚Ü‚ˇB
525 :
2011/02/16(…) 02:02:44
gawk‚ĹƒtƒB[ƒ‹ƒh‚đƒ\[ƒg‚ľ‚Ä•\ŽŚ‚ľ‚˝‚˘‚ń‚ž‚Ş
{split($0, a);asort(a);for(i=1;i<NF;i++){printf("%s%s", a[i], FS);}printf("%s\n", a[NF]);}
‚ć‚č‚ŕƒXƒ}[ƒg‚Č•ű–@‚ ‚éH

$1`$NF‚Ş“ü‚Á‚˝“ÁŽę”z—ń‚Ý‚˝‚˘‚Č‚Ě‚Ş‚ ‚Á‚˝‚炤‚ę‚ľ‚˘‚Ě‚ž‚ށB
526 :
2011/02/16(…) 07:22:58
>>525
$i‚Ć‚Š‘‚Ż‚é‚ľ‘ă“ü‚ŕ‚Ĺ‚Ť‚é‚Š‚ç
$1`‚đ•Ű‘ś‚ľ‚Č‚­‚Ä‚˘‚˘‚Ě‚Č‚çAŒă”ź‚Í

for(i=1;i<=NF;i++){$i=a[i]} print

‚Ə‘‚Ż‚΂ż‚ĺ‚Á‚Ć’Z‚­‚Č‚é‚ȁB
527 :
2011/02/16(…) 12:11:40
>>526
‚Č‚é‚قǁA‚ť‚¤‚Ĺ‚Ť‚é‚Ě‚ŠB‚ ‚č‚Ş‚Ć‚¤B
528 :
2011/02/17(–Ř) 01:07:36
http://www.kt.rim.or.jp/~kbk/gawk-3.1/ ‚É’u‚˘‚Ä‚ ‚Á‚˝
win32—pgawk‚Ş‚˘‚‚̊ԂɂŠŒöŠJ’âŽ~‚É‚Č‚Á‚Ä‚˘‚˝B

wn32‚Ěgensub‚ŞŽg‚Ś‚Ä“ú–{Œę‚ވľ‚Ś‚āA
‚Š‚Âexe‚݂̂ʼnғŽ‚ˇ‚é‚Ě‚ĹƒCƒ“ƒXƒg[ƒ‹•s—v‚Č‚Ě‚Ş•Ö—˜‚Ĺ
ŒöŽ„‚É‚í‚˝‚Á‚Ĉ¤—p‚ľ‚Ä‚˘‚˝‚̂ŁA”ńí‚ɔ߂ľ‚˘ĽĽĽ
529 :
2011/02/17(–Ř) 02:14:57
530 :
2011/02/18(‹ŕ) 11:30:36
‚ť‚ę‚͏­‚ľŒĂ‚˘.
gawk-mbcs-win32-20090920.zip ‚ŞŽčŒł‚É‚ ‚é‚Ě‚Ĺ•K—v‚Č‚çÄ”z•z‚ˇ‚é‚Ş?
531 :
2011/02/19(“y) 01:36:10
>>530
‚ŕ‚ľŽ„‚ÉŒž‚Á‚Ä‚­‚ę‚Ä‚˘‚é‚Ě‚Ĺ‚ ‚ę‚΁A
exe‚Ě‚Ý‚ž‚Ż‚Ç2009/11/24”Ĺ‚ŞŽčŒł‚É‚ ‚é‚̂ŁA
‚ą‚ę‚đŽg‚˘‘ą‚Ż‚悤‚ĆŽv‚¤B‚ ‚č‚Ş‚Ć‚¤B
532 :
2011/02/19(“y) 08:18:59
‰´‚ĚŽčŒł‚ɁAgawk-mbcs-win32-20091124.zip ‚Ş‚ ‚Á‚˝B
—~‚ľ‚˘l‚Ş‚˘‚āA‚Š‚Ĕz•z‚É–â‘č–ł‚˘‚Ć‚˘‚¤Ž–‚Ş‚í‚Š‚ę‚΂ǂÁ‚Š‚É‚¤‚‚ˇ‚é‚ŞB

‚ľ‚Š‚ľ‚Č‚ń‚Ĺ”z•z‚â‚ß‚ż‚á‚Á‚˝‚ń‚ž‚ë‚ˁB
‚Ç‚ą‚Š‚ç‚Š”qŽŘ‚ľ‚˝ƒR[ƒh‚Ć‚Š‚Ěƒ‰ƒCƒZƒ“ƒX–â‘č‚Č‚Ě‚Š‚ȁH
533 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/02/19(“y) 22:51:02.65
AWK++‚É‚ć‚éƒIƒuƒWƒFƒNƒgŽwŒü“ü–ĺ
http://ja.wikibooks.org/wiki/AWK%2B%2B%E3%81%AB%E3%82%88%E3%82%8B%E3%82%AA%E3%83%96%E3%82%B8%E3%82%A7%E3%82%AF%E3%83%88%E6%8C%87%E5%90%91%E5%85%A5%E9%96%80

awk++‚Í–Ę”’‚ť‚¤‚ž‚Ż‚ǁAŒťŽŔ‚É‚Íawk‚ĹOO‚đ‚â‚él‚Í‚Ů‚Ć‚ń‚Ç‚˘‚Č‚˘‚ž‚낤B
‚ť‚ŕ‚ť‚ŕawkŽg‚˘‚ÍOO‚đ—‰đ‚Ĺ‚Ť‚Č‚˘‚—îŽŇ‚Ş‚Ů‚Ć‚ń‚Ç‚ž‚ľB
‚Ĺ‚ŕAgawk‚ރfƒtƒHƒ‹ƒg‚ĹOO‚ɑΉž‚ˇ‚ę‚Îawk‚ĹƒIƒuƒWƒFƒNƒgŽwŒü‚ˇ‚él‚ŕ‘‚Ś‚é‚Š‚ŕ‚ˁB
534 :
2011/02/19(“y) 23:05:51.24
>>533
ƒfƒtƒH‚ĹƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚éawk‚Ĺ‚Ĺ‚Ť‚é”ÍˆÍ‚Ě‚ą‚Ć‚ľ‚Š‚â‚ç‚Č‚˘‚ć
535 :
2011/02/20(“ú) 00:59:51.51
“ŻŠ´B„ƒfƒtƒH‚Ĺ‚Ĺ‚Ť‚é”͈Í
’ˇ‚ß‚ĚƒXƒNƒŠƒvƒg‚đ‘‚˘‚˝Ž–‚Ş‚ ‚Á‚˝‚Ě‚ĹOO‚ ‚é‚Ć•Ö—˜‚ĆŽv‚¤‚Ż‚Ç
‚í‚´‚í‚´ƒCƒ“ƒXƒg[ƒ‹‚ˇ‚é‚Č‚çperlArubyApython‚Ş‚ ‚é‚ľ‚Č‚Ÿ
536 :
2011/02/22(‰Î) 10:31:51.00
awk‚ŏ‘‚Š‚ę‚˝awk++‚Á‚Ä‚Č‚˘‚́H
537 :
2011/03/02(…) 23:14:41.35
gawk‚Ĺ•˝‰ź–źEƒJƒ^ƒJƒi‚Ě•”•Ş‚𔲂Ťo‚ľ‚˝‚˘‚ĆŽv‚Á‚Ä‚Ü‚ˇB
—á‚Ś‚΁uawk‚ɂ‚˘‚ÄŒę‚éƒXƒŒv‚ž‚Á‚˝‚ç
"‚ɂ‚˘‚Ä" "‚éƒXƒŒ" ‚đ•Ď”‚É“ü‚ę‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚˘‚˘•ű–@‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚ŠH
538 :
2011/03/02(…) 23:17:39.07
u‚ɂ‚˘‚āv‚Ɓu‚éƒXƒŒv‚Í‚ť‚ę‚ź‚ę•Ę‚̕ϐ”‚É“ü‚ę‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇ
539 :
2011/03/02(…) 23:27:45.29
ƒAƒ‹ƒtƒ@ƒxƒbƒgˆČŠO‚Ě•”•Ş‚ž‚Á‚˝‚çAƒAƒ‹ƒtƒ@ƒxƒbƒg‚đFS‚ÉŽw’č‚ľ‚Äwhile‚ʼnń‚š‚΂˘‚˘‚Ż‚ǁA
ŠżŽš‚ŕ”˛‚­‚Ě‚Í“ď‚ľ‚˘‚ȁB
‚ť‚ę‚ɁAŽ–ŽŔă•Ď”‚Í–łŒŔ‚ɐśŹ‚ˇ‚é‚Á‚ÄŽ–‚ŠB
540 :
2011/03/02(…) 23:58:57.50
match‚Ě‘ć2ˆř”‚É/[‚ -‚ńƒA-ƒ“]+/‚đŽ‚Á‚Ä‚­‚é‚Ć‚Š?
541 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/03(–Ř) 13:28:46.50
$0,$1...$NF‚đ‰ó‚ľ‚Ä‚ŕ‚˘‚˘‚ń‚ž‚Á‚˝‚çAŽ„‚Č‚ç‚ą‚¤‚ľ‚Ü‚ˇB

gsub‚ĚŒŸő•śŽš“S‚ɂ͐ł‹K•\Œť‚đŽg—p‚ˇ‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚é‚Š‚çA
‚Đ‚ç‚Ş‚Č‚ĆƒJƒ^ƒJƒiˆČŠO‚Ě•śŽš‚đƒXƒy[ƒX‚É’u‚ŤŠˇ‚Ś‚éB

gsub(/[^[‚Ÿ-‚ńƒ@-ƒ“]/," ")

‚Đ‚ç‚Ş‚Č‚ĆƒJƒ^ƒJƒiˆČŠO‚Ě•śŽš‚Í”źŠpƒXƒy[ƒX‚Q‚‚ɒu‚ŤŠˇ‚í‚éB
‚ ‚Ć‚ÍNF‚đŒŠ‚Ä•\ŽŚ‚ľ‚˝‚˘‚悤‚ɏˆ—‚ˇ‚éB

’ˆÓ‚ˇ‚ׂŤ‚́AWindows”ł̐V‚ľ‚˘ƒo[ƒWƒ‡ƒ“‚Ě‚ŕ‚̂ł́A
ł‹K•\Œť‚Ć‚ľ‚āA‚Đ‚ç‚Ş‚Č‚đ ‚Ÿ-‚ń ‚ŁAƒJƒ^ƒJƒi‚đ ƒ@-ƒ“ ‚Ĺ
Žw’č‚Ĺ‚Ť‚Č‚˘‚ŕ‚Ě‚Ş‚ ‚č‚Ü‚ˇB
‚˝‚ľ‚Šƒ}ƒ‹ƒ`ƒoƒCƒgŠg’Ł‚ʼn󂳂ꂽB
542 :
2011/03/03(–Ř) 14:28:35.14
>541
‚Ü‚žŽŽ‚ľ‚Ä‚Ü‚š‚ń‚ށA—~‚ˇ‚é•śŽšˆČŠO‚đÁ‚ľ‚ăSƒjƒ‡ƒSƒjƒ‡‚ˇ‚ę‚΂˘‚Ż‚ť‚¤‚Ĺ‚ˇB
>539-540‚ł‚ń‚ŕ‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B
543 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/03(–Ř) 19:41:21.36
BEGIN {
str = "ƒfƒ“ƒRŠżŽš‚΂ń‚´‚˘Œł‹Cabcde‚ž‚Š‚ç"
c = split(str, a, "[^[ƒ@-ƒ“‚Ÿ-‚ń]")
for (i = c; i>=1; i--) {
if ( a[i] !~ /^$/ ) { print a[i] }
}
}
544 :
2011/03/03(–Ř) 19:44:47.65
ƒ{ƒP‚Š‚Ü‚ľ‚˝
4s–Ú‚Í•’Ę‚É
for ( i = 1; i <=c; i++) {
‚ĹOKB
545 :
2011/03/03(–Ř) 22:55:52.84
c‚đŽc‚ł‚Č‚­‚Ć‚ŕ
for (i in a){if (a[i]) print a[i]}
‚ĹŠÔ‚É‡‚¤‚悤‚ȁB
546 :
2011/03/04(‹ŕ) 01:04:03.52
for-in‚ž‚Ə‡˜‚Ş•Űá‚ł‚ę‚Č‚˘‚ń‚ś‚á‚Č‚Š‚Á‚˝‚Á‚Ż?
547 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/04(‹ŕ) 08:34:52.75
for ( i = 1; i in a ; i++) ‚Á‚ď‘‚Ť•ű‚ŕ‚Ĺ‚Ť‚é‚ć
548 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/07(ŒŽ) 14:14:11.11
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
....

‚̂悤‚ɁAƒtƒB[ƒ‹ƒh”‚ރoƒ‰ƒoƒ‰‚ŁAƒtƒB[ƒ‹ƒh‚ވę’v‚ˇ‚éę‡‚ŕ‚ ‚ę‚Î
ˆę’v‚ľ‚Č‚˘ƒf[ƒ^‚Ş‚ ‚é‚Ě‚Ĺ‚ˇ‚ށAd•Ą‚đ
a1 a2 a3
b1
c1
d1 d2
‚̂悤‚É‚Ü‚Ć‚ß‚ ‚°‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
‚ł‚ˇ‚ނɃOƒO‚Á‚ăRƒsƒy‚Ć‚˘‚¤–ó‚É‚ŕ‚˘‚Š‚¸BBB
549 :
2011/03/07(ŒŽ) 14:31:25.16
>>548
‚˘‚낢‚ë‚â‚č•ű‚Í‚ ‚é‚ĆŽv‚¤‚Ş

awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}'
550 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/07(ŒŽ) 14:53:42.21
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
‚ť‚ę‚ź‚ęA4‚d•Ąƒf[ƒ^‚Ě‚ ‚Á‚˝‚ŕ‚Ě‚Í3‚‚ɁA2‚‚̂ŕ‚Ě‚Í1‚Â‚É‚ĆŒ¸‚Á‚˝‚Ě‚Ĺ‚ˇ‚Ş
‚ť‚ęˆČăŒ¸‚Á‚Ä‚Ü‚š‚ńB“Ż‚śƒRƒ}ƒ“ƒh‚đŒJ‚č•Ô‚ľ‚Š‚Ż‚Ä‚Ý‚˝‚Ě‚Ĺ‚ˇ‚ށA•Ď‰ť‚Í‚Č‚Š‚Á‚˝‚Ĺ‚ˇB

a1 a1 a1 a1
b1 b1 b1
...‚Ě•”•Ş‚Ş
a1 a1 a1
b1 b1
‚É‚Í‚Č‚Á‚˝‚Ć‚˘‚¤ˆÓ–Ą‚Ĺ‚ˇB
‚ŕ‚¤­‚ľ‚¨‚‚Ť‚ ‚˘‚˘‚˝‚ž‚Ż‚Č‚˘‚Ĺ‚ľ‚傤‚ŠBBB
551 :
2011/03/07(ŒŽ) 15:06:41.15
ŽčŒł‚Ĺ‚Íˆę‚‚ɂȂ邯‚Ç‚Č‚ŸBŒ´—‚Í‚í‚Š‚é‚ž‚낤‚Š‚ç‚ ‚Ć‚Í‚Ş‚ń‚΂ęB
s‚˛‚Ć‚ÉƒtƒB[ƒ‹ƒh‚Ě“YŽš‚ɂ‚˘‚㋁[ƒv‚ˇ‚é‚Ě‚Ć˜A‘z”z—ń‚ŏoŒťƒ`ƒFƒbƒN‚ރLƒ‚B

% cat hoge.txt
a1 a1 a1 a2 a2 a3
b1 b1 b1 b1
c1
d1 d2 d2
% awk '{j=0;delete a;for(i=1;i<=NF;i++){if(!a[$i]++){$(++j)=$i}}NF=j;print}' hoge.txt
a1 a2 a3
b1
c1
d1 d2
552 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/07(ŒŽ) 15:14:33.26
0610005C13Rik 0610005C13Rik 0610005C13Rik
0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik 0610007C21Rik

‚ą‚¤‚˘‚¤Š´‚ś‚Ě•śŽš—ń‚Č‚ń‚Ĺ‚ˇ‚Ş
a1‚Ć‚Šb1‚Ĺ—á‚Ś‚Ä‚ŕ‘ĺä•v‚ž‚Á‚˝‚Ĺ‚ˇ‚ŠH
553 :
2011/03/07(ŒŽ) 15:38:11.62
‹ó”’‚Ĺ‹ćŘ‚ç‚ę‚˝•śŽš—ń‚Č‚ç‚Č‚ń‚Ĺ‚ŕ‚˘‚˘‚ށA‚ť‚ĚƒŒƒxƒ‹‚ĚŽż–â‚Ş
o‚é‚悤‚ś‚á‚ŕ‚¤‚ˇ‚ą‚ľŠî‘b‚đ•×‹­‚ľ‚Č‚˘‚Ć‚ž‚ß‚Š‚ŕ‚Č‚ŸB
554 :
2011/03/07(ŒŽ) 15:50:13.69
ƒVƒ“ƒOƒ‹ƒNƒI[ƒe[ƒVƒ‡ƒ“Žg—p‚ĚƒTƒ“ƒvƒ‹‚Ĺ–â‘č‚Č‚˘‚ĆŒž‚¤Ž–‚́`
‚t‚m‚h‚wŠÂ‹Ť‚Č‚Ě‚Š‚ȁ`
555 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/07(ŒŽ) 15:58:11.87
Mac OSX‚Ěƒ^[ƒ~ƒiƒ‹‚đŽg‚Á‚Ä‚Ü‚ˇB
>>551‚Í‚ť‚Ě‚Ü‚Ü‚¤‚Ü‚­“Ž‚Ť‚Ü‚ľ‚˝B
‚˘‚܏¸‡‚ĹŽč“Ž‚ōě‹Ć‚ľ‚Ä‚Ü‚ˇ‚ށA‚Ü‚žz‚𔲂Ż‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚š‚ńB
‚ŕ‚¤Žč‚Ş‚Â‚č‚ť‚¤‚Ĺ‚ˇ
556 :
2011/03/07(ŒŽ) 16:04:33.75
ˆęs–ě˜Y‚đ•Ş‰đ‚ľ‚ÄƒXƒNƒŠƒvƒg‚É‘g‚Ý’ź‚ľ‚ĘM‚ę‚ΓŽěŠm”Fo—ˆ‚é‚ĆŽv‚¤
557 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/03/07(ŒŽ) 16:21:10.50
‚˘‚Üw‚Ü‚Ĺ‚Ť‚Ü‚ľ‚˝B‚ŕ‚¤‚ž‚ß‚Ĺ‚ˇB
ˆę‰žAƒtƒ@ƒCƒ‹‚đ‚¨‚˘‚Ä‚Ý‚Ü‚ˇBBB
http://www5.puny.jp/uploader/download/1299482386.zip
ƒpƒX‚Í1234‚Ĺ‚ˇB
558 :
2011/03/07(ŒŽ) 17:18:15.93
‚Ü‚ž‚â‚Á‚Ä‚é‚Ě‚Š`
ƒtƒ@ƒCƒ‹‚́@O‚l@‚Ş–â‘č‚Ý‚˝‚˘‚ž‚Š‚ç
‚b‚q‚k‚e‚Ěƒtƒ@ƒCƒ‹Œ`ŽŽ‚É•ĎŠˇ‚ľ‚ďă‚Ěˆęs–ě˜Y‚Ĺ–â‘č‚Č‚˘‚Ý‚˝‚˘‚ž‚Á‚˝‚ćB
559 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/04/19(‰Î) 03:07:46.46
#•Ą”s‚Ě“ü—Í’†Ać‚̍s‚Ě11ƒJƒ‰ƒ€–Ú‚ÉOUT‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚Š‚ÂŽŸ‚̍s‚Ě11ƒJƒ‰ƒ€–Ú‚ÉIN‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é2s‚Ş‘ľ‚Á‚˝ŽžA2s‚đo—Í
$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
prev="";
}
560 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/04/19(‰Î) 15:55:50.78
# 7.awk
NR >= 2{
if($0 ~ /^>'=+/){
if($0 ~ /~$/){
print "A";
}else{
print "NAA";
}
}else if($0 ~ /^>\^(Q=)+/){
if($0 ~ /~~$/){
print "B";
}else{
print "NAB";
}
}else{
print "NAC";
}
}

7.txt
3
>'======#======~
>^Q=Q=Q=Q=Q=Q=Q=Q=~~
>'===#====~
NAA
NBB
NAA@@@‚Ć‚Č‚éB‰˝‚ŁH
A
B
A@@‚Ć‚Č‚Á‚Ä‚Ů‚ľ‚˘‚̂ɁEEEgawk 3.1.7‚Ĺ‚ˇEE
561 :
2011/04/19(‰Î) 16:30:51.01
‰´‚ĚŽčŒł‚Ěgawk 3.1.7‚Ĺ‚ÍŠú‘Ň’Ę‚č‚ĚŒ‹‰Ę‚É‚Č‚é‚Č‚ B

s––‚Ş‚ç‚Ý‚ž‚ƉüsƒR[ƒh‚ވá‚Á‚Ä‚˝‚čŒŠ‚Ś‚Č‚˘‹ó”’‚Ş
“ü‚Á‚Ä‚˝‚č‚Ć‚˘‚¤‚Ě‚Ş‚ć‚­‚ ‚é‚Ě‚ĹŠm”F‚ľ‚Ă݁B
562 :
2011/04/19(‰Î) 16:32:43.45
>>560
‚ ‚Ć

/^>'=+/

‚Á‚ăLƒƒƒvƒ`ƒƒ‚Ć‚Š‚ľ‚Ä‚é‚í‚Ż‚ś‚á‚Č‚˘‚Š‚ç+‚Í–ł‘Ę‚ś‚á‚Č‚˘‚ŠB
563 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/04/19(‰Î) 16:45:20.75
>>561
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝B‰üsƒR[ƒh‚đunixŒ`ŽŽ‚É‚ľ‚˝‚ço—ˆ‚Ü‚ľ‚˝B
ĄŒă‚Ć‚ŕ‚ć‚ë‚ľ‚­‚¨Šč‚˘’v‚ľ‚Ü‚ˇB
564 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/04/19(‰Î) 17:00:39.34
>>559

IN‚Ş‚ ‚é‚Ć‚Ť‚É‚ľ‚Šprev‚ރNƒŠƒA‚ł‚ę‚Ä‚˘‚Č‚˘‚Š‚çAOUT‚ޏoŒť‚ľ‚˝ˆČ~‚É
•Ą”s‚ŞŒo‰ß‚ľ‚Ä‚ŕIN‚ޏoŒť‚ˇ‚é‚Ćprint‚ł‚ę‚éƒXƒNƒŠƒvƒg‚É‚Č‚Á‚Ä‚˘‚é‚ćB
565 :
2011/04/20(…) 01:08:11.06
http://okwave.jp/qa/q6672025.html
‚Ć‚Š‚Ě“ü—Í‚đƒCƒ[ƒW‚ľ‚Ä‚˝‚ŕ‚Ě‚Ĺ...

$11~/OUT/{ prev=$0; }
$11~/IN/{
if(prev!=""){ print prev; print; }
}
$11!~/OUT/{ prev=""; }
566 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/05/01(“ú) 16:22:39.39
http://okwave.jp/qa/q6660984.html
#2—ń–Ú‚Ě€–Ú‚Şdisk1`4‚Ü‚Ĺ•s‘Ť•”•Ş‚Ş–„‚Ü‚é‚悤‚É‚ľA•s‘Ť‚ľ‚Ä‚˘‚˝•”•Ş‚Ě1—ń–Ú‚É‚Í‘O‚ĚŽžŠÔA3—ń–Ú‚É‚Í0‚Ĺ–„‚ß‚˝‚˘
BEGIN{ dt=prevDt="00:00:00"; }
NF>=3{ dt=$1; tgt=$2; n=$3; }
NF==2{ tgt=$1; n=$2; }
{ gapDisp(prevTgt,tgt); disp(dt,tgt,n); prevDt=dt; prevTgt=tgt; }
END{ gapDisp(tgt,"disk1"); }

function disp(dt,tgt,n){ print dt, tgt, n; }
function gapDisp(disk,endDisk, cnt)
{
for(cnt=add(getNo(disk)); cnt!=getNo(endDisk); cnt=add(cnt)) disp(prevDt, sprintf("disk%d", cnt), 0);
}
function add(cnt){ return ((++cnt>4)?(1):(cnt)); }
function getNo(disk){ sub(/disk/,"",disk); return disk; }
567 :
2011/05/01(“ú) 19:40:09.87
BEGIN { reset() }
NF == 2 { $3 = $2; $2 = $1; $1 = last_t }
{ last_t = $1 }
{ if ($2 < last_disk) { p(); reset() } last_disk = $2 }
{ n[$2] = $3 }
{ for(i in n) { if (i >= $2) { t[i] = $1 } } }
END { p() }
function p() {
for (i = 1; i <= 4; i++) {
d = "disk" i
print t[d], d, n[d]
}
}
function reset() {
for (i = 1; i <= 4; i++) {
d = "disk" i
t[d] = t["disk4"]
n[d] = 0
}
}
568 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/05/03(‰Î) 14:58:05.53
ŠÔˆá‚Á‚Ä‚é‚ć
‚ľ‚Š‚ŕ’ˇ‚­‚Ä”ü‚ľ‚­‚Č‚˘‚ć
569 :
2011/05/03(‰Î) 15:13:19.32
http://okwave.jp/qa/q6711117.html
...‚ą‚ń‚ČŠ´‚ś‚Š‚Ë‚ĽH@@ awk -f sum.awk ƒf[ƒ^ | sort
----- sum.awk -----
$1!~/¤“X–ź/{ tbl[$1 "," $2]+=$3; }
END{
@for(key in tbl){
@@split(key, item, /,/);
@@print item[1], item[2], tbl[key];
@}
}
-----
570 :
2011/05/03(‰Î) 15:33:28.80
>>566
NF==3 {
disp();
for(i=1;i<=4;i++) {
disk_time[i]=$1
disk_val[i]=0
}
disk_val[substr($2, 5, 1)]=$3
}
NF==2 {
disk_val[substr($1, 5, 1)]=$2
}
END{
disp()
}
function disp() {
for(i=1;i<=4;i++) {
if(i in disk_time) printf("%s disk%d %s\n", disk_time[i], i, disk_val[i])
}
}
571 :
2011/05/03(‰Î) 16:12:56.67
BEGIN {
    # ć“Ş‚Ş‚˘‚Ť‚Č‚č "disk2 15" ‚Ě‚Ý‚ĹŽn‚Ü‚Á‚˝‚č‚ľ‚Č‚Ż‚ę‚Î
    # ‚ą‚̏‰Šú‰ť‚Í•s—vB
    a = "00:00:00";
}
NF == 3 {
    if (NR > 1) put();
    a = $1;
    b[$2] = $3;
}
NF == 2 {
    b[$1] = $2;
}
END {
    put();
}
function put(    i) {
    for (i = 1; i <= 4; i++) {
        print a, "disk" i, b["disk" i] + 0;
        b["disk" i] = 0;
    }
}
572 :
2011/05/03(‰Î) 16:20:05.55
>>569 awk‚Ě”z—ń‚Á‚Ä‚Ç‚ę‚­‚炢Šm•Ű‰Â”\‚Ȃ́H
ć‚Ésort‚ľ‚˝‚ç‚Ç‚¤‚Š‚ȁH sort ƒf[ƒ^ | awk -f sum.awk
----- sum.awk -----
$1!~/¤“X–ź/{ if(store==$1 && item==$2) val+=$3; else{ disp(); store=$1; item=$2; val=$3; } }
END{ disp(); }
function disp(){ if(store!="" || item!="") print store, item, val; }
-----
573 :
2011/05/04(…) 17:32:38.53
ƒwƒbƒNƒVƒ‡ƒ“
574 :
2011/05/06(‹ŕ) 00:54:22.24
$ uname -sr
CYGWIN_NT-6.1 1.7.9(0.237/5/3)
$ awk --version
GNU Awk 3.1.8

‚ą‚̊‹Ť‚ŁA
awk 'BEGIN {for(i=j=1;i<50;++i) {print j; j*=10}}'
‚ą‚ęŽŔs‚ˇ‚é‚ƁAj‚Ş23Œ…’´‚Ś‚˝‚ ‚˝‚č‚Š‚çA‚¨‚Š‚ľ‚­‚Č‚é‚ń‚ž‚Ż‚ǁB

awk‚̐Ž”‚Á‚ďăŒŔ‚ ‚é‚́HiƒEƒ`‚ž‚Ż‚ŠHj
575 :
2011/05/06(‹ŕ) 01:09:59.27
long double•Ó‚č‚̐¸“x‚ľ‚Š‚Č‚˘‚ćB
576 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/05/06(‹ŕ) 09:18:39.10
>>574
‚¨‚ę‚Ě‚o‚b‚Ĺ‚Í•’Ę‚É 1 ‚Š‚ç 1e+048 ‚Ü‚Ĺ•\ŽŚ‚ł‚ę‚Ü‚ˇ‚ށBBB
577 :
2011/05/06(‹ŕ) 09:54:18.77
578 :
2011/05/06(‹ŕ) 11:30:10.09
>>576
–{“–‚Ĺ‚ˇ‚ŠI‚ć‚ë‚ľ‚Ż‚ę‚Ί‹Ť‚đ‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B

>>577
‚ ‚č‚Ş‚Ć‚¤B‚ą‚ąawk‚ŕ’Ł‚ę‚˝‚ń‚žBŒ‹‰Ę‚Ş’ˇ‚ˇ‚Ź‚袂Á‚Ä‚˝‚Ě‚ćB
ł‚É‚ą‚ń‚ČŒ‹‰Ę‚É‚Č‚éB

POSIX‚Ĺ•Űá‚ł‚ę‚Ă鐸“x‚Í>>575‚Á‚Ä‚ą‚ƁH
‚Ä‚ą‚Ƃ́Aawk‚Í“ŕ•”‚ł́A‘S‚Ă̐”‚Şdoubleˆľ‚˘‚Ȃ́H
579 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/05/06(‹ŕ) 14:20:04.87
>>578
576‚Ĺ‚ˇBWindowsXP + GNU Awk 3.0.6 + multi-byte extension 1.15 ‚Ĺ‚ˇB
580 :
2011/05/06(‹ŕ) 18:58:28.81
>>579
‚ ‚č‚Ş‚Ć‚¤B
‚ ‚Ü‚čˆá‚˘‚Ş‚Č‚˘‚ȁBWin7‚ÍŠÖŒW‚Č‚˘‚ž‚낤‚ľB
multi-byte extension‚Ş‚ť‚Ě•Ó‚č‚ŕ˜M‚Á‚Ä‚˘‚é‚Ě‚Šc

‚ť‚¤‚˘‚Ś‚΁A1e+048‚Ý‚˝‚˘‚ČŽw”‚Ĺ•\ŽŚ‚ł‚ę‚é‚́H
o—Í‚Ě‚Ć‚ŤŠŰ‚ß‚é‚Š‚çA‚ż‚á‚ń‚ĆŒvŽZ‚Ĺ‚Ť‚Ä‚é‚悤‚ÉŒŠ‚Ś‚é‚Ě‚Š‚ȁB
581 :
2011/05/06(‹ŕ) 23:07:48.20
awk‚ł͐”’l‚Í‚ˇ‚ׂÄdouble‚Ĺˆľ‚˘‚Ü‚ˇB
‚Ĺ‚ˇ‚Š‚ç‚ť‚̐¸“x‚Ĺ‚ ‚é53bit•ŞA‘ĺ‘Ě15Œ…‚ż‚ĺ‚Á‚Ć‚đ’´‚Ś‚é‚ƐłŠm‚Č’l‚đ•ŰŽ‚Ĺ‚Ť‚Ü‚š‚ńB

23Œ…‚ ‚˝‚č‚܂Őł‚ľ‚­•\ŽŚ‚Ĺ‚Ť‚Ä‚é‚Á‚Ä‚Ě‚Í‚ć‚­‚í‚Š‚č‚Ü‚š‚ń‚ށA
3.0.6‚É‚ľ‚Ä‚ŕo—ÍŽž‚̏‘ŽŽŽw’č‚Şˆá‚¤‚ž‚Ż‚Ĺ“ŕ•”“I‚É‚Í“Ż‚ś‚悤‚É•słŠm‚Č’l‚É
‚Č‚Á‚Ä‚ľ‚Ü‚Á‚Ä‚é‚ĆŽv‚˘‚Ü‚ˇB
582 :
2011/05/07(“y) 01:38:55.53
‚ž‚Š‚çAŽŔŽżlong double‚̐¸“x‚É‚Č‚Á‚Ä‚˘‚é‚ń‚ž‚Á‚Ă΁B
583 :
2011/05/07(“y) 11:11:15.94
>>582
uŽŔŽżv‚Ć‚˘‚¤‚Ě‚Í‚Ç‚¤‚˘‚¤ˆÓ–Ą?

#define AWKNUM double

‚Á‚Ä‚Ě‚Ş‚ ‚é‚ľAlong double ‚É‚ľ‚Ä‚ŕ‰ź”•”‚Í64bit‚ž‚Š‚ç23Œ…‚É‚Í‘Ť‚č‚Č‚˘‚ć?
x87‚ĚƒŒƒxƒ‹‚ĹŠg’Ł¸“x‚É‚Č‚Á‚Ä‚Ä‚ŕA•\ŽŚ‚â‚ç‚Č‚ń‚â‚炡‚é‚Ć‚ą‚ë‚Ĺ”{¸“x‚É
ŠŰ‚ß‚ç‚ę‚ż‚Ⴄ‚ĆŽv‚¤‚ń‚ž‚Ż‚ǁB
584 :
2011/05/07(“y) 13:09:06.68
http://codepad.org/4GaxJcGp
ŠŽ‘S‚Ɉę’vB‚Ç‚¤ŒŠ‚Ä‚ŕ double ‚Ĺ‚ˇB–{“–‚É‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝
585 :
2011/05/07(“y) 21:19:09.46
>>581
‚ ‚¤A‚ť‚¤‚Č‚Ě‚Š[B‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB˘‚Á‚˝‚Č‚ŸB
10i‚ĹŽŔ”ˆľ‚Ś‚Ć‚Ü‚Ĺ‚ÍŒž‚í‚Č‚˘‚Ż‚ǁAŽ”‚Í—~‚ľ‚˘B
”‚đ‚˘‚ë‚ń‚ČŒ^‚Ĺˆľ‚Ś‚鏈—Œn‚Č‚ń‚Ä‚Č‚˘‚ŠB
586 :
2011/05/07(“y) 23:01:38.63
>>583
‚ [Along double‚ĆŒž‚Á‚˝‚Ě‚ŞŮ‚Š‚Á‚˝‚ˁB10‚Ě™p‚Ěę‡‚ÍŽŔŽżdouble‚đ‘ĺ‚Ť‚­‰z‚Ś‚˝¸“x‚É‚Č‚Á‚Ä‚˘‚é‚ĆŒž‚˘‚˝‚Š‚Á‚˝B

10‚Í2‚Ć5‚̐ςž‚Š‚çA10”{‚đŒJ‚č•Ô‚ˇ‚Ć‚Ť‚ɉź”•”‚Í5”{‚¸‚‚ɂľ‚Š‚Č‚ç‚Č‚˘B
IEEE‚Ědouble‚̐¸“x‚ž‚Ć5‚Ě22ć‚Ĺ53ƒrƒbƒg‚đŽg‚˘‰Ę‚˝‚ˇ‚̂ŁA‚ť‚ą‚Ü‚Ĺ‚ÍŒëˇ‚ސś‚ś‚Č‚˘B
Œž‚˘Šˇ‚Ś‚ę‚΁A10‚Ěę‡‚Í53ƒrƒbƒg+22ƒrƒbƒgA‘Ś‚ż75ƒrƒbƒg•Ş¸“x‚Ş‚ ‚é‚悤‚ÉŒŠ‚Ś‚éB

‚Ü‚ŸA>584‚đ10”{‚ś‚á‚Č‚­‚Ä5”{‚É‚ľ‚āAdouble‚đlong long‚É‚ľ‚Ä%.f‚đ%llx‚É‚ľ‚ărƒbƒg”‚𐔂Ś‚Ä‚Ý‚ę‚΂킊‚é‚Ĺ‚ľ‚ĺB
587 :
2011/05/09(ŒŽ) 21:13:05.37
gawk‚Ěƒ†[ƒUƒKƒCƒh‚ɁA‘ź‚̏ˆ—Œn‚ł́A•W€ƒGƒ‰[‚đŽg‚¤‚˝‚߁A
@print "Serious error detected!" | "cat 1>&2"
‚Ć‚˘‚¤•ű–@‚ľ‚Š‚Č‚˘‚Ć‚ ‚č‚Ü‚ˇB
gawk‚Í/dev/stderr‚đ“Á•Ę‚Ɉľ‚¤‚˝‚߁A
@print "Serious error detected!" > "/dev/stderr"
‚Ə‘‚­‚Ě‚Ş“KŘ‚Ć‚ ‚č‚Ü‚ˇB

‚ą‚ę‚ɂ́A‚ǂ̂悤‚Čˆá‚˘‚Ş‚ ‚é‚Ě‚Ĺ‚ľ‚傤‚ŠH
/dev/stderr‚Ş‚ ‚éOS‚Č‚çAcat‚ĚƒvƒƒZƒX‚ސśŹ‚ł‚ę‚é‘ź‚́Aˆá‚˘‚Í‚Č‚˘‚Ě‚Ĺ‚ľ‚傤‚ŠH
ŠÂ‹Ť‚⏈—Œn‚đ–â‚킸“Žě‚ł‚š‚˝‚˘‚Č‚çAă‚̏‘‚Ť•ű‚Ě•ű‚Ş‚ć‚˘‚Ě‚ŠA‹C‚É‚Č‚Á‚Ä‚˘‚Ü‚ˇB

‚ć‚ë‚ľ‚­‚¨Šč‚˘‚ľ‚Ü‚ˇB
588 :
2011/05/10(‰Î) 00:17:11.81
‘ź‚̏ˆ—Œn‚Á‚āA‘ź‚Ěawk‚Á‚ÄŽ–‚ž‚ćB

/dev/stderr‚Ş‚ ‚éOS‚Á‚ÄŽ–‚Ŕ‚á‚Č‚­‚āA
gawk‚Í“ÁŽę‚Čƒtƒ@ƒCƒ‹–ź‚Ć‚ľ‚Ä/dev/stderr‚Ć‚ŠŽg‚Ś‚é‚ćA‚Á‚ÄŽ–‚ž‚ćB

‚Č‚Ě‚Ĺ‘ź‚ĚOS‚Ĺ‚ŕ gawk ‚ž‚Á‚˝‚çprint‚Ć‚Š‚̏o—͐ćƒtƒ@ƒCƒ‹–ź‚Ć‚ľ‚Ä /dev/stderr Žg‚Ś‚é‚Á‚Ęb‚ž‚ˁB
/dev/stderr‚Ć‚Š‚đƒTƒ|[ƒg‚ľ‚Ä‚˘‚Č‚˘gawkˆČŠO‚Ěawk‚Ĺ‚ŕ“Žě‚ł‚š‚é‚Č‚ç ƒpƒCƒv‚Ć"cat 1>&2"‚đŽg‚¤•ű–@‚ľ‚Š‚Č‚˘B‚ށAWinŒn‚Ícat‚ž‚Ć...
589 :
2011/05/10(‰Î) 09:20:21.36
‚ť‚ą‚Ü‚Ĺ‚Ě‚ą‚Ć‚đ‚ˇ‚é‚Č‚çPerl/Ruby/Python“™‚Ě‚ż‚á‚ń‚Ć‚ľ‚˝
ƒXƒNƒŠƒvƒgŒžŒę‚ŏ‘‚˘‚˝•ű‚Ş‚˘‚˘‚ń‚ś‚á‚Č‚˘‚Š‚ȁB‚ą‚¤‚˘‚¤
‚Ç‚¤‚Ĺ‚ŕ‚˘‚˘‚Ć‚ą‚ë‚Ĺ”Y‚Ü‚Č‚­‚ÄĎ‚Ţ‚ćB

awk‚Íawk‚ĹŽčŒy‚ɏ‘‚Ż‚é”ÍˆÍ‚Č‚ç‘ź‚̒ǐ‚đ‹–‚ł‚Č‚˘‚ĆŽv‚¤‚Ş
‚ť‚Ě˜g‚đ‚͂ݏo‚悤‚Ć‚ˇ‚é‚Ć“r’[‚É‘ĺ•Ď‚É‚Č‚éB‚ť‚ą‚ŞŠy‚ľ‚˘‚Ć
‚˘‚¤‚Ě‚Č‚ç–ł—‚É‚ÍŽ~‚ß‚Č‚˘‚Ż‚Çw

590 :
2011/05/10(‰Î) 14:35:51.09
>>589
‚ť‚¤A‚ť‚ę‚ŞŠy‚ľ‚˘‚ń‚ž
591 :
2011/05/11(…) 00:36:20.77
>>588
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
cat‚Ş‚Č‚˘ŠÂ‹Ť‚ž‚ƁA‚Ç‚¤‚ľ‚悤‚ŕ‚Č‚˘‚Ĺ‚ˇ‚ˁc

>>589
ƒRƒ“ƒ}‹ćŘ‚č‚Ěƒf[ƒ^‚đAƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚ŏˆ—‚ľ‚Ä‚˘‚˝‚̂ŁA
‚ť‚ę‚đawk‚ɈڐA‚ľ‚Ä‚˘‚Ü‚ľ‚˝Bˆę”ÔŽčŒy‚ž‚Á‚˝‚Ě‚Ĺ‚ˇB

‚ż‚Ȃ݂ɁA2ŽžŠÔ”źˆČă‚Š‚Š‚Á‚Ä‚˘‚˝ˆ—‚ށA1•ŞˆČ“ŕ‚É’Zk‚ł‚ę‚Ü‚ľ‚˝B
ƒƒ‰ƒ^B@@@ƒƒ‰ƒ^c
592 :
2011/05/11(…) 10:19:43.16
C‚ŏ‘‚Ť’ź‚ľ‚˝‚琔•b‚ĹŽŔsŠŽ—š‚Ě—\Š´‚—
593 :
2011/05/11(…) 12:14:45.46
‚[‚Ä‚ŕawk‚Ć‚Š‚ť‚Ě‘ź‚ĚƒXƒNƒŠƒvƒg‚ĹƒTƒNƒb‚Ə‘‚Ż‚é‚悤‚Č•śŽš—ńˆ—‚đ
CŒžŒę‚Ć‚Š‚Ĺ‚Í‚ ‚ń‚Ü‚č‘‚Ť‚˝‚­‚Č‚ç‚ń‚ĆŽv‚¤‚źw
594 :
2011/05/24(‰Î) 10:19:27.54
‚Č‚č‚Ü‚š‚ń
595 :
2011/05/25(…) 20:17:22.02
‚ ‚Ÿ‚ ‚ ‚Ÿ‚Ÿ‚Ÿ```–ł—‚ž‚Á‚˝‚ŠAA–ł—‚Č‚Ě‚Š[Ia[0][0] = 1 ¨ syntax error
596 :
2011/05/25(…) 21:58:46.38
>>595
gawk‚Ěę‡ƒCƒ“ƒfƒbƒNƒX‚đSUBSEP(=\034‚ރfƒtƒHƒ‹ƒg)‚đ‹˛‚ń‚ĹƒVƒŠƒAƒ‰ƒCƒY‚ľ‚˝ƒCƒ“ƒfƒbƒNƒX‚Ĺ‘˝ŽŸŒł”z—ń‚đ•\Œť‚ˇ‚é
a[0,0] = 1;
‚Č‚çOK‚Ě‚Í‚¸B‚ą‚Ě‚Ć‚Ť‚ĚƒCƒ“ƒfƒbƒNƒX‚Í"0\0340"‚ž‚Š‚çAa["0\0340"] == 1B
597 :
2011/05/26(–Ř) 18:46:04.99
>>596
‚ ‚č‚Ş‚Ć‚¤BŽn‚ß‚Š‚ç‚ť‚ę‚đˆÓŽŻ‚ľ‚ď‘‚˘‚Ä‚˝‚ç‚ć‚Š‚Á‚˝‚ń‚ž‚Ż‚ǂˁB

god["name"] = "Kaname Madoka"
god["msg"] = "Mahoushoujo ha watashi dakede juubun dayo."
homerun["name"] = "Akemi Homura"
homerun["msg"] = "Madoka ha watashi no yome."
‚ą‚ń‚Č•—‚ɏ‘‚˘‚Ä‚˘‚˝‚Ě‚đA

puella_magi["god"] = god
puella_magi["homerun"] = homerun
‚Ý‚˝‚˘‚ɂ܂Ƃ߂悤‚Ć‚ľ‚˝‚çA‚ ‚΂΂΂Î

awk‚Ě”z—ń‚Á‚ďˆ—Œn‚É‚ć‚Á‚Ä‚Í“Y‚ŚŽš‚ސŽ”‚Ěę‡Aˆ—‚ŞĹ“K‰ť‚ł‚ę‚Ä‘‚­‚Č‚Á‚˝‚股‚é‚Ě‚Š‚ȁH
\‘˘‘Ě‚Ě‘ă‚í‚č‚Ý‚˝‚˘‚ÉŽg‚˘‚˝‚Š‚Á‚˝‚Ě‚ž‚ށB
598 :
2011/05/27(‹ŕ) 00:57:28.69
name["god"] = "Kaname Madoka"
msg["god"] = "Mahoushoujo ha watashi dakede juubun dayo."
name["homerun"] = "Akemi Homura"
msg["homerun"] = "Madoka ha watashi no yome."

‚Ĺ‚ć‚­‚ˁH
599 :
2011/05/30(ŒŽ) 21:25:51.88
awk‚Á‚Ä *‚Ç‚ĚŽŔ‘•‚Ĺ‚ŕ* ˆę“x‚ŕŽg‚Á‚˝‚ą‚Ć‚Ş‚Č‚˘•Ď”‚Ě“ŕ—e‚Á‚āAƒXƒJƒ‰‚Č‚ç0‚Š""‚É‚Č‚Á‚Ä‚é‚́H
•Ď”‚ވę“x‚ŕ‘ă“ü‚ł‚ę‚Ä‚˘‚Č‚˘‚ą‚Ƃ𔝒股‚é‚˝‚߂ɁA(x==0 && x=="")‚Á‚ď‘‚˘‚ĉ˝‚Š–â‘č‚Č‚˘H
600 :
2011/05/30(ŒŽ) 21:31:52.21
>>599
•]‰ż‚ł‚ę‚é‚Ć‚Ť‚ɕϐ”‚Ş‘śÝ‚ľ‚Č‚Ż‚ę‚΍쐬‚ł‚ę‚éB‚Í‚¸
”z—ń‚Ě—v‘f‚Č‚ç in ‚Ĺ’˛‚ׂç‚ę‚é‚Ż‚Ç
•Ď”ŽŠ‘Ě‚Ć‚Č‚é‚Ć‚Ç‚¤‚ž‚낤‚Ë
601 :
2011/05/30(ŒŽ) 21:32:47.76
>>599
‰˝“x‚ŕ‘ă“ü‚ľ‚˝ŒăAĹŒă‚É 0 or "" ‚đ‘ă“ü‚ľ‚˝•Ď”‚Ć‹ć•Ę‚Ĺ‚Ť‚Č‚˘B
602 :
2011/05/30(ŒŽ) 23:19:06.92
>>600-601
‚ ‚č‚Ş‚Ć‚¤B‹ć•Ę‚Ĺ‚Ť‚Č‚˘‚Á‚āA‚Ç‚¤‚˘‚¤ó‘Ô‚É‚Č‚é‚́H0‚đ‘ă“ü‚ľ‚˝‚ç0‚Š"0"‚É•]‰ż‚ł‚ę‚éB
‚ ‚ A""‚đ‘ă“ü‚ľ‚˝‚ç0‚Š""‚É•]‰ż‚ł‚ę‚Ä‘Ę–Ú‚Á‚Ä‚ą‚Ć‚ŠIH
603 :
2011/05/31(‰Î) 00:05:27.97
‚ ‚ęHŽŽ‚ľ‚˝‚ç‚Ç‚Á‚ż‚đ‘ă“ü‚ľ‚Ä‚ŕ599‚ĚŽŽ‚Í0‚É•]‰ż‚ł‚ę‚˝‚ćB‹ć•Ę‚Ĺ‚Ť‚Č‚˘ƒP[ƒX‚Á‚Ä‚Ç‚¤‚˘‚¤ę‡H
604 :
2011/05/31(‰Î) 06:28:27.99
BEGIN {
    # ‰Šú‰ť’źŒă (–˘Žg—p) ‚̕ϐ”‚͐”’l (0) ‚Ć•śŽš—ń ("") ‚Ě—ź•ű‚ĚŒ^‚đŽ‚ÂB
    print x == 0, x == ""; # —ź•ű‚Ć‚ŕ^

    x = 0;
    print x == 0, x == ""; # ‘OŽŇ‚̂ݐ^B

    x = "";
    print x == 0, x == ""; # ŒăŽŇ‚̂ݐ^B

    # ‘ź‚Ě–˘Žg—p‚̕ϐ”‚đ‘ă“ü‚ˇ‚é‚Ć "Ä‰Šú‰ť" ‚Ĺ‚Ť‚éB
    x = y;
    print x == 0, x == ""; # —ź•ű‚Ć‚ŕ^B
}
605 :
2011/05/31(‰Î) 22:57:53.71
> ‰Šú‰ť’źŒă (–˘Žg—p) ‚̕ϐ”‚͐”’l (0) ‚Ć•śŽš—ń ("") ‚Ě—ź•ű‚ĚŒ^‚đŽ‚ÂB
IEEE Std 1003.1 ‚Ě awk ‚Ě EXTENDED DESCRIPTION ‚Ě
Variables and Special Variables ‚ɏ‘‚˘‚Ä‚ ‚é‚ˁB uninitialized value ‚Ć‚˘‚¤‚ç‚ľ‚˘B
POSIX‚ɏ€‹’‚ľ‚Ä‚éawk‚Č‚ç‚ą‚¤‚Č‚é‚Ý‚˝‚˘‚ž‚Ż‚ǁAƒIƒŠƒWƒiƒ‹‚Í’m‚ç‚ńB

Ä‰Šú‰ť‚ˇ‚é‚Č‚ç$(NF+1)Žg‚¤‚Ů‚¤‚Ş‚˘‚˘‚Š‚ŕ‚ˁB–˘Žg—p‚̕ϐ”‚đ—pˆÓ‚ľ‚Č‚­‚Ä‚˘‚˘B
‚ž‚Ż‚ǁA‚ť‚ę‚Ş•K—v‚ȏę–Ę‚ŞŽv‚˘•‚‚Š‚΂Ȃ˘‚ށB

ŠÖŒW‚Č‚˘‚Ż‚ǁAabsŠÖ”‚Á‚Ä‚Č‚˘‚ń‚ž‚ˁB•Ę‚É—Ç‚˘‚Ż‚ǁAƒÎ‚âA
0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”‚Í’č‹`‚ľ‚Ä‚Ä‚Ů‚ľ‚˘‚Č‚ B
606 :
2011/06/02(–Ř) 10:09:14.37
>>605
> Ä‰Šú‰ť‚ˇ‚é‚Č‚ç$(NF+1)Žg‚¤‚Ů‚¤‚Ş‚˘‚˘‚Š‚ŕ‚ˁB–˘Žg—p‚̕ϐ”‚đ—pˆÓ‚ľ‚Č‚­‚Ä‚˘‚˘B
ƒtƒB[ƒ‹ƒh•Ď”‚͏í‚É•śŽš—ńŒ^‚ŁA ”’lŒ^‚ÍŽ‚˝‚Č‚˘B
607 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/06/02(–Ř) 22:47:31.10
ƒÎ‚Íatan2(0,-1)‚Ĺ‚˘‚˘‚Ć‚ľ‚Ä
u0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”v‚Á‚Ä‚Ç‚¤’č‹`‚ľ‚Ä‚˘‚ÂŽg‚¤‚Ě?
608 :
2011/06/03(‹ŕ) 13:48:37.95
u0‚ć‚č‘ĺ‚Ť‚˘ĹŹ‚Ě•‚“ŽŹ”“_”v‚Ć‚˘‚¤‚Ě‚Ş‰˝‚đŠó–]‚ľ‚Ä‚˘‚é‚Š‚É‚ć‚éB
ˆČ‰ş‚Ě3Ží—Ţ‚Ş‚ ‚éB

(1) ĹŹ‚̐ł‚Ě”ńł‹K”
(2) ĹŹ‚̐ł‚̐ł‹K”
(3) 1.0‚É‘Ť‚ľ‚ÄŠŰ‚ß‚˝Œ‹‰Ę‚Ş1.0‚ć‚č‘ĺ‚Ť‚­‚Č‚éĹŹ‚̐”
609 :
2011/06/03(‹ŕ) 23:58:11.26
>>606
‚ ‚ż‚áI‚ť‚¤‚Ĺ‚ľ‚˝B$‚Ĺ–ß‚é‚Ě‚Í•śŽš—ń‚ž‚Á‚˝B
‚ť‚ĚŽd—l‘“Ç‚ń‚Ĺ‚é‚ƁANF‚đŠg’Ł‚ľ‚˝‚Ć‚ŤAŒłX‚Č‚Š‚Á‚˝Š‚Íuninitialized value‚É‚Č‚é‚Á‚Ä‚ ‚Á‚˝‚̂ŁB

>>607
‚ť‚ę‚Ĺ‚˘‚˘‚ń‚ž‚Ż‚ǁAPI‚Ć‚Š‚ĹŽQĆ‚Ĺ‚Ť‚˝‚ç‚ŕ‚Á‚Ć‚˘‚˘A‚ĆŽv‚Á‚˝‚Ě‚Ĺ‚ˇB
>>608
”’lŒvŽZ‚Ě‚˝‚߂ɁAC‚ĚDBL_EPSILON‚Ě‘ă‚í‚č‚É‚Č‚é’萔‚Ş—~‚ľ‚˘‚ȂƁB
”CˆÓ‚̐¸“x‚ĹŠŰ‚ß‚ç‚ę‚éŠÖ”‚ŕ‚Č‚˘‚Ĺ‚ˇ‚ľB
610 :
2011/06/04(“y) 09:41:48.63
DBL_EPSILON‚Ş>>608‚Ě(1)`(3)‚Ě‚Ç‚ę‚Š‚í‚Š‚ç‚Č‚˘H
”’lŒvŽZ‚ĚŠî–{‚Č‚ń‚ž‚ށB
611 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/06/10(‹ŕ) 21:49:33.34
•Ď”–ź‚ȂǁAŽŠ‘O‚Ĺ‚ ‚Á‚Ä‚ŕ‹K‘Ľ‚đˆÓŽŻ‚ľ‚Ä‚˘‚é•ű‚˘‚Ü‚ˇ‚ŠH
awk‚ž‚ƁA‚b•—‚ވę”Ę“I‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
ˆę”ԍŏ‰‚ŞVBA‚ž‚Á‚˝‚̂ŁA’ˇ‚˘–ź‘O‚ĆČ—Ş‚ŞŹ‚´‚Á‚Ä‚ľ‚Ü‚Á‚Ä
ŽŠ•Ş‚ĹƒCƒ‰ƒCƒ‰‚ľ‚Ä‚˘‚Ü‚ˇB
‚Ý‚Č‚ł‚ń‚́A’ʏí‚̕ϐ”‚Í‚ą‚¤A”z—ń‚Í‚ą‚¤A’萔‚Í‚ą‚¤A•śŽšŒ^‚Í‚ą‚¤ĽĽĽ
‚Ć‚˘‚¤‚ŕ‚Ě‚đŽQl‚É‚ľ‚˝‚˘‚Ĺ‚ˇB
612 :
2011/06/10(‹ŕ) 22:10:28.97
>>611
ƒVƒXƒeƒ€ƒnƒ“ƒKƒŠƒAƒ“‚đĚ—p‚ˇ‚é‚Š‚Ç‚¤‚Š”Y‚Ţ‚Ů‚Ç‘ĺ‚Ť‚Č‚ŕ‚Ě‚đawk‚ŏ‘‚˘‚˝‚ą‚Ć‚Ş–ł‚˘
613 :
2011/06/13(ŒŽ) 18:37:34.88
A5‚Č‚í‚â‚ ‚Ó‚§t( ())
614 :
2011/06/15(…) 21:51:26.93
>>611
’xƒŒƒX‚ž‚ށAŒ^_“ŕ—e‚Ěŕ–ž_–ź‘O‚Ý‚˝‚­‚ľ‚Ä‚éB–ź‘O‚Şˆę•śŽš‚ž‚Ć‚ť‚Ě‚Ü‚Ü‚ž‚Ż‚ǁB
ƒOƒ[ƒoƒ‹•Ď”‚Ćƒ[ƒJƒ‹•Ď”‚Ě‚Ç‚Á‚ż˜M‚Á‚Ä‚é‚Ě‚Š•Ş‚Š‚č‚₡‚˘‚悤‚ɁAƒ[ƒJƒ‹•Ď”‚Í•K‚¸l‚ĹŽn‚ß‚é‚悤‚É‚ľ‚Ä‚éB
d_per_shouhizei = 5.0‚Ć‚Š‚ˁB
615 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/06/20(ŒŽ) 18:37:26.17
gawk‚ĹBINMODE‚đÝ’股‚ę‚΃oƒCƒiƒŠ[‚Ě“üo—Í‚Ş‚Ĺ‚Ť‚é‚Ě‚Í‚í‚Š‚é‚Ě‚Ĺ‚ˇ‚ށA
“ü—Í‚ł‚ę‚˝ƒoƒCƒiƒŠ[‚đ16iƒ_ƒ“ƒv‚ľ‚Ä•\ŽŚ‚ˇ‚é‚É‚Í‚Ç‚¤‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
od“™‚ĚŠO•”ƒRƒ}ƒ“ƒh‚đŽg‚¤ˆÓŠO‚É•ű–@‚Ş‚ ‚ę‚΂¨‹ł‚Ś‚­‚ž‚ł‚˘B
616 :
2011/06/20(ŒŽ) 19:17:07.50
printf("%02x\n", $1);
617 :
2011/07/05(‰Î) 00:15:13.83
“ń“x‚Ć˜b‚Š‚Ż‚ń‚Č‚ć
‚¨‘O‚ç‚Á‚Ä‚Ç‚¤‚Ý‚Ä‚ŕƒSƒ~‚ž‚ć‚Č
618 :
2011/07/06(…) 14:04:55.24
ƒSƒ~‚ń‚Č‚ł‚˘
619 :
2011/07/14(–Ř) 23:55:15.84
>>595
gawk4.0.0‚Ĺa[0][0]=1‚ŕ‰Â”\‚É‚Č‚Á‚˝‚ś‚á‚Č‚˘‚Š
620 :
2011/07/30(“y) 19:46:15.81
’´‰SŽŇ‚ĚŽż–â‚Ő\‚ľ–ó‚ ‚č‚Ü‚š‚ńBˆČ‰ş‚̂悤‚Čƒf[ƒ^‚đ
aaa 10
bbb 20
ccc 30
aaa 30
bbb 30
aaa 15
ccc 30
ddd 20
ˆČ‰ş‚̂悤‚É‚Ü‚Ć‚ß‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚Ç‚¤‚ľ‚˝‚炢‚˘‚Ĺ‚ľ‚傤‚ŠH
aaa 55
bbb 50
ccc 60
ddd 25
621 :
2011/07/30(“y) 19:53:38.97
ddd 20 ‚Ĺ‚Í‚Č‚˘‚Š‚ĆŽv‚¤‚Ş‚ą‚ń‚ČŠ´‚ś‚Š‚Č
awk '{a[$1]+=$2} END {for (b in a) {print b " " a[b]}}' | sort
622 :
2011/07/30(“y) 23:15:27.52
Gawk4‚Č‚çPROCINFO["sorted_in"]‚̐ݒč‚ĹĹŒă‚Ěsort‚Ş—v‚ç‚Č‚­‚Č‚é
623 :
2011/07/30(“y) 23:22:20.03
>621
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇI‚¤‚Ü‚­‚˘‚Ť‚Ü‚ľ‚˝B
624 :
2011/07/31(“ú) 15:24:48.76
gawk‚Í‚ŕ‚¤•ĘŒžŒę‚ČƒCƒ[ƒWB•’imawkŽg‚Á‚Ä‚é‚Ć
625 :
2011/08/16(‰Î) 22:48:21.64
‚ą‚ą‚Á‚Đś‚Ť‚Ä‚Ü‚ˇ‚ŠH
626 :
2011/08/18(–Ř) 01:56:26.63
ś‚Ť‚Ä‚Ü‚ˇ‚ń
627 :
2011/08/19(‹ŕ) 00:53:44.39
ś‚Ť‚Ä‚˘‚é‚ą‚Ć‚đŠč‚Á‚ÄŽż–â‚đB
WIN32‚ĚEXEˆę‚‚ŁA‰ş‚ĚTEST.AWK‚ރ}ƒgƒ‚‚É“Ž‚­AWK‚đ’T‚ľ‚Ä‚˘‚Ü‚ˇB
‚ą‚ę‚çˆČŠO‚É‚ ‚č‚Ü‚ˇ‚ŠH

http://hinadori.atnifty.com/~wills/program/gawkm115.zip
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/376460/pack/win95/util/text/awk/gawk-mbcs-win32-20051223.zip?ds
http://my.vector.co.jp/servlet/System.FileDownload/download/http/0/80308/pack/win95/util/text/awk/mw32r27.lzh?ds

Cygwin”Ĺ‚ŕŽŽ‚ľ‚˝‚Ě‚Ĺ‚ˇ‚ރ_ƒ‚Ĺ‚ľ‚˝B

TEST.AWK
{ gsub("[0-9]","x",$0) ; gsub("ż","ƒ\",$0) ; gsub("T","‚s",$0) ; print }

TEST.DAT
ą˛ł´ľśˇ¸šşťź˝žż
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒRƒRƒRƒRƒTƒtƒTƒRƒRƒRƒRƒR
ƒTƒtƒTƒtƒTƒtƒTƒtƒTƒtƒT
628 :
2011/08/19(‹ŕ) 01:00:20.60
TEST.DAT‚́A‹ó”’‚Ş“ü‚Á‚Ä‚˘‚Ü‚ˇB
ęƒuƒ‰‚Ěƒ|ƒbƒvƒAƒbƒv‚đƒRƒsƒy‚ľ‚ĉş‚ł‚˘B
629 :
2011/08/19(‹ŕ) 06:26:54.92
ƒEƒ`‚É‹A‚Á‚Ä‚Š‚ç’˛‚ׂĂ݂é‚ć
630 :
2011/08/19(‹ŕ) 11:02:41.54
>>627|628
cygwin‚Ěawk(GNU Awk 3.1.8)‚Ĺ“Ž‚­‚Ż‚ǁA‚Ç‚¤‚Č‚é‚Í‚¸‚Ş‚Ç‚¤“Ž‚Š‚Č‚˘‚ĆŒž‚Á‚Ä‚˘‚é?
>627‚Ětest.dat‚Č‚çA“–‘Ruƒ\v‚ž‚Ż‚Ş•ĎŠˇ‚ł‚ę‚é‚Ż‚ǁB
631 :
2011/08/19(‹ŕ) 11:55:06.25
iCygwin‚Č‚çUTF8‚ś‚á‚Č‚˘‚Ć‚¤‚Ü‚­“Ž‚Š‚Č‚˘‚Ż‚ǁjShift JIS‚Ĺ“Žě‚ł‚š‚˝‚˘‚Á‚Ä‚ą‚Ć‚Š‚ȁH
Ž–‘O‚ÉTEST.DAT‚đnkf -w‚É’Ę‚ľ‚˝‚ç‘Ę–Ú‚Š‚ȁB
632 :
2011/08/19(‹ŕ) 21:59:57.43
>>627
ƒXƒNƒŠƒvƒg‚ŕDAT‚ŕSJIS‚ĹŽŽ‚ľ‚˝‚Ż‚ǁAă‹L3‚‚̂¤‚żAgawk-mbcs-win32-20051223.zip‚̓_ƒ‚ž‚Á‚˝‚ćB
1s–Ú‚Ş‚ą‚ń‚Č‚ń‚Č‚éB

ąxx´ľśˇ¸xşťxxxƒ\

ŽčŽ‚ż‚Ě
GNU Awk 3.1.7(windows special Nov 24 2009)
‚ŁA--ctype=SJIS‚â‚Á‚Ä‚ŕ“Ż‚śŒ‹‰Ę‚É‚Č‚é‚ˁB

ƒXƒNƒŠƒvƒgADAT‚đUTF-8‚É‚ľ‚āA--ctype=UTF8‚â‚Á‚ăŠƒ_ƒCƒŒƒNƒg‚ľ‚˝ƒtƒ@ƒCƒ‹‚͐łí‚ČŒ‹‰Ę‚ޏo‚é‚ćB
ƒŠƒ_ƒCƒŒƒNƒg‚ľ‚Č‚˘‚ĹƒRƒ}ƒ“ƒhƒvƒƒ“ƒvƒg‚É•\ŽŚ‚ł‚š‚é‚Ɖť‚Ż‚é‚Ż‚ǁB
633 :
2011/08/19(‹ŕ) 23:18:25.14
EUC‚Ȃ生ŠpƒJƒi‚ŕ‚¤‚Ü‚­‚â‚Á‚Ä‚­‚ę‚é‚ń‚ž‚ށc
634 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/08/24(…) 08:07:37.54
gawk‚̓Kƒ“ƒKƒ“‹@”\‚đŠg’Ł‚ľ‚Ä‚é‚Ż‚ǁA
‚ť‚ë‚ť‚ëOOP‘Ήž‚ľ‚Ä‚­‚ę‚Č‚˘‚Š‚ȁB
awk++‚Ć‚Š‚ ‚é‚Ż‚ǁA•W€‚ĹOOP‚Ĺ‚Ť‚ę‚Í•Ö—˜B
635 :
2011/08/24(…) 22:44:37.24
> OOP
...‚ŕ‚Í‚âawk‚Ĺ‚â‚éˆÓ–Ą‚Ş–ł‚˘w ‘ź‚É‚˘‚­‚ç‚Ĺ‚ŕ‚ ‚é•Ę‚ĚŒžŒę‚Ĺ‚˘‚˘‚ś‚á‚ń
636 :
2011/08/25(–Ř) 01:14:17.45
awk‚ɍ݂é‚Ć•Ö—˜‚Š‚ŕ‚ĆŽv‚¤‚Ě‚ÍŽQĆ’l‚­‚炢‚Š‚Č

”z—ń‚âŠÖ”‚Ö‚ĚŽQĆ‚đ’l‚Ć‚ľ‚ÄŽć‚čo‚ľŠi”[‚ľ‚˝‚č
‹t‚É‚ť‚Ě’l‚Š‚çŒł‚Ě”z—ń‚ɃAƒNƒZƒX‚ľ‚˝‚čŒł‚̊֐”‚đŒÄ‚ń‚ž‚čo—ˆ‚é‚Ć
‘Š“–‚É•ĄŽG‚Čƒf[ƒ^\‘˘‚Ş•\Œť‰Â”\‚É‚Č‚éA‚ť‚ę‚ą‚ťOOP‚Á‚Ű‚˘‚ą‚Ć‚ŕ‰Â”\‚ž‚ľ

‚Ĺ‚ŕ‚ ‚ń‚Ü‚č‚â‚â‚ą‚ľ‚˘‚ą‚Ć‚â‚é‚Č‚çPerl‚Ĺ‚˘‚˘‚Š‚ç•K{‚Ĺ‚Í‚Č‚˘‚Ë
637 :
2011/08/25(–Ř) 02:28:23.99
> ŠÖ”‚đŒÄ‚ń‚ž‚č

•Ď”‚Ě’l‚đŠÖ”–ź‚Ć‚ľ‚Ä
var = "sage";
@var();
‚Á‚Ä‚Ĺ‚Ť‚é‚Ż‚ǁA‚ť‚ę‚Ć‚Íˆá‚¤‚Ě‚ńH


638 :
2011/08/25(–Ř) 04:07:56.67
‚¨‚ćA‚ŕ‚¤‚ ‚é‚Ě‚Šw
Ĺ‹ß‚Ěawk‚Í•Ş‚Š‚ç‚Ë‚Śc‚Á‚Ä‚ą‚Ƃ́A”z—ń‚Ö‚ĚŽQĆ‚đŽg‚Á‚Ä“ü‚ęŽq‚Ě”z—ń‚Ć‚ŠŠů‚ɍě‚ę‚ż‚á‚Á‚˝‚股‚é‚Ě‚ŠH
639 :
2011/08/25(–Ř) 10:56:54.36
”z—ń‚Ě”z—ń‚͍ě‚ę‚é‚ćBgawk4‚Č‚çB
640 :
2011/08/25(–Ř) 19:51:33.84
iL_TMjĚ°Ý
641 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/08/25(–Ř) 20:52:51.07
class human {
@@property name
@@property sex
@@property age
@@method new(x, y, z) {
@@@@name = x
@@@@sex = y
@@@@age = z
@@}
@@method say() {
@@@@printf("Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB\n",name, age, sex)
@@}
}
class japanese : human {
@@property name
@@property sex
@@property age
@@method say() {
@@@@printf("Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB\n", name, age, sex)
@@}
}
BEGIN {
@@alice = human.new("ƒAƒŠƒX", "—", 11)
@@taro = japanese.new("‘ž˜Y", "’j", 15)
@@yuka = japanese.new("—R‰Ŕ", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()
}
642 :
641
2011/08/25(–Ř) 20:58:10.41
>>635
http://code.google.com/p/lawker/source/browse/fridge/lib/bash/awk%2B%2B/
‚ą‚ę‚đŽg‚Ś‚΂ą‚Ě’ö“x‚ĚOOP‚Í‚Ç‚¤‚É‚Š‚Ĺ‚Ť‚éB
–{“–‚É‚ą‚Ě’ö“x‚Ĺ‚˘‚˘‚Š‚çOOP‚ɑΉž‚ľ‚Ä‚Ů‚ľ‚˘B
Žg‚¤l‚Í‚Ů‚Ć‚ń‚Ç‚˘‚Č‚˘‚ĆŽv‚¤‚ށA‘S‚­‚Ĺ‚Ť‚Č‚˘‚Ě‚ŕ˘‚éB
643 :
2011/08/25(–Ř) 22:07:53.46
‚ť‚ę‚ÍĹ‘awk‚Ĺ‚ ‚é•K—v‚Ş‘S‚­–ł‚˘
644 :
2011/08/26(‹ŕ) 06:00:04.19
function Human(self,name,sex,age) {
self["property___name"] = name
self["property___sex"] = sex
self["property___age"] = age
self["method___say"] = "Human___say"
}
function Human___say(self) {
printf "Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB\n", self["property___name"], self["property___age"], self["property___sex"]
}

function Japanese(self,name,sex,age) {
Human(self,name,sex,age)
self["method___say"] = "Japanese___say"
}
function Japanese___say(self) {
printf "Ž„‚Í%sB%dÎ‚Ě%s‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB\n", self["property___name"], self["property___age"], self["property___gender"]
}

function methodcall(obj,methodname, m) {
m = obj["method___" methodname]
@m(obj)
}

BEGIN {
Human(alice, "ƒAƒŠƒX", "—", 11)
Japanese(taro, "‘ž˜Y", "’j", 15)
Japanese(yuka, "—R‰Ŕ", "—", 18)
methodcall(alice,"say")
methodcall(taro,"say")
methodcall(yuka,"say")
}
645 :
2011/08/26(‹ŕ) 06:01:35.02
‚˛‚ß‚ńˆę•”gender‚É‚Č‚Á‚Ä‚é‚Š‚çsex‚É’ź‚ľ‚Ć‚˘‚Ä

‚Ć‚č‚ ‚Ś‚¸A‚ą‚ń‚ČŠ´‚ś‚Ĺgawk4‚Ĺ‚ŕOOPŽŠ‘Ě‚Ío—ˆ‚é‚ć‚Á‚Ęb
646 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/08/27(“y) 15:07:17.61
>>644
‚Č‚é‚قǂˁ[
‚Ć‚Ä‚ŕ•×‹­‚É‚Č‚č‚Ü‚ˇ

‚Ĺ‚ŕA‚â‚Á‚Ď‚čOOP—p‚̍\•ś‚ŞŽg‚Ś‚ę‚΃xƒXƒg‚Ĺ‚ˇ‚Ë
‚ť‚Ě‚Ů‚¤‚Ş‚í‚Š‚č‚₡‚˘‚ĆŽv‚˘‚Ü‚ˇ
647 :
2011/08/27(“y) 15:58:44.09
‚â‚Á‚Ď•ĘŒžŒęŽg‚¤‚ׂŤ‚ž‚ë
648 :
2011/08/27(“y) 16:10:36.72
–{“–‚É—~‚ľ‚˘‚ń‚Č‚çAgawk‚ĚML‚É‚ą‚¤‚ˇ‚ę‚ÎOOPŽŔŒť‚Ĺ‚Ť‚é‚ą‚Ć‚đ”­ŒŠ‚ľ‚˝‚ń‚ž‚Ż‚ǁA
‚ą‚ę‚Ě“œˆß\•ś‚đ—pˆÓ‚ľ‚Ä‚­‚ę‚Á‚Ä“Še‚ˇ‚é‚Ć‚˘‚˘‚ń‚ś‚á‚Ë
switch‚ŕŽŔ‘•‚ł‚ę‚Ä‚é‚ľA—~‚ľ‚˘l‚Ş‹‚é‚Ć•Ş‚Š‚ę‚Εt‚Ż‚Ä‚­‚ę‚é‚Š‚ŕ‚ć
649 :
2011/08/27(“y) 16:25:08.65
#! /usr/bin/env python
# -*- coding: utf-8 -*-

class human:

@@def __init__(self, name, sex, age):
@@@@self.name = name
@@@@self.sex = sex
@@@@self.age = age

@@def say(self):
@@@@print("Ž„‚Í" + self.name + "B" + str(self.age) + "Î‚Ě" + self.sex + "‚Ĺ‚ˇB")

class japanese(human):

@@def __init(self):
@@@@super(human, self).__init__(self)

@@def say(self):
@@@@print("Ž„‚Í" + self.name + "B" + str(self.age) + "Î‚Ě" + self.sex + "‚Ĺ‚ˇB‘Đ‚Í“ú–{‚Ĺ‚ˇB")

if __name__ == "__main__":

@@alice = human("ƒAƒŠƒX", "—", 11)
@@taro = japanese("‘ž˜Y", "’j", 15)
@@yuka = japanese("—R‰Ŕ", "—", 18)
@@alice.say()
@@taro.say()
@@yuka.say()
650 :
2011/08/27(“y) 16:26:25.23
python‚ŏ‘‚˘‚Ä‚Ý‚é‚ƁA
>>641‚Ć”ä‚ׂé‚Ć“Á‚É‚í‚Š‚č‚₡‚˘‚í‚Ż‚Ĺ‚ŕ‚Č‚˘‚Ż‚Ç
>>644‚ć‚č‚Í‚í‚Š‚č‚₡‚˘
651 :
2011/08/27(“y) 16:53:49.92
‚ť‚č‚áawk‚ÍOOPL‚Ĺ‚Í‚Č‚˘‚Š‚ç‚Č
‚ ‚­‚Ü‚ĹƒVƒFƒ‹‚Ě‚¨‹Ÿ‚Ĺ‚˘‚˘‚ĆŽv‚¤‚ń‚ž
‚ť‚ľ‚Ä‚ť‚ą‚ɍ‚“x‚ČOOP‹@”\‚Í—v‚é‚Ć‚ÍŽv‚Ś‚Č‚˘
‚Ç‚ż‚ç‚Š‚ĆŒž‚Ś‚΃tƒB[ƒ‹ƒh’Šo‚Ć‚Š‚đ‚ŕ‚Á‚Ć•Ö—˜‚É‚ˇ‚ׂŤ‚ž‚ć
652 :
2011/09/17(“y) 15:34:39.29
cygwinˆČŠO‚Ĺgawk4.0‚đwindows‚ĹŽg‚¨‚¤‚ĆŽv‚Á‚˝‚çAƒoƒCƒiƒŠ‚Í‚Ç‚ą‚Ĺ“üŽč‚Ĺ‚Ť‚ŕ‚¤‚ˇ‚Š‚ˁH
653 :
2011/09/17(“y) 16:28:58.78
cygwin ‚Ĺ‘Ę–Ú‚Č——R‚Ş•Ş‚Š‚ç‚Č‚˘‚Š‚ç‹ł‚Ś‚ç‚ę‚Č‚˘B
654 :
2011/09/18(“ú) 08:02:36.95
655 :
2011/09/19(ŒŽ) 13:00:55.06
>654 ‚ł‚ń‚­‚ˇ‚ą

>653 awk‚ĚŽŔsŒ`ŽŽ‚ž‚Ż“üŽč‚ˇ‚ę‚Ηǂ˘‚悤‚É‚ľ‚˝‚˘‚Ě‚łB
656 :
2011/09/19(ŒŽ) 14:01:43.39
ƒoƒCƒiƒŠŒÝŠˇ‚ĚWindows‚Ȃ̂ɁAcygwin‚Äexe‚đ‚ŕ‚Á‚Ä‚­‚ž‚Ż‚ś‚áŽg‚Ś‚Č‚˘‚́H
657 :
2011/09/19(ŒŽ) 16:07:37.39
•¨‚É‚ć‚Á‚Ä‚ÍŽg‚Ś‚˝‚悤‚Č‹C‚Ş‚ˇ‚éB
cygwin1.dll‚ž‚Á‚ŻH‚ɃpƒX‚Ş’Ę‚Á‚Ä‚ę‚Αĺ‘ĚŽg‚Ś‚˝‚悤‚Č‹C‚Ş‚ˇ‚éB
658 :
2011/09/19(ŒŽ) 17:00:12.76
Œ‹\‘ňŽR‚Ědll‚Ş—v‚é‚ć
ƒRƒ}ƒ“ƒh‚É‚ć‚é‚Ż‚Ç
659 :
2011/10/24(ŒŽ) 01:55:49.24
‹ł‚Ś‚Ä‚­‚ž‚ł‚˘B‰pŒę“žˆÓ‚Ȑl

http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
‚́@asort(), asorti()‚ĹŽg‚¤ƒ†[ƒU[’č‹`‚Ě”äŠrŠÖ”‚ɂ‚˘‚Ä
3”Ô–Ú‚Ěˆř”‚ĆPROCINFO["sorted_in"]‚ɐݒ股‚é‚Ě‚Ćˆá‚¤‚Ě‚Š“Ż‚ś‚Č‚Ě‚ŠH

‚ť‚ę‚Ć
http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
‚ɏ‘‚˘‚Ä‚ ‚é3”Ô–Ú‚Ěˆř”‚Ěŕ–ž("descending"‚Ć‚Š)‚Ş—ź—§‚ľ‚Ä‚ń‚́H
660 :
2011/10/24(ŒŽ) 11:34:13.18
http://www.gnu.org/s/gawk/manual/gawk.html#Array-Sorting-Functions
As with PROCINFO["sorted_in"], this argument may be the name of a user-defined function, ....

http://www.gnu.org/s/gawk/manual/gawk.html#String-Functions
The third argument can also be a user-defined function name ....
‘ćŽOˆř”‚Ě’l‚Ć“Ż–ź‚̊֐”‚Ş’č‹`Ď‚Ý‚Č‚ç‚ť‚ę‚đ—˜—p‚ˇ‚é‚Ć‚ŠA
‚ť‚¤‚˘‚¤•ű–@‚Ĺ‹ć•Ę‚ľ‚Ä‚é‚ń‚ś‚á‚Č‚˘‚Ě
661 :
2011/10/24(ŒŽ) 13:33:04.59
>>659
”äŠrŠÖ”‚Ě—^‚Ś•ű‚ÍPROCINFO["sorted_in"]‚Ěę‡‚Ć“Ż‚ś‚Á‚Ä‚ą‚Ć‚ž‚ëB

ŽŠ•Ş‚Ĺ’č‹`‚ľ‚˝ŠÖ”‚Ě–ź‘O‚Ĺ‚ŕ‚˘‚˘‚ľA11.2.1.2‚ɏ‘‚˘‚Ä‚ ‚é‚悤‚É‚ˇ‚Ĺ‚É—pˆÓ
‚ł‚ę‚Ä‚˘‚é@`‚đŽg‚Á‚Ä‚ŕ‚˘‚˘B

662 :
2011/11/14(ŒŽ) 21:59:05.28
ŒÂl“I‚ɂ́AGAWK‚É‚Í‚ ‚ƁAC‚ŏ‘‚˘‚˝ŠÖ”‚ĚŒÄ‚Ńo‚ľ‚Ć‚˘‚¤‚Š
GAWK‚ĹŒÄ‚ÔŠÖ”‚đC‚ŏ‘‚Ż‚é‹@”\‚Ş—~‚ľ‚˘‚ĆŽv‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁA
‚ą‚ąŒŠ‚éŒŔ‚萢ŠÔ“I‚É‚Í‚ ‚ń‚Ü‚čŽů—v‚Č‚˘‚ń‚Š‚Ë‚ĽB

‚Ü‚ŸA‚ť‚ę‚â‚é‚­‚炢‚Č‚çGAWKŽŠ‘Ě‚É•ĎX‚đ‰Á‚Ś‚čăRƒ“ƒpƒCƒ‹‚ľ‚ë‚Á‚Ä‚ą‚Ć‚Š‚ŕ‚ľ‚ę‚Č‚˘‚Ż‚ǁB
663 :
2011/11/15(‰Î) 01:44:31.01
P‚Ć‚ŠRŽg‚ŚŒž‚í‚ę‚é‚ĆŽv‚¤B
664 :
2011/11/15(‰Î) 01:58:32.43
>>662
ttp://www.gnu.org/s/gawk/manual/html_node/Dynamic-Extensions.html
‚ś‚áƒ_ƒHŤ—ˆ“I‚É‚ł‚ç‚ÉŠg’Ł‚ł‚ę‚é‰Â”\Ť‚Í‚ ‚é‚Ý‚˝‚˘‚ž‚Ż‚Ç
665 :
2011/12/09(‹ŕ) 00:35:09.18
Ĺ‹ßawkcard‚đ’m‚Á‚čŔ‰E‚É’u‚˘‚Ä‚é‚Ě‚ž‚ށA“ú–{Œę”Ĺ‚Á‚Ä‘śÝ‚ˇ‚é‚Ě‚ž‚낤‚ŠB
666 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2011/12/22(–Ř) 16:57:35.32
ttp://gauc.no-ip.org/awk-users-jp/blis.cgi/DoukakuAWK_271
‚ą‚ą‚ɏ‘‚˘‚Ä‚ ‚é’Ę‚č‚É‚ľ‚Ä‚ŕ“ú–{Œę‚É–|–ó‚ł‚ę‚Ü‚š‚ń
‚Ç‚¤‚ľ‚Ä‚Ĺ‚ˇ‚ŠH
ŠÂ‹Ť‚Í LinuxMint12 A GNU Awk 3.1.8 ‚Ĺ‚ˇ
667 :
2011/12/22(–Ř) 18:01:49.60
>>666
‚ť‚Ě’Ę‚č‚É‚â‚Á‚˝‚ĆŒž‚¤‚Ě‚Č‚çA‰˝ŒĚpoƒtƒ@ƒCƒ‹‚đ’ńŽŚ‚ľ‚Č‚˘‚Ě‚Š‚ˁAƒ_ƒ~ƒAƒ“ŒNB
668 :
2011/12/22(–Ř) 18:07:45.38
>>667
po‚͍쐬‚ľ‚Ü‚ľ‚˝‚ľAmo‚ŕŠ’č‚ĚƒfƒBƒŒƒNƒgƒŠ‚É‚ ‚č‚Ü‚ˇB
po‚ÍŽŠ•Ş‚Ĺ•ŇW‚ľ‚Ä‚ŕA‚ť‚ĚƒTƒCƒg‚Ě“ŕ—e‚đƒRƒsƒy‚ľ‚Ä‚ŕƒ_ƒ‚Ĺ‚ľ‚˝B

$ cat gettext.po
#: gettext.awk:10
msgid "********** Count Prime Number **********"
msgstr " ‘f”‚𐔂Ś‚é "

#: gettext.awk:14
msgid "2 is a prime number."
msgstr "2 ‚Í‘f”‚Ĺ‚ˇB"

#: gettext.awk:24
msgid "%d is a prime number.\n"
""
msgstr "%d ‚Í‘f”‚Ĺ‚ˇB\n"

$ ls ja_JP/LC_MESSAGES/
gettext.mo
669 :
2011/12/22(–Ř) 18:10:02.43
Œ‹‰Ę‚Í‚ą‚Ě’Ę‚č‚Ĺ‚ˇB

$ LC_ALL=ja_JP gawk -f gettext.awk 10
********** Count Prime Number **********
2 is a prime number.
3 is a prime number.
5 is a prime number.
7 is a prime number.
670 :
2012/01/12(–Ř) 13:56:36.33
‚¸‚˘‚Ô‚ńawk‚Š‚ç—Ł‚ę‚Ä‚˘‚Ä‹v‚ľ‚Ô‚č‚ÉŽg‚Á‚˝‚ç
nawk‚É“ú–{Œę‚ĚƒoƒO‚Ş‚ ‚é‚ą‚Ć‚É‚ľ‚΂炭‹C‚Ă‚Š‚Č‚Š‚Á‚˝
substr()‚Ĺutf-8‚ĚƒeƒLƒXƒg‚đŘ‚čo‚ˇ‚Ć‚¨‚Š‚ľ‚Č’l‚É‚Č‚é
gawk‚Ĺ‚Í’ź‚Á‚Ä‚˘‚é
671 :
2012/01/12(–Ř) 19:50:49.28
‚ť‚ŕ‚ť‚ŕUTF-8‚ɑΉž‚ľ‚Ä‚˝‚Á‚Ż
672 :
2012/01/13(‹ŕ) 00:28:07.37
ttp://blog.livedoor.jp/corbie/archives/cat_94960.html
Žc”O‚Č‚Ş‚çAƒVƒtƒgJISAUTF-8—ź•ű‚Őłí‚É“Žě‚ľ‚ť‚¤‚ČWindows”Ĺgawk‚ÍŒó•â‚Ě’†‚É‚ ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
673 :
2012/01/13(‹ŕ) 07:52:50.95
Linux‚Ĺ‚Í•’Ę‚É“Ž‚­‚ށc
674 :
2012/04/29(“ú) 21:07:39.93
ƒtƒ@ƒCƒ‹–ź‚Ş"*.txt"‚Ěˆę——‚đŽć“ž‚ˇ‚é‚Ć‚ŤA"\.txt"‚Ĺƒ}ƒbƒ`‚ł‚š‚é‚ƁA”CˆÓ‚Ěˆę•śŽš.(ƒhƒbƒg)‚ƉđŽß‚ł‚ę‚Ä‚ľ‚Ü‚¤‚ń‚Ĺ‚ˇ‚ށA‚˘‚˘•ű–@–ł‚˘‚Ĺ‚ľ‚傤‚ŠH
675 :
2012/04/29(“ú) 22:04:14.36
GNU Awk 3.1.7‚ž‚Ćƒhƒbƒg‚Ƀ}ƒbƒ`‚ľ‚˝‚Ż‚Ç‚ť‚ŕ‚ť‚ŕawk‚Ě˜bH
‹ď‘Ě“I‚ɃRƒ}ƒ“ƒh‚Ş‚Ů‚ľ‚˘‚Č
676 :
2012/04/29(“ú) 22:08:23.01
ş˜a‚̍ Šo‚Ś‚˝ƒAƒZƒ“ƒuƒ‰‚ĆCŒžŒę
‚ą‚ę‚Ş‚ ‚Á‚˝‚Š‚ç
‚˘‚Ü‚ž‚ÉŽŠ•Ş‚Ş‘š‚Č‹ĆŠE‚ŔтđH‚Á‚Ä‚é
677 :
2012/04/29(“ú) 22:36:10.83
>>676
‚ť‚ą‚Š‚ç‚Š‚‚–‚‚ɍs‚Á‚ăXƒ}ƒzƒAƒvƒŠŠJ”­‚Č‚ç‚ŕ‚¤ˆę‰Ôç‚˘‚˝‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ë‚—
678 :
2012/04/29(“ú) 23:09:38.43
”nŽ­‚É‚Í–ł—
679 :
2012/04/30(ŒŽ) 18:07:43.22
>>675
ls | awk '{ if( match($0,"\.txt") > 0) print $0 }'
Ş‰ďŽĐ‚ĚƒT[ƒoă‚Ĺ‚ą‚ń‚ČŠ´‚ś‚Ě‚ą‚Ć‚â‚낤‚Ć‚ľ‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށA
ugawk: Œx: ƒGƒXƒP[ƒvƒV[ƒPƒ“ƒX `\.' ‚Í `.' ‚Ć“Ż“™‚Ɉľ‚í‚ę‚Ü‚ˇv
‚ĆƒƒbƒZ[ƒW‚ޏo—Í‚ł‚ęAƒhƒbƒg‚Ş”CˆÓ‚Ěˆę•śŽšH‚ƉđŽß‚ł‚ę‚袂Á‚Ä‚˘‚Ü‚ľ‚˝‚ށA
ŽŠŒČ‰đŒˆ‚ľ‚Ü‚ľ‚˝B(ŽŠ‘î‚ĚLinuxPC‚Ĺ“ŽěŠm”F‚ľ‚Ü‚ľ‚˝BGAWK3.1.7‹y‚Ń4.0.1)
"\.txt"‚Ĺ‚Í–ł‚­‚āA".txt"‚Ĺ—Ç‚Š‚Á‚˝‚ń‚Ĺ‚ˇ‚ˁB
‚¨‘›‚Ş‚š‚ľ‚Ü‚ľ‚˝B

‚ŕ‚ľ‚Š‚ľ‚˝‚çA‰ďŽĐ‚ĚƒT[ƒo(RHEL)‚ĚGAWK‚ŞŒĂ‚­‚Ä‰đŒˆ‚Ĺ‚Ť‚Ä‚Č‚˘‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚ށB
680 :
2012/04/30(ŒŽ) 20:27:16.48
>>679
match() ‚Ě‘ć“ńˆř”‚É•śŽš—ń‚đ—^‚Ś‚˝ę‡‚ÍŽ–‘O‚ɐł‹K•\Œť‚Ö‚ĚŒ^•ĎŠˇ‚ލs‚í‚ę‚é‚ŞA
‚ť‚ĚŰ‚ÉƒGƒXƒP[ƒv‚ŞŠO‚ę‚Ä /.txt/ ‚Ć“Ż“™‚É‚Č‚Á‚Ä‚ľ‚Ü‚¤A ‚Ć‚˘‚¤‚ą‚Ć‚Š‚ƁB
‚‚܂č "\\.txt" ‚Ć‚ˇ‚é‚ŠA ł‹K•\Œť‚Ě /\.txt/ ‚đ—^‚Ś‚ę‚΂悢B

The GNU Awk User's Guide ‚É‚ŕ‚ą‚ĚŒťŰ‚ɂ‚˘‚Ä‚Ěŕ–ž‚Í‚ ‚é‚ŞA
~ !~ ‰‰ŽZŽq‚ɂ‚˘‚Ä‚ľ‚ŠG‚ę‚ç‚ę‚Ä‚˘‚Č‚˘B
ttp://www.kt.rim.or.jp/~kbk/gawk-30/gawk_5.html#SEC32
681 :
2012/05/24(–Ř) 00:27:31.74
gawk4.0.2•t‘Ž‚ĚŒ´”Ĺ‚Ĺ‚Ímatch‚Ěŕ–ž‚É‚ŕ‚ť‚̕ӐG‚ę‚ç‚ę‚Ä‚é‚ˁB
http://www.gnu.org/software/gawk/manual/html_node/String-Functions.html#String-Functions
’N‚Š‚ą‚Ěƒo[ƒWƒ‡ƒ““ú–{Œę‰ť‚ľ‚Ä‚Č‚˘‚Š‚ȁB
682 :
2012/07/12(–Ř) 02:26:40.35
FIFO‚ČŠ´‚ś‚̐ć“ü‚ęćo‚ľ‚Ěƒoƒbƒtƒ@‚ɂ͉˝Žg‚Ś‚΂˘‚˘H
‚Ć‚˘‚¤‚ŠA
Array‚ŁA‚˝‚Ć‚Ś‚ÎA[3] ‚Š‚çA[8]‚Ü‚Ĺ‚Ěƒf[ƒ^‚đA[1]‚Š‚çA[6]‚É“Ž‚Š‚ˇ‚ɂ͉˝‚ވę”Ô‘‚˘H
‚Ĺ‚Ť‚ę‚Δz—ń‚Í‚P‚‚ľ‚ŠŽg‚˘‚˝‚­‚Č‚˘‚Ě‚ž‚ށA–ł—‚ž‚낤‚Šc
683 :
2012/07/12(–Ř) 09:23:22.92
‘Ź‚ł‚đ‹‚ß‚é‚Č‚ç–ˆ“x‘S—v‘f‚¸‚炡‚ć‚čA“ǂݏo‚ľˆĘ’u‚Ə‘‚Ťž‚ÝˆĘ’u‚Ě“YŽšŽ‚Á‚Ä
ŠÇ—‚ľ‚˝•ű‚Ş‚˝‚˘‚Ä‚˘‘Ź‚˘
684 :
2012/07/12(–Ř) 10:14:32.78
awk‚ɂ͘A‘z”z—ń‚ľ‚Š‚Č‚˘‚ľ‚Č
685 :
2012/07/14(“y) 14:35:06.22
ƒŠƒ“ƒOƒoƒbƒtƒ@‚ʼn˝‚Ć‚Š‚Č‚é‚Č‚çƒŠƒ“ƒOƒoƒbƒtƒ@‚Š‚Č
686 :
2012/07/14(“y) 22:27:17.73
>>682
BEGIN{
@QMAX=3
@QTopPos=0;QTailPos=0;QNum=0;
@deQ();
@enQ("1");deQ();
@enQ("a");enQ("b");enQ("c");enQ("x");deQ();deQ();deQ();deQ();
}
function enQ(PushVal){
@if (QNum+1 > QMAX){print "‚¨‚Č‚Š‚˘‚Á‚Ď‚˘"; return;}
@nextPos = (QTopPos+1) % QMAX;
@queue[QTopPos] = PushVal;
@QTopPos=nextPosQNum++;
}
function deQ(){
@if (QNum < 1){print "‚Š‚ç‚Á‚Ű"; return}
@QNum--;@TailVal=queue[QTailPos]
@QTailPos = (QTailPos +1) % QMAX;
@print TailVal;
@return TailVal;
}
687 :
2012/07/14(“y) 22:54:06.64
Ş‚ĚŒ‹‰Ę‚Í‚ą‚ń‚ČŠ´‚śB
>‚Š‚ç‚Á‚Ű
>1
>‚¨‚Č‚Š‚˘‚Á‚Ď‚˘
>a
>b
>c
>‚Š‚ç‚Á‚Ű

>>685‚̏‘‚˘‚Ä‚˘‚郊ƒ“ƒOƒoƒbƒtƒ@ŽŔ‘•‚Ĺ‚ˇB
enqueue,dequeue‰ń”‚Ş‘˝‚˘‚Č‚çƒŠƒ“ƒOƒoƒbƒtƒ@‚Ĺ—Ç‚˘‚ĆŽv‚¤B
‘ĺ’ď‚Ěę‡‚ÍQMAX‚É‘ĺ‚Ť‚Č’l‚đÝ’股‚ę‚ÎŽ–‘Ť‚č‚éƒnƒY‚ž‚Ż‚Ç
ăŒŔ‚ŞŒˆ’č‚Ĺ‚Ť‚Č‚˘“™‚ĚŽ–î‚Ş‚ ‚ę‚Îdelete array‚đŽg‚Á‚˝’Pƒ‚Č”z—ńŠÇ—‚Š‚ȁB
‚˝‚ž“Y‚ŚŽš‚ސ”’lăŒŔ‚đ’´‚Ś‚Č‚˘—l‚ȍH•v‚Í•K—v‚ž‚ˁB
688 :
2012/07/15(“ú) 21:09:36.15
ƒŠƒ“ƒO‚Ĺ‚ŕăŒŔ‚đ’č‚ß‚é‚Ć“ü—̓XƒgƒŠ[ƒ€‚̏ăŒŔ‚Ş•s–ž‚Čę‡‚Ü‚¸‚˘‚ą‚Ć‚É‚Č‚é‚̂ŁAŒťÝ‚Í
A=“ü—ÍArray,CˆęŽž•ŰŠÇ,i,k,n,p
  k=1;C[0]=0;
  for(i=1;i<=A[0];i++){n=0;while(k<i && A[k++]=C[n+=1]);if(n){
  delete C[C[0]+1];C[0]-=n;p=0;while(C[p+=1]=C[n+=1]);}p=1;
  while(match(substr(A[i],p),re)){p+=RSTART-1;n=substr(A[i],p,RLENGTH);
  if(k<i){A[k++]=n;}else{C[C[0]+=1]=n;};p+=RLENGTH;}};n=1;
  while(A[k++]=C[n]){delete C[n++];};A[0]+=C[0]-1;C[0]=0;
‚đŽg‚Á‚Ä‚˘‚éB
re=regexp‚Ć‚ľ‚āAArray A‚Ɉę’v‚ˇ‚éƒf[ƒ^‚Ş‚ ‚ę‚Ú‚ť‚ę‚đŽć“žAŒ‹‰Ę‚đArray A‚ɏo—́AA[0]‚ɍ‡Œv‚Ş‹LÚB

‚ą‚ęˆČăiƒR[ƒhƒTƒCƒYA‚ ‚é’ö“x‚Ě‘Ź“xAƒƒ‚ƒŠ‚ĚŽg—p—Ę‚đ‹É—͏­‚Č‚­j‚Ć‚˘‚¤đŒ‚ĹĹ“K‰ť‚Ĺ‚Ť‚é‚ž‚낤‚Šc
‚ž‚ę‚Š—Š‚ށB
“ü—Í‚Ćo—͐悪“Ż‚ś‚Ĺ‚ŕA•Ę‚Ĺ‚ŕě“Ž‚ˇ‚éƒR[ƒh‚Č‚çŽ‚Ě‚ą‚Ć—Ç‚˘‚Ě‚ž‚ށc
689 :
2012/07/17(‰Î) 00:02:18.87
‚ą‚ę‚Í‚Đ‚Ç‚˘
ƒfƒoƒbƒO‚ŕŠg’Ł‚ŕ–ł—‚ś‚á‚Ë
690 :
2012/07/17(‰Î) 22:03:00.62
Šî–{“I‚Ɉę“xě‚Á‚ÄŒă‚Í•K—v‚ɉž‚ś‚ăRƒsƒy‚ž‚Ş‚ç‚ȁB‘ź‚É‚Í
function grep( o, re, p, B, this, a ){
B[0]=0;if(o~"-v"){while((getline v < p)>0){if(!match(v,re))B[B[0]+=1]=v;}return B[0];};
if(o~"-o"){while((getline v < p)>0){a=v;while(match(a,re)){B[B[0]+=1]=substr(a,RSTART,RLENGTH);
a=substr(a,RSTART+RLENGTH);}};return B[0];};while((getline v < p)>0){if(match(v,re))B[B[0]+=1]=v;}return B[0];
}
‚Č‚ń‚Š‚ŕ—Ç‚­Žg‚¤Bgrep("-o","pattern","/var/log",data);‚Ý‚˝‚˘‚ČŠ´‚ś‚ŁB‘O‚Ě‚Íagrep("-v",pattern,B,C)‚Ěˆę•”•ŞB
“ú‚˛‚ë‚Ěƒƒ“ƒe‚Ĺ‚ż‚ĺ‚Á‚Ć‚ľ‚˝Žčě‹Ć‚ś‚á‚ß‚ń‚Ç‚˘‚Ě‘g‚Ţ‚Ć‚Ť‚ɁA‚قڐ”•Ş‚Ĺ‘g‚Ý‚ ‚Ş‚é‚Ě‚ŞŠy‚Č‚ń‚ž‚ćB
ƒTƒuƒvƒƒZƒX‚Ć‚ľ‚ÄgrepŒÄ‚яo‚ˇ‚Ě‚ŞƒRƒXƒg‚Š‚Š‚鎞‚Ć‚ŠAperl‚Ş”j‘š‚ľ‚˝ó‹ľ‚Ĺ‚ĚƒŠƒJƒoƒŠ[ƒXƒNƒŠƒvƒg‚Ć‚ľ‚Ä‘g‚ń‚ž‚Ě‚ŞŒł‚ž‚Ż‚ǁB
ƒJ[ƒlƒ‹‚ł‚Śś‚Ť‚Ä‚˘‚ę‚ÎŒă‚ÍawkƒoƒCƒiƒŠ—Ź‚ľž‚ß‚ÎŽg‚ŚAsh‚Ş”ź•ŞŽ€‚ń‚Ĺ‚˘‚Ä‚ŕ‚Č‚ń‚Ć‚Š“Ž‚­‚ľB
691 :
2012/07/21(“y) 23:12:03.74
>>688
BEGIN{
@QMAX=9007199254740991
@QTopPos=QTailPos=QNum=0;
@hitTop=0;
@A[++z]="hoge";
@A[++z]="1 2 3 4 5";
@A[++z]="fuga";
@A[0]=z;
@for(i=1;i<=A[0];i++){
@@p=1;
@@while(match(substr(A[i],p),/[0-9]+/)){
@@@p+=RSTART-1;
@@@enQ(substr(A[i],p,RLENGTH));
@@@p+=RLENGTH;
@@}
@@if(QNum>0){
@@@while(QNum && hitTop<i)A[++hitTop]=deQ();
@@}else{
@@@delete A[i];
@@}
@};
@if(QNum>0) while(QNum)A[++A[0]]=deQ();
@for(z=1;z<=A[0];z++)print "A[" z "]:" A[z];
}
692 :
2012/07/21(“y) 23:44:24.03
691‚Ě‘ą‚Ť
‚ż‚Ȃ݂ɁAA[1]`A[A[0]]‚đgrep‚ľ‚ÄŒ‹‰Ę‚ÍA[1]`A[?]‚É–ß‚ˇƒXƒNƒŠƒvƒg‚ˁB
•Ą”Œƒ}ƒbƒ`‚ˇ‚鎖‚Ş‚ ‚é‚Ě‚Ĺ–˘ˆ—s‚đă‘‚Ť‚ľ‚Č‚˘‚悤‚ɃLƒ…[Žg‚Á‚Ä‚éB
function enQ(PushVal){
@if (QNum+1 > QMAX){print "Queue Overflow"; exit;}
@nextPos = (QTopPos+1) % QMAX;
@QBody[QTopPos]=PushVal;
@QTopPos=nextPos
@QNum++;
}
function deQ(){
@if (QNum<1){print "Illigal dequeue"; exit;}
@QNum--;
@TailVal=QBody[QTailPos];
@delete QBody[QTailPos];
@QTailPos=(QTailPos +1) % QMAX;
@return TailVal;
}
ƒŠƒ“ƒOƒoƒbƒtƒ@‚̏ăŒŔ’´‚Ś‚˝‚çI—š‚ł‚š‚Ä‚é‚Ż‚Ç>>688‚ĚŽŔ‘•‚ŕăŒŔ’´‚Ś‚˝‚çƒoƒO‚é‚ľ‹–‚ľ‚āB
Œv‚Á‚Ä‚Č‚˘‚Ż‚ǃ‹[ƒv‚Ş‚Č‚˘•Ş‘‚˘”¤BƒR[ƒhƒTƒCƒY‚Í‚¨Ž@‚ľB
ƒƒ‚ƒŠ‚ÍA[]‚Ƀf[ƒ^•ř‚Ś‚Ă鎞“_‚ĹƒAƒEƒg‚ČŠ´‚ś‚ž‚Ż‚ÇA[]‚đ“K‹XÁ‚ˇ‚悤‚É‚ľ‚Ć‚˘‚˝B
o—͐ć‚đ•Ę‚É‚ľ‚˝‚˘‚Č‚çA[]‚ÉdeQ()‚š‚¸•Ę•Ď”‚É‚ˇ‚ę‚΂¨‚‹B
‚ą‚ę‚Ĺ—Ç‚˘H
693 :
2012/07/22(“ú) 09:36:17.43
>QMAX=9007199254740991
ƒƒƒ^www
‰´‚Ě‚ŕŠm‚Š‚Éwhile(C[p+=1]=C[n+=1]);‚Ě•”•Ş‚Ĺ•ŰŽ‚ľ‚Ä‚é‚Ě‚ˇ‚ׂďÁ”ď•Ş‚ž‚Żă‚ɈړŽ‚ł‚š‚Ä‚é‚Ě‚Ş–ł‘Ę‚Č‚Ě‚Ĺ
‚ť‚Ěƒ‹[ƒv‚Ş–ł‚˘•Ş‚ÍŠm‚Š‚É‘‚˘‚Í‚¸B

‚ ‚ƁA’p‚¸‚Š‚ľ‚Č‚Ş‚çq‚Ë‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‰´>>688‚ĚŽŔ‘•‚ŏăŒŔ’´‚Ś‚˝‚çƒoƒO‚é‚đkwsk
‚Č‚ń‚ŠŒŠ—Ž‚Ć‚ľ‚Ä‚˝‚Ě‚ŠĄX‚Č‚Ş‚çS”z‚É‚Č‚Á‚Ä‚Ť‚˝B
Ěě‚Á‚˝‚â‚‚Ȃń‚ŁAŒ‹\‚Č•p“xŽg‚Á‚Ä‚Ť‚˝‚Ě‚ž‚ލĄ‚Ü‚ĹƒoƒO‚É‹C‚Ă‚Š‚Č‚Š‚Á‚˝

‚ľ‚Š‚ľƒf[ƒ^‚đƒƒ‚ƒŠă‚É“WŠJ‚ˇ‚é‚Š‚ç‚Ç‚¤‚ľ‚Ä‚ŕăŒŔ‚ޏo‚Ä‚­‚é‚ȁc
awk‚Ĺ10GB‚Ž‚炢‚Ěˆľ‚¤Žž‚Ígetline‚Ĺ‚Č‚ń‚Ć‚Š‚Č‚é‚Ż‚ǁA‚â‚Í‚čƒƒ‚ƒŠƒ}ƒbƒv‚âƒ|ƒCƒ“ƒ^‚ŞŽg‚Ś‚˝‚ç•Ö—˜‚ž‚ć‚Č‚Ÿ
ƒpƒbƒ`ě‚Á‚˝‚çŽů—v‚ ‚é‚Š‚ȁH
694 :
2012/07/22(“ú) 11:41:46.83
>>693
691A‚ż‚ĺ‚Á‚Ć’ůłB–ł‘Ę‚ÉƒLƒ…[Žg‚¤•ŞAŒłƒXƒNƒŠƒvƒg‚Š‚ç—ň‰ť‚ľ‚Ä‚˝B
> @@@p+=RSTART-1;
>-@@@enQ(substr(A[i],p,RLENGTH));
>+@@@if(hitTop+1<i){
>+@@@@A[++hitTop]=substr(A[i],p,RLENGTH)
>+@@@}else{
>+@@@@enQ(substr(A[i],p,RLENGTH));
>+@@@}
> @@@p+=RLENGTH;
‚ ‚ƁA—Ç‚­l‚Ś‚˝‚ço—͐ć‚đ•Ę‚É‚ˇ‚é‚Č‚çA‚ť‚ŕ‚ť‚ŕƒLƒ…[•s—vB

ƒoƒO‚Á‚Ä‚Ě‚Í687‚Ő”’lăŒŔ‰]X‚Ə‘‚˘‚˝‚Ć‚¨‚čA
hC[0]+=1h‚Şawk‚̐Ž”‚̐¸“xŒëˇ‚Č‚ľ‰‰ŽZ‰Â”\ăŒŔ‚đl—ś‚ľ‚Ä‚˘‚Č‚˘‚ž‚ŻB
‚Ç‚Ěawk‚ŕ‘˝•Ş‚ť‚¤‚ž‚ĆŽv‚¤‚Ż‚ǁAŽčŒł‚̊‹Ť‰ş‚Ĺ‚ĚŽŔsŒ‹‰ĘŤ
C:\>gawk --version
GNU Awk 3.1.7(windows special Nov 24 2009)
C:\>gawk "BEGIN{print 9007199254740990+1}" nul
9007199254740991
C:\>gawk "BEGIN{print 9007199254740991+1}" nul
9007199254740992
C:\>gawk "BEGIN{print 9007199254740992+1}" nul
9007199254740992

ŽŔŰ‚́ihdd‚⃁ƒ‚ƒŠ‚ސć‚ÉŽ€‚ʂ̂Łj
ˆęs‚Ĺ‚ą‚ę‚ž‚Żł‹K•\Œť‚Şhit‚ˇ‚鎖‚ÍŽ–ŽŔă–ł‚˘‚ľA
‰ź‚É”­ś‚ľ‚Ä‚ŕŒŸőŒ‹‰Ę‚ޒׂę‚é‚ž‚Ż‚ŁA‹C•t‚Š‚Č‚˘”¤B
695 :
2012/07/22(“ú) 13:39:49.16
>9007199254740992
—˜_ăA8192ƒyƒ^ƒoƒCƒg‚Ě“Ż‚śƒf[ƒ^[aaa...]‚Ĺregexp="."‚Ć‚ˇ‚ę‚΁A”­ś‚ˇ‚é‚ȁc
IEEE 754‚Ě52bit§ŒŔ‚ž‚Š‚çA‚ą‚ęˆČă‚Ě‚Ĺ‚Š‚˘”Žšˆľ‚¤‚Č‚çbig numbert‘Ήž‚Ěƒ‰ƒCƒuƒ‰ƒŠ‚Š,
"bc -q" |& ‚Ĺ“Ž‚Š‚ˇ‚ŠAxgawkAdnawk‚ ‚˝‚čŽg‚¤‚ׂŤ‚ž‚Č‚Ÿ

Ě’N‚Š‚Şbignum‚ĚawkƒXƒNƒŠƒvƒg‘‚˘‚Ä•ú—Ź‚ľ‚Ä‚˘‚˝Šo‚Ś‚Ş‚ ‚é‚Ě‚ž‚ށA
ƒOƒOƒb‚Ä‚ŕŒŠ‚‚Š‚ç‚ńBŽčŒł‚É‚ ‚é‚Ě‚Íƒrƒbƒg‰‰ŽZ‚Ě‚â‚‚ž‚Ż‚ž‚í
‚˘‚‚Š‚ť‚ę‚ž‚Ż‚Ěƒf[ƒ^‚đƒƒ‚ƒŠă‚É•ŰŽ‚Ĺ‚Ť‚éƒ}ƒVƒ“‚đˆľ‚Á‚Ä‚Ý‚˝‚˘‚ŕ‚Ě‚žc
696 :
2012/08/03(‹ŕ) 02:35:23.75
awk‚Á‚Äabs‚Ć‚Šacos‚Č‚Ç‚ĚŠî–{“I‚ČŽZpŠÖ”‚Ş—pˆÓ‚ł‚ę‚Ä‚Č‚˘‚ń‚Ĺ‚ˇ‚Ë
ĄŒă‚ŕŽŔ‘•‚ł‚ę‚é‚ą‚Ć‚Í‚Č‚˘‚ń‚Ĺ‚ľ‚傤‚ŠH

ƒpƒCƒv‚ĹƒTƒNƒb‚Ƃ‚Ȃ˘‚Ĺƒƒ“ƒ‰ƒCƒ“‚ŏˆ—‚ˇ‚é‚Ě‚Éd•ó‚ľ‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށEEE
‘ă‚í‚č‚Ć‚Č‚é‚ƁA‰˝Žg‚¤‚Ě‚Ş‚ć‚ë‚ľ‚˘‚Ĺ‚ˇ‚ŠH
‚Ĺ‚Ť‚ę‚Îperl‚ÍŽg‚˘‚˝‚­‚Č‚˘‚Ĺ‚ˇi‚Ç‚¤‚ľ‚Ä‚ŕD‚Ť‚É‚Č‚ę‚Č‚˘
697 :
2012/08/03(‹ŕ) 06:48:38.25
abs‚ÍŽŠ•Ş‚ŏ‘‚Ż‚΂˘‚˘‚ľAacos(x)‚Íatan2(x, ă(1.0 - x*x))‚Ə‘‚Ż‚é‚Š‚çA
‚Ç‚ż‚ç‚ŕŠî–{“I‚Ĺ‚Í‚Č‚˘‚Ć”ť’f‚ľ‚Ä‘g‚ݍž‚Ý‚ś‚á‚Č‚˘‚ń‚ž‚ĆŽv‚¤‚Ż‚ǁB

Python‚ŠRuby‚Ĺ‚˘‚˘‚ń‚ś‚á‚Č‚˘H@ƒƒ“ƒ‰ƒCƒi[Œü‚Ť‚Ĺ‚Í‚Č‚˘‚Ż‚ǁB
698 :
2012/08/03(‹ŕ) 07:37:24.41
>>696
ƒ‰ƒCƒuƒ‰ƒŠ(?)‚đE‚Á‚Ä—ˆ‚Ä‚Í?
699 :
2012/08/03(‹ŕ) 11:48:03.19
>>696
•K—v‚Ȋ֐”’l‚đŒvŽZ‚ˇ‚é‚ž‚Ż‚ĚƒvƒƒOƒ‰ƒ€‚đC‚ōě‚Á‚Ä‚¨‚˘‚˝‚ç?
700 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2012/08/03(‹ŕ) 20:21:59.43
Ě‚ť‚ę‚ĹƒxƒNƒgƒ‹‰‰ŽZ‚ľ‚Ä—V‚ń‚ž‚Č
701 :
2012/08/04(“y) 09:23:47.83
Ruby‚Í‚ť‚ą‚ť‚ąƒƒ“ƒ‰ƒCƒi[‚ŕ‘‚Ż‚銴‚ś‚Ş‚ˇ‚éAawk‚âPerl‚Ů‚Ç‚ś‚á‚Č‚˘‚Ż‚Ç‚Ë
Python‚Í—ŹÎ‚ɃR[ƒh‹N‚ą‚ł‚Č‚˘‚Ɛh‚˘‚ą‚Ć‚Ş‘˝‚˘‚Ş
702 :
2012/08/04(“y) 10:27:49.07
awk‚Ĺmatlab‚Ý‚˝‚˘‚ČƒxƒNƒgƒ‹‰‰ŽZ‚Ĺ‚Ť‚é‚悤‚É‚ľ‚Ä‚Ů‚ľ‚˘
703 :
2012/08/04(“y) 16:48:36.10
awk‚ĹƒNƒ‰ƒX‚đŽg‚Ś‚é‚悤‚É‚ľ‚Ä‚Ů‚ľ‚˘
704 :
2012/08/04(“y) 17:06:19.06
awk‚Ĺ‘S‚Ä‚Ě–‚–@­—‚đ‹~‚Á‚Ä‚Ů‚ľ‚˘
705 :
2012/08/04(“y) 17:08:30.07
awk‚ł‚ń‚Í–‚—
706 :
2012/08/05(“ú) 07:21:28.03
Awk++
http://awk.info/?doc/dsl/awkplusplus.html
OO in AWK++
The awk++ language provides object oriented programming for AWK that includes:
classes
class properties (persistent object variables)
methods
inheritance, including multiple inheritance

http://lawker.googlecode.com/svn/fridge/lib/bash/awk++/version21/awkpp21.zip
707 :
2012/08/05(“ú) 09:56:26.63
ƒfƒoƒbƒO‘ĺ•Ď‰ß‚Ź‚ÄŽ€‚Ę‚é
$ cat witch.awkpp
class Witch {
var spell
method new() { spell = "mahalic mahalita" }
method perform() { print spell }
}
class Samantha : Witch {
method perform() { print "twitch" }
}
BEGIN {
# wife = Witch.new() ƒGƒ‰[—vˆös
wife = Samantha.new()
wife.perform()
}
$ gawk -f awkpp -r witch.awkpp
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ syntax error
gawk: -:10: () ƒGƒ‰[—vˆös
gawk: -:10: ^ •\Œť‚Ě char '?' ‚Í•sł‚Ĺ‚ˇB
708 :
2012/08/22(…) 00:09:49.86
size: 656 byte, supports -o -v option. Array A and B can be the same (NEW)
function xagrep( o, re, A, B, this, a, i,k ){
k=0;B[0]=A[0];if(o~"-v"){for(i=1;i<=A[0];i++){if(!match(A[i],re)) B[k+=1]=A[i];}B[0]=k;return k};
if(o~"-o"){B[B[0]+1]=0;for(i=1;i<=A[0];i++){a=A[i];if(i==k){i=i-B[B[0]+1]+1;B[B[0]+1]=k;k=B[0]+2;
while(i<=B[B[0]+1]){B[i++]=B[k];delete B[k++];}i=B[B[0]+1];k=i;B[B[0]+1]=0;}while(match(a,re)){
if(i>k){B[k+=1]=substr(a,RSTART,RLENGTH);}else{B[B[0]+1+(B[B[0]+1]+=1)]=substr(a,RSTART,RLENGTH);
k++}a=substr(a,RSTART+RLENGTH)}}if(i<k){i=k-i;k=B[0]+1;B[0]=i+B[B[0]+1];while(i<B[0])B[i+=1]=B[k+=1];
while(i<k)delete B[i+=1];}return B[0]}for(i=1;i<=A[0];i++){if(match(A[i],re))B[k+=1]=A[i];}B[0]=k;return k;
}
‚ą‚ęˆČăí‚ę‚é‚Ć‚ą‚ë–ł‚˘‚Š‚ȁH@
‚‘Ź‰ť{ƒTƒCƒY—Dć‚ŁA•Ď”‚Í‚Ĺ‚Ť‚é‚ž‚ŻŽg‚¤”‚đ­‚Č‚­‚Ć‚ĚđŒ‚Ĺ
709 :
2012/08/22(…) 09:51:11.01
>>708
‚ť‚Ě3‚Â‚ĚđŒ‚Ě—Dć“x‚Ş‚í‚Š‚ç‚ń‚ȁB

Œ‹\“Ż‚ś•”•ŞŽŽ‚Ş‚ ‚é‚̂ŕϐ”‚É“ü‚ę‚˝•ű‚Ş•Ď”‚Í‘‚Ś‚é‚Ż‚Ç’Z‚­‚Č‚é‚ľ
ę‡‚É‚ć‚Á‚Ä‚Í‘Ź“x‚ŕ‘Ź‚˘‚Ć‚Š‚ ‚č‚ť‚¤‚ž‚Ż‚Ç‚Ç‚¤‚Č‚ń?

—á‚Ś‚ÎB[0]‚Í“Á•Ę‚Č—p“r‚Á‚Ű‚˘‚Ż‚Çx‚Ć‚Š1•śŽš•Ď”‚É‚ľ‚Äreturn‚Ě’ź‘O‚É
‘‚Ť–ß‚ľ‚˝•ű‚Ş•śŽš”‚͉҂°‚éB

‚ ‚Ć×‚Š‚˘‚Şhoge+=1‚ć‚č++hoge‚Ě•ű‚Ş1•śŽš’Z‚˘‚Ć‚ŠA‚˘‚ç‚Č‚˘u;v‚Ş
Žc‚Á‚Ä‚é‚Ć‚Š‹l‚ß‚ŞŠĂ‚˘‚Ć‚ą‚ë‚Ş‚Ü‚ž‚ ‚é‚ˁB
710 :
2012/09/30(“ú) 22:45:00.64
ˆČ‰ş‚̂悤‚Čƒf[ƒ^‚̏ˆ—‚ɂ‚˘‚ÄŽż–₢‚˘‚Ĺ‚ľ‚傤‚ŠB
$1‚ÉŒo‰ßŽžŠÔiŽžjA$2‚Ɂu‘Ź“xv‚Ş‚ ‚ę‚Î$3‚̐”’l‚Í‘Ź“x‚đA$2$3‚É
uup avudown av‚Č‚Ç‚Ć‚ ‚ę‚΂ť‚ĚŽž‚Ĺ‚Ěs“Ž‚đŽŚ‚ľ‚Ü‚ˇB

‚ą‚Ěƒf[ƒ^‚Š‚çupAdown‚̏ꏩ‚đ‹‚ß‚˝‚˘‚ĆŽv‚˘‚Ü‚ˇB
‚‚܂čA‰ş‚Ě—á‚ĹˆÚ“ŽŠJŽn‚Š‚ç‚Ě‹——Ł3‚Ĺup aA‹——Ł3.5‚Ĺup bA‚Ć‚˘‚¤‹ď‡‚Ĺ‚ˇB
Œo‰ßŽžŠÔ‚Ć‘Ź“x‚Š‚çęŠ‚đŒvŽZ‚ˇ‚é‚ž‚Ż‚Ĺ‚ˇ‚ށB‘Ź“x‚đ•ĎX‚ˇ‚éƒ^ƒCƒ~ƒ“ƒOE
‰ń”‚Í•s’čA‘Ź“xƒf[ƒ^‚ƍs“Žƒf[ƒ^‚Í‚Ć‚ŕ‚ÉŒo‰ßŽžŠÔ‡‚É‹L˜^‚ł‚ę‚Ä‚˘‚Ü‚ˇB
‘Ź“x•ĎX‚đ‚Ç‚¤ˆľ‚Ś‚΂˘‚˘‚Ě‚ŠA‚ż‚ĺ‚Á‚Ć“Ş‚Ş‰ń‚č‚Ü‚š‚ńB

---Œłƒf[ƒ^—á---
0 ‘Ź“x 10
50 ‘Ź“x 20
200 ‘Ź“x 25
30 up a
35 up b
40 down a
40 down b
50 up a
70 down a
200 up c
250 down c

---ˆ—Œă---
3 up a
3.5 up b
4 down a
4 down b
5 up a
6 down a
12.5 up c
14.5 down c
711 :
2012/10/01(ŒŽ) 11:28:30.42
‹^–â‚đ’ńŽŚB
$1‚ޏí‚ÉŽž‚Ĺ$2‚Ş‘Ź“x‚Ě‚Ć‚Ť‚Ě$3‚Ş‘Ź“x‚Č‚çA
30 up a‚Ě‚Ć‚Ť‚É30 * 10‚Ĺ300 up a‚É‚Č‚é‚ń‚ś‚á‚Č‚˘‚ž‚낤‚ŠB
“Ż‚ś‚悤‚ɁA70 down a‚Ě‚Ć‚Ť‚É50 * 10 + (70 - 50) * 20‚Ĺ900 down a‚É‚Č‚é‚ń‚ś‚á‚Č‚˘‚ž‚낤‚ŠB

$3‚Ş‘Ź“x(’PˆĘŽžŠÔ“–‚˝‚č‚ĚˆÚ“Ž—Ę)‚Ĺ‚Í‚Č‚­’PˆĘˆÚ“Ž—Ę“–‚˝‚č‚̏Š—vŽžŠÔ‚Č‚Ě‚Ĺ‚ ‚ę‚΁A
30 up a‚Ĺ30 / 10 = 3A70 down a‚Ĺ50 / 10 + (70 - 50) / 20 = 6‚É‚Č‚é‚ń‚ž‚Ż‚ǂˁB
712 :
2012/10/01(ŒŽ) 13:21:34.21
ŽŔ‘•‚ľ‚Ä‚Ý‚˝B‘Ź“x‚Ş“r’†‚ɏo‚Ä‚Ť‚Ä‚ŕ‚˘‚˘‚悤‚Épos‚đ–ˆ‰ńŒvŽZ‚ˇ‚é‚Š‚çŒř—ŚˆŤ‚˘‚Ż‚ǁB
--
BEGIN {
sCount = 0;
}
$2 == "speed" {
sTime[sCount] = $1;
sSpeed[sCount] = $3;
++sCount;
next;
}
{
pos = 0;
for (ic = 1; ic < sCount; ++ic) {
if (sTime[ic] > $1) break;
pos += (sTime[ic] - sTime[ic - 1]) / sSpeed[ic - 1];
}
pos += ($1 - sTime[ic - 1]) / sSpeed[ic - 1];
print pos, $2, $3;
}
713 :
2012/10/01(ŒŽ) 20:30:33.48
>>711
‚ˇ‚Ý‚Ü‚š‚ńA‘OŽŇ‚Ĺ‚ˇ‚ˁB‚Č‚ń‚ž‚낤A’p‚¸‚Š‚ľ‚˘B

>>712
‚Ȃ̂ŁAƒAƒNƒVƒ‡ƒ“•”‚Ě / ‚đ * ‚É•Ď‚Ś‚ę‚΂悳‚ť‚¤‚Ĺ‚ˇB

‚¨“ń•űA‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
714 :
2012/12/13(–Ř) 11:40:43.98
awk‚É‚Š‚í‚é“Ż“™‚Ě‚ŕ‚Ě‚ ‚č‚Ü‚ˇH
715 :
2012/12/13(–Ř) 13:08:08.26
python
716 :
2012/12/13(–Ř) 13:13:55.85
>>715
awk‚Ý‚˝‚˘‚ÉŽg‚˘ŸŽč‚˘‚˘‚Ě‚Š‚ȁH
717 :
2012/12/13(–Ř) 13:18:24.65
—Ç‚˘‚Ĺ‚ˇ‚ć
718 :
2012/12/13(–Ř) 13:24:31.23
>>717
‚ ‚č‚Ş‚Ć‚ˇB•×‹­‚ľ‚Ä‚Ý‚Ü‚ˇ
719 :
2012/12/13(–Ř) 14:45:25.45
‚Í‚˘
720 :
2013/02/06(…) 03:49:18.86
g”CˆÓ‚Ě‹L†h‚đŠÜ‚ń‚žƒVƒFƒ‹•Ď”‚đawk‚É“n‚ˇ‚ą‚Ƃ͉”\‚Ĺ‚ˇ‚ŠH‚˝‚Ć‚Ś‚Î

[user@localhost ~]$ var='hoge'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge
hoge

‚ą‚ą‚ŁAvar‚É$‚đŠÜ‚Ü‚š‚é‚Ć

[user@localhost ~]$ var='hoge$fuga'
[user@localhost ~]$ echo "hoge" | awk -v var="$var" '
$0 ~ var {print var}
END {print var}
'
hoge$fuga

‚Ć‚¤‚Ü‚­ƒ}ƒbƒ`‚ľ‚Ü‚š‚ń‚Ĺ‚ľ‚˝BvarŽŠ‘Ě‚Í“n‚ł‚ę‚Ä‚˘‚é‚Í‚¸‚Ĺ‚ˇ‚ށA‰˝‚ŞŒ´ˆö‚Ĺ‚ľ‚傤‚ŠH
721 :
2013/02/06(…) 11:23:41.42
>>720
‚˘‚ż‚Ź‚傤‚ß‚Ě‚Đ‚ž‚č‚Ş‚í‚Ě var ‚́A‚Ђ傤‚Š‚Ě‚ł‚˘‚É
‚š‚˘‚Ť‚Ђ傤‚°‚ń‚Ö‚Ě‚Š‚˝‚Ö‚ń‚Š‚ń‚Ş‚¨‚ą‚Č‚í‚ę‚éB

$0 ~ /hoge$fuga/ {print "hoge$fuga"}
END {print "hoge$fuga"}

‚ß‚˝‚ŕ‚ś‚Ć‚Č‚Á‚Ä‚ľ‚Ü‚¤‚ŕ‚̂́A‚ś‚ş‚ń‚ ‚邢‚Í‚ą[‚Ç‚Ě‚Č‚Š‚Ĺ
‚Ś‚ˇ‚Ż[‚Ő‚ˇ‚é‚Ђ‚悤‚Ş‚ ‚éB
722 :
2013/02/06(…) 11:29:22.31
~(ƒ`ƒ‹ƒ_)‚̉E•Ó‚͐ł‹K•\Œť‚Ć‚ľ‚ĉđŽß‚ł‚ę‚é‚Š‚çA"hoge" ~ /hoge$fuga/ ‚Ĺƒ}ƒbƒ`‚ˇ‚é‚í‚Ż‚Ş‚Č‚˘B
‹t‚É”J‚ëA"hoge$fuga" ~ /hoge/ ‚Č‚çƒ}ƒbƒ`‚ˇ‚éB
723 :
2013/02/06(…) 11:33:09.61
>>720
>721‚ŕ>722‚ŕ‚Ç‚ż‚ç‚ŕŒ´ˆöB‚â‚č‚˝‚˘‚ą‚Ć‚đ‚ć‚­Ž—‚ľ‚悤B
724 :
2013/02/06(…) 15:09:21.72
‚ˇ‚˘‚Ü‚š‚ńAecho "hoge"‚Ĺ‚Í‚Č‚­echo "$var"‚Ĺ‚ľ‚˝B
‚˝‚žAŒ‹‰Ę‚Í>>720‚Ć“Ż‚ś‚Ĺ‚ˇB

—v‚Í“ü—̓tƒ@ƒCƒ‹“ŕ‚́uƒƒ^•śŽšž‚Ý‚Ě”CˆÓ‚Ě•śŽš—ńv‚đA•Ę‚́uƒƒ^•śŽš‚Ɖüsž‚Ý‚Ě”CˆÓ‚Ě•śŽš—ńv‚Ĺ’uŠˇ‚ˇ‚éA
‚Ć‚˘‚¤‚Ě‚đƒƒ^•śŽš‚ĚƒGƒXƒP[ƒv“™‚Ě–Ę“|‚ȏˆ—‚đ‚š‚¸‚ɃTƒNƒb‚Ć‚â‚č‚˝‚˘‚Ě‚Ĺ‚ˇ‚ށA‚Ĺ‚Ť‚Ü‚ˇ‚ŠH
725 :
2013/02/07(–Ř) 05:01:43.19
ŃŘ

—\‚߁uƒƒ^•śŽš‚ĆŒž‚Á‚Ä‚ŕ $ ‚ľ‚Šo‚Ä‚ą‚Č‚˘v‚Ć‚Š”ť‚Á‚Ä‚é‚Č‚ç‘ĺ‚ľ‚˝‚ą‚Ć–ł‚˘‚Ż‚Ç
ˆę”ʉť‚ˇ‚ę‚΂ˇ‚é‚Ů‚Ç–Ę“|‚É‚Č‚é
726 :
2013/02/07(–Ř) 22:14:56.21
>>725
‚â‚Í‚č‚ť‚¤‚Ĺ‚ˇ‚ŠB
Ą‚Ü‚Ĺ‚ą‚¤‚˘‚Á‚˝ˆ—‚Ísed‚Ĺ‚ľ‚ą‚ľ‚ąƒGƒXƒP[ƒv‚ľ‚Ä‚â‚Á‚Ä‚˝‚ń‚Ĺ‚ˇ‚ށA‚˘‚˘‰ÁŒ¸–Ę“|‚É‚Č‚Á‚˝‚̂ŁA
‚˝‚Ć‚Ś‚Îfgrep‚Ý‚˝‚˘‚ɐł‹K•\Œť‚đƒIƒt‚É‚ľ‚ďˆ—‚ˇ‚é•ű–@‚Í‚Č‚˘‚Š‚Ć’T‚ľ‚Ä‚˘‚é‚ń‚Ĺ‚ˇ‚ށA
awk‚Ĺ‚Í–ł—‚Ĺ‚ˇ‚ŠEEEB
727 :
2013/02/08(‹ŕ) 11:20:14.98
>>726
’P‚Ɉę’v‚Ȃ琳‹K•\Œť‚Č‚ń‚ŠŽg‚킸‚É”äŠr‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
fgrep‚ĹŽ–‚Ş‘Ť‚č‚é‚Ě‚Č‚çawk‚Š‚çfgrep‚đ‹N“Ž‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
728 :
2013/02/08(‹ŕ) 19:27:47.04
>>726
fgrep‚Č‚ç index()ŠÖ”‚ś‚á‚Č‚˘‚Ě?
729 :
2013/02/09(“y) 15:32:27.55
>>727
„’P‚Ɉę’v‚Ȃ琳‹K•\Œť‚Č‚ń‚ŠŽg‚킸‚É”äŠr‚ˇ‚ę‚΂˘‚˘‚ś‚á‚ńB
ˆÓ–Ą‚Ş•Ş‚Š‚ç‚Č‚˘‚ń‚Ĺ‚ˇ‚ށAawkă‚Ě˜b‚Ĺ‚ˇ‚ć‚ˁH

>>728
index()‚Ěˆř”‚Í•śŽš—ń‚ž‚Š‚çA‚ą‚ę‚đ‚¤‚Ü‚­Žg‚Ś‚ΖړI‚̏ˆ—‚Ş‚Ĺ‚Ť‚éEEE‚Ě‚Š‚ȁH

‚Ĺ‚ŕ‚Č‚ń‚Šawk‚Ĺ‚˛‚ż‚傲‚ż‚ĺ‚â‚é‚ć‚čAƒƒ^•śŽš‚đƒGƒXƒP[ƒv‚ˇ‚é‘Oˆ—‚đ‚Š‚Ü‚ˇ‚Č‚č
‰˝‚Č‚č‚ľ‚˝‚Ů‚¤‚Ş‘f’ź‚Č‹C‚Ş‚ľ‚Ä‚Ť‚˝EEEB‚˝‚Ć‚Ś‚΂ą‚ń‚ČŠ´‚ś‚Ĺ

$ var='hoge$fuga'
$ var2=$( echo "$var" | sed 's/\$/\\\\$/g' )@ŠƒGƒXƒP[ƒvˆ—
$ echo "$var" | awk -v var="$var2" '
$0 ~ var {print var}
END {print var}
'
hoge\$fuga
hoge\$fuga
730 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2013/02/09(“y) 17:49:52.25
/bin/sh‚Ĺ‚˛‚ż‚傲‚ż‚ĺ‚â‚é‚Ě‚ŞD‚Ý‚Č‚çAawk‚ŕfgrep‚ŕŽg‚킸Acase•ś‚Ĺ‚â‚č‚Ⴂ‚˘‚ń‚ś‚á‚Č‚˘‚́B
731 :
2013/02/09(“y) 21:34:09.39
>>729
•śŽš—ń‚Ě”äŠr‚Í“™†‚Ĺ‚Ĺ‚Ť‚é‚Á‚Ä”FŽŻ‚Í‚Č‚˘‚Ě?
732 :
2013/02/10(“ú) 14:31:49.57
>729
‚˘‚âA‚ť‚Ě•ű–@‚Ĺ‚ŕŒ‹‹Ç ' ‚̓GƒXƒP[ƒv‚Ş•K—v‚Ĺ‚ľ‚ĺB
ƒ_ƒCƒŒƒNƒg‚ɃVƒFƒ‹•Ď”‚É“ü‚ę‚é•ű–@‚ŠA
ƒtƒ@ƒCƒ‹‚Č‚Ç‚É“f‚Ťo‚ľ‚Ä‚¨‚­•ű–@‚Ě•ű‚ވŔ’čB
‚Ü‚Ÿ‚ť‚ę‚Ĺ‚ŕ‰üs‚Ć‚Š§Œä•śŽš“ü‚ę‚ç‚ę‚é‚Ć‚ŕ‚É‚ĺ‚éę‡‚Ş‚ ‚é‚Ż‚ǂȁB
733 :
2013/02/11(ŒŽ) 20:15:01.17
‚ť‚ą‚Ü‚Ĺ‚ß‚ń‚Ç‚­‚ł‚­‚Č‚Á‚˝‚çperl‚Ć‚Šruby‚Ć‚ŠŽg‚Á‚˝•ű‚ŞŠy‚ž‚źw
734 :
2013/02/11(ŒŽ) 22:46:25.57
‰˝‚Ĺ gawk -f ‚Ć‚ŠŽg‚킸ƒƒ“ƒ‰ƒCƒi[‚ɍS‚é‚Ě‚Š‚Ë‚Ľ
735 :
2013/02/12(‰Î) 22:00:38.07
>>732
’†ŠŘƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚ÍîŽă‚ĚŽdŽ–iƒhƒ„Šç
>>734
ƒƒ“ƒ‰ƒCƒi[ƒfƒBƒX‚Á‚Ä‚ń‚́H
736 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2013/03/11(ŒŽ) 10:05:12.56
#
# text converter ( Mac to MS-DOS on Windos/MS-DOS machine)
# convert CR to CR+LF
#
BEGIN{ RS = "\r" }
{ print }
737 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2013/03/15(‹ŕ) 08:05:25.28
#
# Line(s”)‚𐔂Ś‚é
#

END { FNR }
738 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2013/03/20(…) 19:07:17.00
# text to html converter
# usage: awk -f txt2htm.awk infile1.txt > outfile2.html

BEGIN{
print("<html>"); print("<head>")
print("<titile> My favorite URLs </titile>")
print("</head>"); print("<h1> </h1>"); print("<body>");
}

/^[:space:]*http/ { print "<A HREF=\""$1"\">"$1"</A><BR>"}

END{
print("</body>")
print("</html>")
}
739 :
UNIX(LF) to DOS(CR+LF) conversion
2013/03/21(–Ř) 21:15:00.86
awk 1 infile1 > outfile2.txt
740 :
2013/03/21(–Ř) 22:10:08.07
# awk -f add.awk
BEGIN {
  s1 = "323524855"
  s2 = "4972560"

  reverse(a2, s2)
  size = reverse(a1, s1) # s1 > s2
  carry = 0

  for(k = 1; k <= size; k++) { # s1 > s2
    d = a1[k] + a2[k] + carry
    if(d >= 10) {
      e[k] = d - 10
      carry = 1
    } else {
      e[k] = d
      carry = 0
    }
  }

  if(carry == 1) {
    e[k] = 1
    size = k
  }

  g = produce_string(e, size)
  printf("%s + %s = %s\n", s1, s2, g)
  printf("%f\n", s1 + s2)
  exit
}
741 :
2013/03/21(–Ř) 22:11:11.39
# >>740‚̂‚ÂŤ
function reverse(a, s, k, i) {
  k = 1;
  size = length(s)
  for(i = size; i >= 1; i--) {
    a[k++] = substr(s, i, 1)
  }

  return size
}
function produce_string(a, size, i) {
  g = ""
  for(i = size; i >= 1; i--) {
    g = g a[i]
  }

  return g
}
742 :
2013/03/21(–Ř) 22:12:57.08
function produce_string(a, size, g, i) {
743 :
grep‚đawk‚Ĺ
2013/03/22(‹ŕ) 13:32:02.74
# usage: awk -f grep.awk char1 file1 file2

BEGIN{
pattern = ARGV[1]
ARGV[1] = ""
}
$0 ~ pattern {print($0" File name=" FILENAME)}
744 :
2013/11/30(“y) 12:16:25.95
$ echo 10 20 30 | awk '{for(i=0;i<4;)print _$++i}'
10
20
30

_$++i‚Ĺ‚ŕ$++i‚Ĺ‚ŕ‚Ç‚ż‚ç‚Ĺ‚ŕ‚˘‚Ż‚é‚Ě‚Ĺ‚ˇ‚ށAƒAƒ“ƒ_[ƒXƒRƒA‚Ş•t‚˘‚ĉ˝ŒĚ‘ĺä•v‚Č‚Ě‚Ĺ‚ľ‚傤‚ŠH
745 :
2013/11/30(“y) 16:04:55.55
‚ˇ‚˘‚Ü‚š‚ńA‚í‚Š‚č‚Ü‚ľ‚˝
‹ó‚̕ϐ”_‚Ć$++i‚ĚŒ‹‰Ę‚Şˆę‚É‚Č‚Á‚Ä‚˝‚ž‚Ż‚Č‚ń‚Ĺ‚ˇ‚Ë
746 :
2013/11/30(“y) 20:37:58.81
’P‚ÉŽŽ‚đ•Ŕ‚ׂé‚Ć•śŽš—ń˜AŒ‹‚É‚Č‚éA‚Ě㩂Š
747 :
2014/04/02(…) 00:10:13.15 ID:T3/5Epfc
•ŰŽç

‚Ä‚Š”ź”N‹ß‚­‘‚Ťž‚Ý‚Ş–ł‚Š‚Á‚˝‚Š
748 :
2014/04/14(ŒŽ) 22:41:42.89 ID:5r697USd
4.1.1‚Á‚Ä‚ŕ‚¤ƒŠƒŠ[ƒX‚ł‚ę‚˝‚́H
749 :
2014/04/19(“y) 13:45:38.45 ID:Db2IzPol
‚Ć‚ ‚égawkƒXƒNƒŠƒvƒg‚̐擪‚Ĺ
{last_hoge=hoge; hoge=$ 3}
‚Á‚Ä‚â‚Á‚Ä‚é‚ń‚ž‚Ż‚ǁA
hoge=$ 3‚Íhoge=$3‚ĚŠÔˆá‚˘? ‚ť‚ę‚Ć‚ŕ‚ą‚¤‚˘‚¤‹L–@‚Ş‚ ‚é?
750 :
2014/04/19(“y) 14:56:08.53 ID:A73fEYrr
>>749
$ ‚͉‰ŽZŽq‚ž‚Š‚çAa=b+1‚đa = b + 1‚Ə‘‚­‚悤‚Č‚ŕ‚Ě‚Š‚ȁB
751 :
2014/04/19(“y) 21:10:32.64 ID:Db2IzPol
‚Ś‚Ś[ ‰‰ŽZŽq‚ž‚Á‚˝‚Ě‚Š‚ BŐŒ‚‚ĚŽ–ŽŔ
752 :
2014/04/20(“ú) 12:36:45.70 ID:SQaIR8ej
‰‰ŽZŽq‚ž‚Š‚çA•Ď”‚Ĺ‚ŕ‚˘‚˘‚ćB
753 :
2014/04/20(“ú) 14:34:12.09 ID:YSeiuWKu
ŽŽ‚ޏ‘‚Ż‚é‚ˁB
$ ‚͈ę”Ô—Dć‡ˆĘ‚ލ‚‚˘‚Š‚çA‚Š‚Á‚ą‚ĹŠ‡‚ç‚ɂႢ‚Š‚ń‚ށB
754 :
2014/04/20(“ú) 15:12:13.25 ID:k3tDznaJ
Ą‚Í‚ś‚ß‚Ä’m‚Á‚˝Bhaskell‚Ě$‚͉‰ŽZŽq‚ž‚Á‚Ä’m‚Á‚Ä‚˝‚Ż‚ǁAawk‚Ĺ‚ŕ‰‰ŽZŽq‚ž‚Á‚˝‚ń‚ž‚ˁB
755 :
2014/10/14(‰Î) 13:37:28.35 ID:cBz5RbAX
‚ť‚ľ‚Ä”ź”N‹ß‚­‘‚Ťž‚Ý‚Ş–ł‚Š‚Á‚˝
756 :
2014/10/15(…) 03:28:03.90 ID:SS4U/DMU
‚˘‚âawkƒXƒŒ‚Č‚ń‚Ä•’i‚Í‚ť‚ń‚Č‚É˜b‘č‚Č‚˘‚ž‚ë
757 :
2014/10/21(‰Î) 15:46:10.36 ID:TQsAGJgk
Žż–â‚ł‚š‚Ä‚­‚ž‚ł‚˘

ĄƒfƒBƒŒƒNƒgƒŠ“ŕ‚Ěƒtƒ@ƒCƒ‹‚Ě–źĚ‚ĆƒTƒCƒY‚ĚƒŠƒXƒg‚đě‚č‚˝‚˘‚ĆŽv‚Á‚Ä‚˘‚Ü‚ˇ
ƒRƒ}ƒ“ƒh‚Ć‚ľ‚Ä‚Íls -l‚đŽŔs‚ľ‚Ä‚˘‚Ü‚ˇ‚Ş‚ą‚ę‚đ‚ł‚ç‚Éawk‚ɃpƒCƒv‚ľ‚Ä‚˘‚Ü‚ˇ
‚˝‚ž‚ľƒtƒ@ƒCƒ‹–ź‚ɃXƒy[ƒX‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚é‚˝‚ßˆČ‰ş‚̂悤‚Č‹ę“÷‚̍ô‚đ‚Ć‚Á‚Ä‚¨‚č‚Ü‚ˇ‚Ş

ls -l | awk '{print $5 "\t" $9$10$11$12$13$14$15$16$17$18$19}'

10ŒÂˆČă‚Ĺ‹ćŘ‚ç‚ę‚Ä‚é‰Â”\Ť‚ŕ‚ ‚é‚˝‚ߍޖ{“I‚ȑΉž‚đ‚ľ‚˝‚˘‚ƍl‚Ś‚Ä‚˘‚Ü‚ˇ‚Ş
‚悢ˆÄ‚Í‚ ‚č‚Ü‚ˇ‚Ĺ‚ľ‚傤‚Š
758 :
2014/10/21(‰Î) 17:25:55.68 ID:EsuQiv22
# ƒtƒ@ƒCƒ‹–ź‚Ɂu"v‚ŞŠÜ‚Ü‚ę‚Ä‚˘‚˝‚ç’m‚ç‚ˁB
ls -Ql |awk '{split($0, foo, "\x22"); print $5 "\t" foo[2]}'
759 :
2014/10/21(‰Î) 23:41:50.65 ID:stXOK2Vv
QƒIƒvƒVƒ‡ƒ“‚͕׋­‚É‚Č‚Á‚˝
ls -l|awk '{s=$5;for(i=1;i<9;i++)$i="";print s"\t"$0}'
760 :
2014/12/13(“y) 17:07:55.12 ID:8LbgKkKk
034@@‚́@h@i”źŠpj
035@@‚́@”@i”źŠpj@@@@@@@‚Ĺ‚¨‚‹‚Ĺ‚ˇ‚ŠH
761 :
2014/12/13(“y) 18:17:16.35 ID:FQOeA8KF
>>760
‚˘‚˘‚Śˆá‚˘‚Ü‚ˇB
762 :
2014/12/14(“ú) 00:00:31.34 ID:7YfznIJB
‚Ç‚ż‚ç‚ŕ”ń‰Â“Ç•śŽš‚Ĺ‚ˇ‚ˁB‚ť‚ľ‚Ä‚ť‚¤‚Č‚é‚ĆƒXƒŒˆá‚˘B
awk‚Ć—‚Ţ‚Ě‚Č‚ç‹ď‘Ě“I‚É‚Ç‚¤‚źB
763 :
2015/02/03(‰Î) 10:36:52.13 ID:Dvc0nyMp
Terastation‚Ěƒtƒ@ƒCƒ‹Eƒzƒ‹ƒ_–ź‚ÉŽg‚¤‚Ćƒtƒ@ƒCƒ‹ƒŒƒvƒŠƒP[ƒVƒ‡ƒ“‚ĹƒGƒ‰[‚Ş‹N‚ą‚é•śŽš‚Ş‚ ‚Á‚āA‚ť‚ę‚đ•ĎŠˇ‚ˇ‚éƒoƒbƒ`‚𐜐Ź‚ˇ‚鎞‚É‚ą‚Ěƒ}ƒCƒi[ŒžŒę‚Ş‘ĺŠˆ–ô‚ľ‚˝B
–ń80–œŒ‚Ěƒtƒ@ƒCƒ‹ƒzƒ‹ƒ_–ź‚Š‚ç’Šo‚ˇ‚é‚Ě‚É10•Ş’ö“x‚ž‚Á‚˝B
764 :
2015/05/26(‰Î) 00:18:03.33 ID:Y5HiR/XE
Gawk4.1.2‚ޏo‚˝‚Č‚ A‚ĆŽv‚Á‚Ä‚˝‚炡‚Ž4.1.3‚ޏo‚˝B
‘fl‚É‚Íˆá‚˘‚Ş‚ ‚Ü‚č•Ş‚Š‚ç‚ń‚Ě‚ž‚ށB
765 :
2015/05/31(“ú) 09:20:55.82 ID:PB6Yeih1
http://www.amazon.co.jp/AWKŽŔ‘H“ü–ĺ-Software-Design-plus-’†“‡/dp/477417369X

V‚ľ‚˘–{Ao‚˝‚ń‚ž‚Č
”p‚ę‚Č‚˘‚Ě‚ŞŚ‚˘
766 :
2015/06/03(…) 20:45:34.22 ID:vBAc8MUN
>>765
”ƒ‚Á‚Ä‚Ť‚˝B‚Ü‚žĹ‰‚Ě•ű‚ĆĹŒă‚Ě•ű‚đ’­‚ß‚˝‚ž‚Ż‚ž‚Ż‚ǁB

ƒy[ƒWiviu‚Í‚ś‚߂Ɂvj‚Ĺawk‚Ě•\‹L‚ɂ‚˘‚āu–{‘“ŕ‚ł́A‚˘‚¸‚ę‚Ě
ę‡‚ŕ‚ˇ‚ׂśŽš‚Ěawk‚Ć‚˘‚¤•\Œť‚É“ˆę‚ľ‚Ä‚¨‚č‚Ü‚ˇv‚Ć
‚ ‚é‚̂ɁA‘–ź‚ŞAWKB

ŠŞ––‚ĚƒŠƒtƒ@ƒŒƒ“ƒX‚Ĺ‹C‚É‚Č‚Á‚˝‚Ć‚ą‚ëB
‰‰ŽZŽq‚Ě—Dć‡ˆĘ‚ɐG‚ę‚Ä‚˘‚Č‚˘AƒtƒB[ƒ‹ƒh‰‰ŽZŽq‚Ş
u“Á•Ę‚ČˆÓ–Ą‚đŽ‚Â‚Č•Ď”v‚Ě’†‚É“ü‚ę‚ç‚ę‚Ä‚˘‚éB

ŽQl‘‚â•śŒŁ‚Ş‚Č‚˘‚Ż‚ǁAĄŽž‚́uƒlƒbƒg‚ĹƒOƒO‚ęv‚Š‚ȁB
767 :
2015/07/06(ŒŽ) 22:02:56.12 ID:Wnwr3Nh9
Mono: Playback -9707 [5%] [-97.07dB] [on]
ă‚̍s‚Š‚çƒp[ƒZƒ“ƒg‚đœ‚˘‚˝”Žšiă‚Ě—á‚ž‚Ć5j‚đŽć“ž‚ľ‚˝‚˘‚Ě‚Ĺ‚ˇ‚Ş‚Ç‚Ě‚ć‚¤‚É‚ľ‚˝‚ç‚悢‚Ĺ‚ľ‚傤‚ŠH
ƒp[ƒZƒ“ƒg‚Ě’l‚Í0‚Š‚ç100‚̐Ž”‚ž‚ĆŽv‚˘‚Ü‚ˇ
768 :
2015/07/07(‰Î) 15:47:02.78 ID:NFKuqu84
# $0 ‚É“ü‚Á‚Ä‚˘‚é‚Ć‚ľ‚Ä
sub(/%.*/, "");
sub(/.*[^0-9]/, "");
769 :
2015/07/08(…) 11:55:27.32 ID:rptAPQZX
awk -F"[%[]" '{print $2}'
‚Ĺ‚Í‚Ü‚¸‚˘?
770 :
2015/07/08(…) 18:52:19.39 ID:GgkVcZ7j
>>768,769
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ľ‚˝
‚Ç‚ż‚ç‚Ĺ‚ŕŠó–]‚ĚŒ‹‰Ę‚đ‹‚ß‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚ľ‚˝
771 :
2015/07/10(‹ŕ) 10:45:11.15 ID:VcZTZ3UB
ƒeƒ“ƒvƒŒ‚Ĺ‚ ‚锤‚Ě1‚Ş“Ç‚ß‚Č‚˘‚ń‚ž‚ށA‚ą‚ĚƒXƒŒ“I‚É‚ÍPOSIX‚ŏ‘‚­‚Ě‚Ş
ł“H•’i‚ÍGawk‚ľ‚ŠŽg‚í‚Č‚˘‚Ě‚Ĺˆę‰žŠm”FB
772 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2015/10/10(“y) 22:36:33.12 ID:1AEUTcmG
awk ‚Ě a ‚́Aaho ‚Ě a

‚˝‚ž‚ľAƒGƒCƒz‚Ć“Ç‚Ţ‚ç‚ľ‚˘
‚Ö‚Ľ[[[[[
773 :
2016/02/12(‹ŕ) 17:12:05.45 ID:VH2jVHwT
awkŽg‚Á‚Ä‚éƒVƒFƒ‹ƒXƒNƒŠƒvƒgŒŠ‚é‚Ć“Ś‚°‚Ä‚é‚Č‚ ‚ĆŽv‚¤
774 :
2016/02/18(–Ř) 00:13:16.92 ID:E3KgV2Kz
•’Ę‚Í x[3]=5 ‚Ə‘‚­‚ށA=‚Č‚ľ‚Ě
x[3]
‚ž‚Ż‚Ĺ‚ŕƒGƒ‰[‚ƂȂ炸Ax ‚đ”z—ń‚Ć‚ľ‚ÄŠm•Ű‚ľAlength(x)=1 ‚É‚Č‚é‚Ě‚đ”­ŒŠ
‚Ü‚ A‚ ‚Ü‚č•K—v‚Č‚˘‚Ż‚Ç
775 :
2016/02/18(–Ř) 23:58:18.64 ID:kHIvdCfG
‚Ü‚ Agawk‚Ěƒ}ƒjƒ…ƒAƒ‹‚Ĺ‚ŕ‘ă“ü‚Ě‘O‚ÉŽQĆ‚ޏo‚Ä‚­‚é‚ľ
776 :
2016/02/20(“y) 00:57:58.12 ID:OTE8dQpJ
‚ť‚¤‚Ĺ‚ľ‚˝‚ŠAV”­ŒŠ‚Ĺ‚Č‚Š‚Á‚˝
777 :
2016/02/20(“y) 15:01:09.40 ID:91Q+YYwH
‘ă“ü‘O‚É‚¤‚Á‚Š‚čŽQĆ‚ľ‚Ä‚ľ‚Ü‚¤‚Ě‚Í‹H‚É—Ç‚­‚ ‚éB
778 :
2016/02/28(“ú) 01:02:06.47 ID:Atbyv4Wk
IGNORECASE=1
‚đBEGIN ‚Ě‘O‚É’u‚˘‚Ä‚ŕƒGƒ‰[‚ɂȂ炸A•s‰Â‰đ“Žě
ƒZƒLƒ…ƒŠƒeƒB“I‚É‚â‚΂­‚Č‚˘‚Ě
779 :
2016/02/28(“ú) 02:01:41.85 ID:2mMmSiU+
>>778
BEGIN ƒZƒNƒVƒ‡ƒ“‚đć“ނɏ‘‚Ż‚Ƃ͉˝ˆ‚É‚ŕ‘‚˘‚Ä‚Č‚˘B

BEGIN ‚đĹŒă‚ɏ‘‚˘‚Ä‚ŕ END ‚đĹ‰‚ɏ‘‚˘‚Ä‚ŕ–â‘č‚Í–ł‚˘B
‰˝ˆ‚ɏ‘‚˘‚Ä‚ŕAŽŔŰ‚ɂ͐擪s“ǂݍž‚Ý‘OAŠes“ǂݍž‚ÝŽžAĹIs“ǂݍž‚ÝŒă‚É‚ť‚ę‚ź‚ę
ƒpƒ^[ƒ“ƒ}ƒbƒ`‚ލs‚í‚ę‚Ä‚˘‚éB
‚˝‚žƒ}ƒbƒ`‚ˇ‚éđŒ‚Ş“ÁŽę‚ž‚Š‚çAć“Ş‚ŠĹŒă‚Ĺ‚ľ‚Š’†‚Ě•ś‚ŞŽŔs‚ł‚ę‚Č‚˘‚ž‚ŻB
780 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/03/29(‰Î) 09:03:58.15 ID:/c8bAcK4
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’ö‚Ő‚ ‚˝‚ńi‚ľ‚ă‚Á‚ż‚傤‚Ü‚˘‚­‚ë‹łˆç’ˇŒđ‘ăjt•śŽˇs40‘㔄ăˇŠzƒVƒ…ƒK[ƒ`ƒ‡ƒR
https://www.youtube.com/watch?v=NDq1QoJY0nY‰Fƒhƒiƒ‹ƒhƒAƒiƒŠƒXƒgƒpƒ[ƒXƒg[ƒ“ƒR[ƒ`ƒ“ƒO‚Ć‚ľ‚Ü‚Ś‚ń
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’öŒĂ–{‰Ž‚ć‚ľ‚˝‚Ż‚ľ‚ă‚Á‚ż‚傤‚ż‚ĺ‚ą‚ľ‚ă‚Ş[
ƒfƒB[ƒ‰[Ĺ–ą“VËŠJ”­ŽŇŽ€–S‹l‚݃ˆƒ~ƒhƒNƒ^[ƒ}ƒCƒNƒƒT[ƒrƒX•s‘Ť
ƒTƒbƒJ[ƒuƒbƒVƒ…“ú–{‘ă•\“ú’ö‚Ő‚ ‚˝‚ńƒVƒtƒgŒő‹ŕ‚ł‚Š‚˘‹­§ƒoƒCƒglŒ NŠQ–â‘č
t•ŞŽ‘ŒšŽˇsƒjƒ…[ƒˆ[ƒN’ጴ‰ż‚Ú‚Á‚˝ƒXƒe[ƒLƒ\ƒ‹ƒgƒŒƒCƒN•Ÿ‰Ş‰Ą•lV‹´“z—ę‰Ű‹ŕƒpƒ`ƒVƒtƒg‹­§ƒoƒCƒg–â‘čVŠƒ•ÄƒZƒ“ƒ^[śŽc
ƒRƒXƒ‚Q‚Sƒ`ƒƒƒŠƒeƒB[‰B‚ę40‘㐜Šˆ•ŰŒěƒvƒŒƒCƒ{[ƒCƒoƒCƒgƒŒ[ƒh‚˘‚˝‚č‚ ‚ńÚ‘Ň–â‘č
ƒ}ƒXƒRƒ~KARDƒ[ƒ“ƒP[ƒI[ƒT[ƒrƒX•s‘ŤĽŠˆƒp[ƒeƒB[Šń•t‹ŕŽˇsŒ´”­ƒrƒWƒlƒX
FBIƒ`ƒƒƒCƒj[ƒYƒ^ƒCƒzƒeƒ‹”„ăŽ––ąŠƒKƒ`ƒƒŒˆŽZƒKƒ`ƒƒƒLƒƒƒ“ƒy[ƒ“i”Ě”„•ń“šw‰ßŒƒ”h‘gDŒüŒg‘эŐVî•ń’ń‹ŸI—š
Z’ˇ”­Œž×S’ˆÓƒm[ƒgƒ“ŽY”pƒGƒ‰[(’˜ěŒ ƒNƒŒ[ƒ€’†‘”˝‰ž—ZŽ‘‚Šz‹łˆç”ď)(’†‘•ßŒ~’c‘Ě40‘ăŽĐˆőƒTƒbƒJ[ƒRƒƒ“ƒg
‚Šz“üŠw‹ŕƒ„ƒtƒEV‹´‘ĺŠwƒ„ƒtƒEV‹´—Ž–’ˇFXŒo”ď ‚¨‚ś‚â50‘㎑ŽYƒKƒŠƒoƒYƒtƒB[ƒh40‘ăƒGƒŠ[ƒg
781 :
awk–˝
2016/05/10(‰Î) 10:11:56.15 ID:qP72K9YB
mawk32.exe‚Łumultibyte charv‚ĚƒƒbƒZ[ƒW‚Ş‚Ĺ‚Ä˘‚Á‚Ä‚Ü‚ˇA‰˝‚ŞŒ´ˆö‚Ĺ‚ľ‚傤?
—}Ž~‚ˇ‚é•ű–@‚Í‚ ‚č‚Ü‚ˇ‚Š?
multibyteŽw’č‚ĚƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒIƒvƒVƒ‡ƒ“‚Í–ł‚˘‚悤‚Č‚Ě‚Ĺ‚ˇ‚Ş?
782 :
2016/05/10(‰Î) 13:22:33.71 ID:pT7b4QGj
UTF-8 ‚ŞŽg‚Ś‚Č‚˘‚Ě‚Š‚ŕ

umawk multibyte charv‚ĹŒŸőI
783 :
awk–˝
2016/05/11(…) 00:10:08.64 ID:EkexSAUH
„‚V‚W‚Q

ƒf[ƒ^‚ŕƒvƒƒOƒ‰ƒ€‚ŕ‚r‚i‚h‚r‚Ĺ‚ˇB
‰˝‚É”˝‰ž‚ľ‚Ä multibyte char‚ޏo‘ą‚Ż‚é‚Ě‚Š•s–ž‚Ĺ‚ˇB
‚‡‚‚—‚‹‚‘Ź‚Č‚Ě‚Ĺ–ž‘Ť‚Č‚Ě‚Ĺ‚ˇ‚ށA‚r‚s‚c‚d‚q‚q‚É multibyte char‚Ş‚Ĺ‘ą‚Ż‚é‚Ě‚Ĺ‚¤‚´‚˘‚ľA‚ą‚̏o—Í‚Ô‚ń‚ž‚Ż‘Ź“x‚ŕ’ቺH
784 :
2016/05/11(…) 00:13:30.76 ID:Qn6YFszJ
“ü—Í‚ÉSJIS‚Ĺ‚Č‚˘•śŽš‚ލŹÝ‚ľ‚Ä‚˘‚é‚ą‚Ć‚Č‚˘H
nkf -s “ü—̓tƒ@ƒCƒ‹ | awk
‚Ĺ•ĎŠˇ‚ľ‚˝‚ç
785 :
2016/05/11(…) 03:47:08.47 ID:6KznZIvs
ƒR[ƒh‚đ‹ł‚Ś‚ĉş‚ł‚˘B
ƒ`ƒƒƒŒƒ“ƒW‚ľ‚Ü‚ľ‚˝‚ށA‚ą‚ę‚Ĺ‚Íƒ_ƒ‚Ĺ‚ˇBB
(for i=1, i<=NF, i++){
if $i<0{$i=0}
}
print $0


‚ľ‚˝‚˘‚ą‚Ƃ́A‰ş‹L‚̂悤‚ȍs—ń‚̐”Žš‚Ş‚ ‚Á‚āA•‰‚Ě’l‚đƒ[ƒ‚É’uŠˇ‚ľ‚˝‚˘‚Ĺ‚ˇB

ĽŒł‚̍s—ń
3 15 6 1
-5 4 0 2
8 9 -7 11

Ľ‚â‚č‚˝‚˘•ĎŠˇŒă‚̍s—ńƒCƒ[ƒW
3 15 6 1
0 4 0 2
8 9 0 11
786 :
2016/05/11(…) 04:14:37.49 ID:gi9ycYMA
\•ś‚Ş‚ş‚ń‚ş‚ń‘ʖځB
{for(i=1;i<=NF;i++)if($i<0){$i=0};print $0;}

u‚ľ‚˝‚˘‚ą‚Ƃ́A`‚ľ‚˝‚˘‚Ĺ‚ˇBv‚̍\•ś‚ŕ‘ʖځB“TŒ^“I‚Č‚Ë‚ś‚ę•śB
787 :
2016/05/11(…) 07:39:07.59 ID:E3fj3Ww+
Ruby, Python ‚Č‚Ç‚đŽg‚Ś‚΁H
788 :
2016/05/11(…) 12:31:52.37 ID:ZhRn3EDd
>>787
Ruby, Python ƒXƒNƒŠƒvƒg‚đ’ńŽŚ‚ľ‚Ä‚Ý‚ë‚ćB
789 :
2016/05/11(…) 22:58:11.78 ID:Lckmn9CP
>>786
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇIo—ˆ‚Ü‚ľ‚˝I

(ˆęsƒvƒƒOƒ‰ƒ~ƒ“ƒOIawk•Ö—˜‚Ĺ‚ˇ‚Ë)
790 :
2016/05/13(‹ŕ) 01:56:22.83 ID:VtzDMLxe
awk ‚ś‚á‚Č‚­‚Ä‚ŕ‚˘‚˘‚ń‚Č‚ç

$ sed 's/-[0-9][0-9]*/0/g' ...

GNU sed ‚Č‚ç

$ sed -r 's/-[0-9]+/0/g' ...

‚Ĺ‚Ś‚Ś‚ń‚ż‚ႤH
791 :
2016/06/22(…) 00:21:13.08 ID:X+fwM1CQ
‚Š‚܂Ձ@uwƒVƒFƒ‹Œ|x‚ÉŒř‚­ AWKˆ•űⳁv

ƒGƒCƒzćśuAWK‚Á‚ÄŽg‚˘ŽĚ‚Ä‚ĚŒžŒęi’†—ށjƒvƒ‰ƒXƒAƒ‹ƒtƒ@‚̏ˆ—‚Ş‚â‚č‚˝‚˘‚ć‚ˁB
‚˝‚ž‚ť‚̏ˆ—‚Í‚Ć‚Ä‚ŕŠČ’P‚ȏˆ—‚Ĺ‚˘‚˘B‚ť‚ą‚ɑ΂ľ‚ĐV‚ľ‚˘ƒvƒƒOƒ‰ƒ€ŒžŒę‚đě‚Á‚Ä‚˘‚Ť‚˝‚˘v

AWKƒu[ƒ€‘ć1˘‘ă‚́uƒAƒCƒhƒ‹ŽŤ‘v‚ĹŠw‚ń‚ž\\“ú–{GNU AWKƒ†[ƒU[‰ď Ä“Ą‚ł‚ń (1/5)FCodeZineiƒR[ƒhƒWƒ“j
http://codezine.jp/article/detail/9478
2016/06/15 14:00
792 :
2016/06/22(…) 23:46:54.12 ID:P+7nG182
‚â‚˝‚ç‚Ć‘ą‚Ť‚Í“o˜^‚ľ‚Ä“Ç‚ß‚ĆŒž‚í‚ę‚Ä‚ŕ‚Č‚ B
‚ą‚ĚƒXƒŒ‚Ş—§‚Á‚˝ ‚Š‚çJGAUC‚ĚHP‚ލXV‚ł‚ę‚Ä‚˘‚Č‚˘‚Á‚Ä‚Ě‚ŕŚ‚˘B
793 :
2016/08/27(“y) 09:20:46.26 ID:2q8s4uQl
Windows”Ĺ‚Ěgawk‚Ĺ—V‚ń‚Ĺ‚˝‚ç
for (i=0; i<n; i++) ‚ć‚č
for (i=0; i<n; i+=1) ‚Ě‚Ů‚¤‚Ş
ŽŔsŽžŠÔ‚Ş’Z‚­‚Č‚é‚ą‚Ć‚É‹C‚Ă‚˘‚˝
‚Č‚ń‚ž‚ą‚č‚á
794 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/13(‰Î) 23:56:36.77 ID:mfLTwPLq
for(i=1;i<=1000000;i++){a[i]=1}
‚Ć
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
Œ‹‰Ę‚Í“Ż‚ś‚Í‚¸‚Ȃ̂ɁAŒăŽŇ‚ÍˆŮí‚Ƀƒ‚ƒŠ‚đH‚¤I‚Ó‚ľ‚ŹI
795 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/14(…) 00:22:19.58 ID:YCeX8Gov
“Ż‚ś‚ś‚á‚Č‚˘‚źB”’l‚Ć•śŽš—ń‚žB
‚Ć‚ą‚ë‚ŁAŒN‚ŞŽg‚Á‚Ä‚é awk ‚Í‚Ç‚ę?

apropos awk

‚Á‚Ä‚â‚Á‚Ä‚Ý‚˝‚çA‚ą‚ń‚Č‚ńo‚Ä‚Ť‚˝B

gawk (1) - ƒpƒ^[ƒ“ŒŸőEˆ—ŒžŒę
igawk (1) - ƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚đŽg‚¤ gawk
a2p (1) - Awk to Perl translator
awk (1) - pattern scanning and text processing language
English (3perl) - use nice English (or awk) names for ugly punctuation v...
mawk (1) - pattern scanning and text processing language
nawk (1) - pattern scanning and text processing language
796 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/14(…) 22:01:59.31 ID:DqYC5LBT
>>795
—á‚ŞˆŤ‚­‚ăXƒ}ƒ\ACygwină‚Ĺgawk4.1.4Žg‚Á‚Ä
for(i=1;i<=1000000;i++){a[i]="1"}
‚Ć
for(i=1;i<=1000000;i++){a[i]=sprintf("1")}
‚Ĺƒ‹[ƒv’Eo’źŒă‚Ěƒƒ‚ƒŠŽg—p—Ę‚đ”äŠr‚ˇ‚é‚Ć
ă‚Ş60MBytesA‰ş‚Ş600MBytes‚Ć‚Š‚É‚Č‚Á‚˝

cmd‚Ĺ“Ž‚­gawk‚Ě3.1.7‚Ĺ‚ŕ“Ż‚ś‚悤‚ȍˇ‚Ş‚Ĺ‚˝
Linux‚ÍŽŽ‚ľ‚Ä‚˘‚Č‚˘‚Ż‚ǁA‚ŕ‚ľ‘ĺä•v‚Č‚çWindows”Ĺ‚Ě–â‘č‚Š‚ŕ
797 :
2016/09/14(…) 22:50:10.30 ID:PWB0Awgu
>>796
OSX El Capitan
gawk 4.1.4

‚ť‚ę‚ź‚ęBEGIN{}‚É“ü‚ę‚˝ƒXƒNƒŠƒvƒg‚đ“ǂݍž‚Ü‚š‚ÄŽŔsB
‚Ĺ‘OŽŇ”\MBAŒăŽŇ3GB’´‚Ü‚Ĺƒƒ‚ƒŠŽg‚Á‚˝iƒAƒNƒeƒBƒrƒeƒBƒ‚ƒjƒ^jB
798 :
795
2016/09/14(…) 23:40:38.22 ID:YCeX8Gov
‚â‚Á‚Ä‚Ý‚˝‚ćBŠÂ‹Ť‚Í Debian jessieB
ƒeƒXƒgƒvƒƒOƒ‰ƒ€

#!/usr/bin/perl -w
use strict;
{
my $do_ps = 'system("ps p $PPID o pid,sz,args")';
foreach ( 1,'sprintf("1")'){
system('gawk',"BEGIN { for(i=1;i<=1000000;i++){a[i]=$_} $do_ps;}");
}
}

ŽŔsŒ‹‰Ę

PID SZ COMMAND
7389 7693 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=1} system("ps p $PPID o pid,sz,args");}
PID SZ COMMAND
7392 158116 gawk BEGIN { for(i=1;i<=1000000;i++){a[i]=sprintf("1")} system("ps p $PPID o pid,sz,args");}

KB ’PˆĘ‚ç‚ľ‚˘‚Š‚ç 8MB ‚Ć 160MB B‚˝‚ž‚˛‚Ć‚ś‚á‚Č‚˘ˇ‚ž‚ˁB
1 ‚đ "1" ‚É•ĎX‚ľ‚Ä‚ŕ‚ą‚ń‚ČŠ´‚ś‚ž‚Š‚琔’l‚Ć•śŽš—ń‚̍ˇ‚Ć‚˘‚¤‚í‚Ż‚Ĺ‚Í‚Č‚ł‚ť‚¤B
799 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/14(…) 23:49:14.48 ID:YCeX8Gov
‚˛‚ß‚ńA‘‚Ť–Y‚ę‚˝B

GNU Awk 4.1.1, API: 1.1 (GNU MPFR 3.1.2-p3, GNU MP 6.0.0)
Copyright (C) 1989, 1991-2014 Free Software Foundation.
800 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/17(“y) 08:30:37.61 ID:didBD5ba
‚ć‚­l‚Ś‚˝‚çAƒƒ‚ƒŠ‚ĚŽg—p—ĘŽŠ‘Ě‚ś‚á‚Č‚­‚āA‚ť‚ę‚Ş‚Ç‚ę‚ž‚Ż‘‚Ś‚˝‚Š‚ޏd—v‚ž‚ˁB
‚ť‚ľ‚āA˜A‘z”z—ń‚̍\‘˘‘Ě‚ĆƒL[‚É•K—v‚Č—Ę‚Í‚Ç‚ĚƒP[ƒX‚Ĺ‚ŕ“Ż‚ś‚ƍl‚Ś‚ç‚ę‚éB
‚‚܂čA˜A‘z”z—ń‚Ě—v‘f‚Ě‚˝‚ß‚Ě—Ę‚Ş‚Ç‚ę‚ž‚Żˆá‚¤‚Š‚𒟐ڒm‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚é‚Í‚¸B
‚Ć‚˘‚¤‚í‚Ż‚ŁA‚ŕ‚¤ˆę‰ńƒeƒXƒgB

https://ideone.com/mRuFj7
801 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/17(“y) 08:32:42.20 ID:didBD5ba
ŽŔsŒ‹‰Ę

element before after diff
1 5685 7691 2006
i 5685 29226 23541
sprintf("%d",i) 5685 158124 152439
sprintf("%d",i) + 0 5685 29221 23536
sprintf("%d",i) "" 5685 37026 31341

1000000 —v‘f‚Ě”z—ń‚Ĺ 2MB ‚Á‚āA‚˘‚Á‚˝‚˘‚Ç‚¤‚â‚Á‚Ä‚é‚ń‚ž‚낤B­‚Č‚ˇ‚Ź‚éB
sprintf("%d",i) ‚ޓˏo‚ľ‚Ä‘˝‚˘‚Ě‚Í sprintf ‚Ĺ‘˝‚ß‚ÉŠm•Ű‚ľ‚Ä
Ř‚č‹l‚ß‚˝‚č‚š‚¸‚É‚ť‚Ě‚Ü‚ÜŽg‚Á‚Ä‚é‚Ě‚ž‚낤‚ŠB
‚ł‚ Agawk ‚Ěƒ\[ƒXƒR[ƒh‚đƒnƒbƒN‚ľ‚Ä‚Ý‚é‚Š!
802 :
2016/09/17(“y) 14:11:27.89 ID:IIH0ZjSk
„‘Ş‚ž‚Ż‚ǁAstream, yield, callbackA’x‰„ˆ—‚Š‚ŕ

ƒf[ƒ^‚đƒoƒbƒtƒ@ƒTƒCƒY•Ş‚ž‚Ż“ǂݍž‚ń‚ŏˆ—‚ľ‚āA
ŽŸ‚ĚƒRƒ}ƒ“ƒh‚Ö‘—‚Á‚˝‚çA‚ť‚ę‚đŽĚ‚ĂāAŽŸ‚Ěƒf[ƒ^‚đ“ǂݍž‚Ţ‚Ě‚Š‚ŕ

‚ą‚Ě•űŽŽ‚ž‚Ćƒƒ‚ƒŠ‚́Aƒoƒbƒtƒ@ƒTƒCƒY•Ş‚ž‚Ż‚ľ‚ŠŽg‚í‚Č‚˘
803 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/18(“ú) 10:41:36.96 ID:6jI6cHER
ƒxƒNƒ^[‚ÉŒöŠJ‚ł‚ę‚Ä‚égawk3.1.5i‚Ć”ńŒöŠJ‚Ě3.1.7jAƒwƒ“ƒeƒR‚ȏˆ—‚ŞŒŠ‚‚Š‚Á‚˝‚Ě‚Ĺƒƒ‚
‚ą‚Ěgawk‚ĚsystemŠÖ”‚đŽŔs‚ˇ‚é‚ƁAŠÂ‹Ť•Ď”TMP‚ŞŽw‚ľ‚Ä‚éƒtƒHƒ‹ƒ_‚É
@echo off
systemŠÖ”‚Ěˆř”
‚Ć‚˘‚¤2s‚ޏ‘‚Š‚ę‚˝ƒoƒbƒ`ƒtƒ@ƒCƒ‹pip?.bati?‚ÍsystemŽŔs‰ń”+1j‚Ć‚˘‚¤‚Ě‚ŞěŹ‚ł‚ę
804 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/18(“ú) 10:44:42.56 ID:6jI6cHER
EEE‚˘‚Á‚Ř‚ń‚ɏ‘‚ą‚¤‚Ć‚ľ‚˝‚çƒnƒl‚ç‚ę‚éorz
805 :
803
2016/09/18(“ú) 10:46:32.08 ID:6jI6cHER
(‘ą‚Ť)
‚ť‚ę‚đ/c pip?.bat‚Ĺ‹N“ŽAŠŽ—šŒă‚Épip?.bat‚đ
íœ‚Ć‚˘‚¤—Ź‚ę‚ĹƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚é
806 :
803
2016/09/18(“ú) 10:47:07.98 ID:6jI6cHER
(‘ą‚Ť)
systemŠÖ”‚đŽg‚Á‚˝ƒXƒNƒŠƒvƒg‚đ“ŻŽž‚É1‚‚ľ‚ŠŽŔs‚ľ‚Č‚˘‚Č‚ç—Ç‚˘‚Ż‚Ç
2‚ÂˆČăŽŔs‚ľ‚˝‚Ć‚Ť‚̓^ƒCƒ~ƒ“ƒOŽŸ‘ć‚Ĺpip?.bat‚̐”Žš‚ނԂ‚Š‚čAć‚ÉŽŔs‚ľ‚˝‘¤‚Ş
E ƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚Č‚˘
E ƒRƒ}ƒ“ƒh‚ŞŽŔs‚ł‚ę‚é‚Ż‚ǁAŠŽ—šŒă‚Ɂuƒoƒbƒ`ƒtƒ@ƒCƒ‹‚ŞŒŠ‚‚Š‚č‚Ü‚š‚ńv‚Ş“f‚Š‚ę‚é
‚Ć‚˘‚¤Œ‹‰Ę‚É‚Č‚é

—\‚ßcmd‚Ě‘‹‚˛‚Ć‚ÉTMP‚đ•Ď‚Ś‚Ä‚¨‚Ż‚Ζâ‘č‚Č‚˘‚Ż‚Ç–Ę“|‚­‚ł‚˘
ƒRƒ}ƒ“ƒh | getline‚Ĺ‹N“Ž‚ľ‚˝‚Ů‚¤‚ŞŽč‚ÁŽć‚葁‚˘‚ĆŽv‚¤
i‚˝‚ž‚ľo—Í‚Ş2KBytes—­‚Ü‚é‚ĆŽ~‚Ü‚é‚Š‚ç“K‹XƒŠƒ_ƒCƒŒƒNƒg‚ˇ‚éj

‚Ĺ‚ŕ‰˝‚Ĺ‚ą‚ń‚Č•ű–@‚ĹsystemŠÖ”‚đŽŔ‘•‚ľ‚˝‚ń‚ž‚낤‚Ë(LEƒÖEM)
807 :
2016/09/18(“ú) 13:53:41.51 ID:EIh/dcA1
tmpfile ‚đŽg‚Ś‚΁A‘ź‚Əd•Ą‚ľ‚Č‚˘Aƒ‰ƒ“ƒ_ƒ€‚Č–ź‘O‚Ěƒtƒ@ƒCƒ‹‚đě‚ę‚é‚̂ɁA

‚Ç‚¤‚ľ‚ÄŽg‚í‚Č‚˘‚Ě‚ž‚낤H
808 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/18(“ú) 14:54:02.97 ID:KtcAr9oX
MS-DOS ‚ł͂ˁAƒRƒ}ƒ“ƒhƒ‰ƒCƒ“‚Ě’ˇ‚ł‚̐§ŒŔ‚ŞŒľ‚ľ‚Š‚Á‚˝‚ń‚ž‚ćB‹Á‚­‚Č‚Š‚ęA‚˝‚Á‚˝ 128 ƒoƒCƒg‚žB
‚ť‚ń‚Ȋ‹Ť‚ł́Aƒoƒbƒ`ƒtƒ@ƒCƒ‹‚É‚ˇ‚ę‚ÎŽŔs‚Ĺ‚Ť‚é‚Ż‚Ç

command /c "prog arg1 arg2 ..."

‚Ĺ‚Í command /c ‚Ě‚š‚˘‚Ő§ŒŔ‚đ‰z‚Ś‚é‚Ć‚˘‚¤‚ą‚Ć‚ŕ‚ ‚é‚ž‚낤B‚‚܂čA‚ť‚¤‚˘‚¤‚ą‚Ć‚žB
cccç’k‚žBŠm‚Š‚É‚ť‚¤‚˘‚¤§ŒŔ‚Í‚ ‚Á‚˝‚Ż‚ǁB
ŒťÝ‚Í‚ŕ‚¤ system ŠÖ”‚Ĺ‚Í‚ť‚¤‚˘‚¤‚ą‚Ć‚đ‚ľ‚Ä‚˘‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć‚Ş ChangeLog ‚ɏ‘‚Š‚ę‚Ä‚é‚ćB

2014-01-15 Eli Zaretskii <eliz@gnu.org>
* popen.c (os_system): Use spawnl, and quote the command line, to be consistent with what gawk_popen does.
(os_popen) [__MINGW32__]: Don't scriptify the command, to be consistent with gawk_popen.
(os_pclose) [__MINGW32__]: Update to match os_open: no need to unlink the script file.
809 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/18(“ú) 15:07:54.47 ID:KtcAr9oX
‚Ĺ‚ŕƒ\[ƒXƒR[ƒh‚đŒŠ‚é‚Š‚Ź‚čAƒpƒCƒv‚Ĺ‚Í‚ť‚¤‚˘‚¤‚ą‚Ć‚đ‚ľ‚Ä‚é‚Ý‚˝‚˘‚Č‚ń‚ž‚Ż‚ǁcc
‚ż‚ĺ‚Á‚ĆŽŽ‚ľ‚Ä‚Ý‚Ä‚­‚ę‚Č‚˘‚Š‚ȁB

system("dir") | getline

‚Ý‚˝‚˘‚ČŠ´‚ś? ‚ć‚­’m‚ç‚Č‚˘‚Ż‚ǁB
810 :
803
2016/09/18(“ú) 16:19:12.82 ID:6jI6cHER
ƒRƒ}ƒ“ƒh | getline ‚Ĺ‹N“Ž‚ˇ‚éę‡‚Ípip?.bat‚͍ě‚ç‚ę‚Ü‚š‚ń‚Ĺ‚ľ‚˝
systemŠÖ”‚ž‚Żpip?.batŒo—R‚Ě–Í—l
klabaster”Ĺ‚Ěwindows—pgawk4.1.3‚ž‚ĆsystemŠÖ”‚Şpip?.bat‚đ
ě‚ç‚Č‚Š‚Á‚˝‚Š‚çAƒxƒNƒ^[”ĹŒĹ—L‚Ě“Ž‚Ť‚Š‚Č‚ ‚ĆŽv‚˘‚Ü‚ˇ
811 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/18(“ú) 17:46:00.36 ID:KtcAr9oX
‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB
gawk-4.1.1 ‚Ě pc/popen.c ‚đŒŠ‚˝ŒŔ‚č‚Ĺ‚Í gawk ‚Ě system ŠÖ”‚Ĺƒoƒbƒ`ƒtƒ@ƒCƒ‹‚đě‚é‚Ě‚Í MINGW ŒŔ’č‚ŁA
ChangeLog ‚É‚Í–â‘č‚Ş‰đÁ‚ł‚ę‚˝‚Š‚ç’źÚ spawnl ‚ĹŽŔs‚ˇ‚é‚悤‚É‚ľ‚˝‚Ə‘‚Š‚ę‚Ä‚˘‚é‚í‚Ż‚Ĺ‚ˇ‚Ş
gawk ‚ĚƒpƒCƒvˆ—‚đŽŔs‚ľ‚Ä‚˘‚é(‚ĆŽv‚í‚ę‚é) os_popen ŠÖ”‚Ĺ‚Íƒoƒbƒ`ƒtƒ@ƒCƒ‹‚đě‚é‚Ć‚Ť‚Ć“Ż—l‚É
tempnam ŠÖ”‚Ĺƒtƒ@ƒCƒ‹–ź‚đě‚Á‚˝ă‚ŁA‚ť‚Ěƒtƒ@ƒCƒ‹‚đŒo—R‚ľ‚ÄŽó‚Ż“n‚ľ‚đ‚ľ‚Ä‚˘‚é‚悤‚ÉŒŠ‚Ś‚Ü‚ˇB
‚ą‚ę‚Í MS-DOS ‚ĚŽž‘ă‚Š‚çŽg‚í‚ę‚Ä‚é‚â‚č•ű‚ŁAƒpƒCƒv‚̂悤‚ÉŒŠ‚Ś‚Ä‚ŕƒpƒCƒv‚Ĺ‚Í‚ ‚č‚Ü‚š‚ńB
‚ą‚Ě‚â‚č•ű‚ž‚Ć gawk ‚Ĺ

while (( command | getline) > 0)

‚Ə‘‚˘‚Ä‚ŕŽŔŽż“I‚É‚Í

system("command > filename"); while (( getline < "filename") > 0)

‚Ć“Ż‚ś‚ą‚Ć‚É‚Č‚č‚Ü‚ˇB
‚ ‚­‚Ü‚Ĺ‚ŕ 4.1.1 ‚Ě pc/popen.c ‚Ě os_popen ŠÖ”‚Ş‚ť‚¤ŒŠ‚Ś‚é‚Ć‚˘‚¤‚ž‚Ż‚ŁAŽŔŰ‚ɂ͈Ⴄ‚Š‚ŕ‚ľ‚ę‚Ü‚š‚ń‚Ş
ŽŠ•Ş‚ĹŽŽ‚ˇ‚ą‚Ć‚Ş‚Ĺ‚Ť‚Ü‚š‚ńB‚ť‚ŕ‚ť‚ŕ 3.1.5 ‚Ěƒ\[ƒXƒR[ƒh‚Á‚Ä‚Ç‚ą‚É‚ ‚é‚Ě?
‚ŕ‚ľŠ¨ˆá‚˘‚ś‚á‚Č‚˘‚Č‚ç >>806 ‚Ć“Ż‚ś–â‘č‚Ş‹N‚ą‚č‚ť‚¤‚Č‹C‚ށcc
Linux ‚đŽg‚Á‚Ă鎊•Ş‚É‚ÍŠÖŒW‚Č‚˘‚Ć‚˘‚Á‚Ä‚ľ‚Ü‚Ś‚΂ť‚ę‚Ü‚Ĺ‚Ĺ‚ˇ‚ށB
812 :
2016/09/18(“ú) 19:56:17.75 ID:zTPoEkjL
>>811
vector‚Ě”z•zƒtƒ@ƒCƒ‹“ŕ‚Ěreadme‚ɂ̓\[ƒXƒR[ƒh‚Ě
ŒöŠJęŠ‚đ’T‚ľ‚Ä‚é‚Ć‚ŠA’źÚ˜A—‚ˇ‚ę‚Γn‚ˇ‚Ć‚Š‘‚˘‚Ä‚ ‚éB

Windows”ŁANT‚ ‚˝‚č‚Š‚çˆęŽžƒtƒ@ƒCƒ‹ě‚炸‚ɃpƒCƒv“Žě‚ˇ‚é‚悤‚É
‚Č‚Á‚˝‚Ć‚ŠA‚Ç‚ą‚Š‚Ĺ“Ç‚ń‚ž‹C‚Ş‚ˇ‚é‚Ż‚ǁB
813 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/18(“ú) 22:03:20.37 ID:KtcAr9oX
“ä‚Í‰đ‚Ż‚˝B
ƒtƒ@ƒCƒ‹‚đŽg‚Á‚ăf[ƒ^‚đ“n‚ˇ‚Ě‚Íƒ}ƒNƒ __DJGPP__ ‚Ćƒ}ƒNƒ __MINGW32__ ‚Ş
‚˘‚¸‚ę‚ŕ’č‹`‚ł‚ę‚Ä‚˘‚Č‚˘ę‡‚ç‚ľ‚˘‚Ĺ‚ˇB
Vector ‚Ě‚Í MINGW ‚Č‚Ě‚ĹŠY“–‚ľ‚Ü‚š‚ńB‚¨‘›‚Ş‚š‚ľ‚Ü‚ľ‚˝B
814 :
2016/09/19(ŒŽ) 11:56:06.00 ID:iIvzjj/t
ƒtƒ@ƒCƒ‹‚đŒo—R‚ľ‚Ä‚˘‚Ä‚ŕAƒXƒgƒŒ[ƒW‚ɏ‘‚Ťž‚Ţ‚Ć‚ÍŒŔ‚ç‚Č‚˘

ƒƒ‚ƒŠă‚ž‚Ż‚É‘śÝ‚ˇ‚éAƒtƒ@ƒCƒ‹‚ŕ‚ ‚č“ž‚éB
Linux‚ĚRAMƒfƒBƒXƒNAtmpfs ‚Ć‚Š
815 :
803
2016/09/19(ŒŽ) 14:26:19.66 ID:fDWhtT6v
>>811
î•ń‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇB>>803‚ŏ‘‚˘‚˝uƒwƒ“ƒeƒR‚ȏˆ—v‚đpc\popen.c“ŕ‚ÉŠm”F‚Ĺ‚Ť‚Ü‚ľ‚˝B
scriptifyŠÖ”‚ĚtempnamŒÄ‚ń‚Ĺ‚é‚Ć‚ą‚ë‚ĹƒvƒƒZƒXID‚ŕ‚‚Ż‚é‚Č‚čA×H‚ľ‚˝‚˘‚Č‚ EEE
816 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/20(‰Î) 17:00:26.41 ID:RIxgZ1yj
ć“úƒAƒNƒZƒX‚Ĺ‚Ť‚Č‚Š‚Á‚˝ GNU ‚ĚƒTƒCƒg‚Ş•œŠˆ‚ľ‚Ä‚˝‚Ě‚Ĺ 3.1.5 ‚Ěƒ\[ƒXƒR[ƒh‚đ“üŽč‚Ĺ‚Ť‚Ü‚ľ‚˝B
‚â‚Á‚Ď‚č os_popen ‚Š‚ç‚ŕ scriptify ‚đŒÄ‚ń‚Ĺ‚˝‚Ý‚˝‚˘‚Ĺ‚ˇ‚ˁB4.1.1 ‚Ěƒ\[ƒXƒR[ƒh‚ś‚ᔝ‚č‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
ˆę‰ž chdir ‚̓Aƒgƒ~ƒbƒN‚ȏˆ—‚Ě‚Í‚¸‚Č‚Ě‚ĹƒŠƒXƒN‰ń”đ‚ɖ𗧂‚Ǝv‚˘‚Ü‚ˇ‚ćB‚ť‚ęˆČŠO‚É•ű–@‚Ş‚Č‚Ż‚ę‚΁B
chdir ‚ľ‚˝‚ç rmdir ‚ŕ–Y‚ꂸ‚ɁB
817 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/20(‰Î) 17:06:03.57 ID:RIxgZ1yj
ŠÔˆá‚Ś‚˝Bchdir ‚ś‚á‚Č‚­‚Ä mkdir ‚Ĺ‚ˇB
818 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/22(–Ř) 12:11:24.09 ID:nnsRF/zz
>>794
‚Ç‚¤‚â‚ç >>801 ‚Ĺ‘z‘œ‚ľ‚˝’Ę‚č sprintf ‚ĚŽd—l‚ç‚ľ‚˘B
–{‘Ě‚Í builtin.c ‚Ě format_tree ŠÖ”‚ç‚ľ‚˘B
Ĺ‰‚É 512 ƒoƒCƒgŠm•Ű‚ľ‚˝ƒoƒbƒtƒ@‚Í‘ĺ‚Ť‚­‚Í‚Č‚Á‚Ä‚ŕŹ‚ł‚­‚Í‚Č‚ç‚Č‚˘B
ŽŔŰ‚Ě•śŽš—ń‚ɍ‡‚í‚š‚ÄŠm•Ű‚ľ‚Č‚¨‚ľ‚˝‚ç‚Ç‚¤‚Č‚é‚Š >>800 ‚ĚƒeƒXƒg‚đ‚ľ‚Ä‚Ý‚˝‚ćB

‰ü‘˘‘O
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@151283@148530
sprintf("%d",i) + 0@@@@@ 2753@ 22376@ 19623
sprintf("%d",i) ""@@@@@@2753@ 30174@ 27421

‰ü‘˘Œă
element@@@@@@@@@@ before@ after@@diff
1@@@@@@@@@@@@@@ 2753@@4757@@2004
i@@@@@@@@@@@@@@ 2753@ 22357@ 19604
sprintf("%d",i)@@@@@@@ 2753@ 30174@ 27421
sprintf("%d",i) + 0@@@@@ 2753@ 22373@ 19620
sprintf("%d",i) ""@@@@@@2753@ 30230@ 27477

‚ ‚ęH jessie ‚Ě gawk ‚Ć”ä‚ׂăƒ‚ƒŠ‚ĚŽg—p—Ę‚Ş­‚Č‚˘B
-DDEBUG •t‚Ť‚ĹƒRƒ“ƒpƒCƒ‹‚ľ‚˝‚Š‚瑝‚Ś‚é‚Š‚ĆŽv‚Á‚˝‚̂ɁB
‚Ü‚ A‚ť‚ęˆČŠO‚Íˆę‰ž—\‘z’Ę‚č‚Ĺ‚Í‚ ‚éB
819 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/22(–Ř) 23:15:31.17 ID:SYBS8P/o
>>793‚Ć‚Š
•śŽš—ń‚Ě˜AŒ‹‚Í "A" "B" ‚ć‚č‚ŕsprintf("%s%s", "A", "B") ‚Ě•ű‚Ş‘Ź‚˘‚Ć‚Š
gawk‚Á‚ÄŒ‹\ƒNƒZ‚ ‚č‚Ü‚ˇ‚Ë
820 :
2016/09/23(‹ŕ) 02:39:22.63 ID:o4qLonoN
>>819
> •śŽš—ń‚Ě˜AŒ‹‚Í "A" "B" ‚ć‚č‚ŕsprintf("%s%s", "A", "B") ‚Ě•ű‚Ş‘Ź‚˘
ƒ}ƒW‚ŠB‹t‚ž‚Ć•ˇ‚˘‚Ä‚˘‚˝‚ށB
821 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/23(‹ŕ) 16:06:39.19 ID:Y+5MXC/e
‚ť‚ń‚ČƒoƒJ‚ȁcc‚ĆŽv‚Á‚Ä‚â‚Á‚Ä‚Ý‚˝B

https://ideone.com/jIYn2p

jessie —p‚ĚƒpƒbƒP[ƒW‚É‚ć‚éŽŔsŒ‹‰ĘB

i++@@@@@@@@@6.15614
i = i + 1@@@@@@6.02501
cat " and " dog@@@13.0163
sprintf@@@@@@@19.1612

ƒCƒ“ƒNƒŠƒƒ“ƒg‚Ć‘Ť‚ľŽZ‚̍ˇ‚Í—LˆÓ‚Ć‚ÍŽv‚Ś‚Č‚˘B
˜AŒ‹‚Ć sprintf ‚̍ˇ‚Í‘˝•ŞA”{‚­‚炢B
sprintf ‚Ě’†‚Ě•ĄŽG‚ł‚đl‚Ś‚ę‚ΈӊO‚ƍˇ‚͏Ź‚ł‚˘‚Ć‚˘‚Ś‚éB
ƒtƒH[ƒ}ƒbƒg•śŽš—ń‚Ş’č”‚Ȃ琳‹K•\Œť‚Ý‚˝‚˘‚ɃRƒ“ƒpƒCƒ‹‚ˇ‚ę‚Î
‚‘Ź‰ť‚Ĺ‚Ť‚écc‚Ě‚Š‚Č‚ ? ŽŠ•Ş‚Ĺ‚â‚Á‚Ă݂悤‚Ć‚Í(Ą‚Í‚Ü‚ž)Žv‚í‚Č‚˘B
822 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/24(“y) 23:15:47.76 ID:+IiHRmp0
Windows‚ĹŽg‚Ś‚éawk‚ĹUnicode‚𐳂ľ‚­ˆ—‚Ĺ‚Ť‚éilength("‚ ‚˘‚¤")‚Ĺ3‚Ş•Ô‚Á‚Ä‚­‚éj‚ŕ‚Ě‚Í
Cygwin”Ĺ‚ĆVector”ĹˆČŠO‚É–ł‚˘‚Ĺ‚ľ‚傤‚ŠH
823 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/25(“ú) 10:08:34.07 ID:BH82R274
‰˝‚Ş‚ ‚Á‚˝‚ń‚Ĺ‚ˇ‚Š?

http://tanimoto.to/nlp/jgawk/jgawk.html

‚ɏ‘‚Š‚ę‚Ä‚˘‚é‚悤‚Č‚ą‚Ć‚Ĺ‚ˇ‚Š? •Ę‚Ě‘I‘đŽˆ‚ŕˆę‰ž‚ ‚é‚Ý‚˝‚˘‚Ĺ‚ˇ‚ށB
ƒgƒ‰ƒ“ƒXƒŒ[ƒ^‚Ĺ‚ŕ‚˘‚˘‚Č‚ç Perl ‚É a2p ‚Ş“ŻŤ‚ł‚ę‚Ä‚Ü‚ˇB
824 :
822
2016/09/25(“ú) 14:28:36.60 ID:MNlfsMjx
“Á‚ɍ˘‚育‚Ć‚Í–ł‚˘‚Ě‚Ĺ‚ˇ‚ށAĹV‚ĚVer4.1.4‚â‚ť‚Ě‹ß•Ó‚Ěƒo[ƒWƒ‡ƒ“‚Ĺ
Unicode‚ސł‚ľ‚­ˆ—‚Ĺ‚Ť‚é‚ŕ‚Ě‚Ş‚ ‚ę‚΁AĄŽg‚Á‚Ä‚˘‚éBruce”Ĺ3.1.7‚Š‚ç
ć‚芡‚Ś‚˝‚˘‚Č‚ ‚ĆŽv‚˘‚Ü‚ľ‚āB

Ť‚Ě5”N‘O‚ɏ‘‚Š‚ę‚˝‹LŽ–‚̍ ‚ć‚č‘I‘đŽˆ‚Ş‘‚Ś‚˝‚č‚ľ‚Ä‚˝‚çŠđ‚ľ‚˘‚ȂƁEEEB
http://blog.livedoor.jp/corbie/archives/3924154.html
825 :
823
2016/09/26(ŒŽ) 09:17:05.22 ID:bhAuZr+w
—‰đ‚ľ‚Ü‚ľ‚˝B‘S–Ĺ‚ž‚Á‚˝‚ń‚Ĺ‚ˇ‚ˁB
Windows ‚Ĺ‚ĚŽ–î‚Í‘ś‚ś‚Ü‚š‚ń‚ށA‚ą‚ż‚ç‚Ĺ‚ŕŽć‚č‹}‚Ź gawk 3.1.5 ‚đ make ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
‚Ć‚ą‚ë‚ŁA‚ť‚Ěƒy[ƒW‚ĚƒeƒXƒg3‚Í•s\•Ş‚Ĺ‚ˇB
UTF-8 ‚Ĺ‚Ěƒpƒ^[ƒ“ƒ}ƒbƒ`‚Í’Ęí•śŽš‚ĚŒëƒ}ƒbƒ`‚ÍŒ´—“I‚É‹N‚ą‚č‚Ü‚š‚ńB‹N‚ą‚Á‚˝‚çƒoƒO‚Ĺ‚ˇB
‚ž‚Š‚çAUTF-8 ‚ɑΉž‚ľ‚Ä‚˘‚é‚Š‚Ç‚¤‚Š‚đƒeƒXƒg‚ˇ‚é‚˝‚ß‚É
sub(/.‚¤/, "U")
‚Ć‚˘‚¤‚悤‚Č‚ŕ‚Ě‚đ“ü‚ę‚ÄŽŽ‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
Ąƒrƒ‹ƒh‚ľ‚˝‚΂Š‚č‚Ě gawk 3.1.5 ‚Ć jessie ‚ĚƒpƒbƒP[ƒW‚Ě gawk 4.1.1 ‚Ş‚ą‚ĚƒeƒXƒg‚ɍ‡Ši‚ľ‚Ü‚ľ‚˝B
mawk 1.3.3 ‚ŕƒCƒ“ƒXƒg[ƒ‹‚ł‚ę‚Ä‚Ü‚ľ‚˝‚ށA‚ą‚ż‚ç‚̓}ƒ‹ƒ`ƒoƒCƒg•śŽš‚ɑΉž‚ľ‚Ä‚˘‚Č‚˘‚悤‚Ĺ‚ˇB

‚ł‚āAŒ‹˜_‚Ĺ‚ˇB
ƒVƒtƒgJIS ‚ɑΉž‚ľ‚Ä‚˘‚é‚Ć‚ł‚ę‚é‚ŕ‚Ě‚Í”đ‚Ż‚˝•ű‚Ş‚˘‚˘‚ĆŽv‚˘‚Ü‚ˇB
—]Œv‚ȉü‘˘‚Í‚ľ‚Č‚˘•ű‚ސM—ŠŤ‚͍‚‚˘‚Ĺ‚ľ‚傤B
length ‚ރoƒCƒg”‚Ȃ̂́A’P‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•śŽš”ń‘Ήž‚ĹƒRƒ“ƒpƒCƒ‹‚ł‚ę‚Ä‚é‚Š‚ç‚ž‚ĆŽv‚˘‚Ü‚ˇB
ƒ}ƒ‹ƒ`ƒoƒCƒg•śŽš‘Ήž”Ĺ‚đ’N‚Š‚ރŠƒŠ[ƒX‚ľ‚Ä‚­‚ę‚é‚Ě‚đ‘҂‚ŠAŽŠ•Ş‚ĹƒRƒ“ƒpƒCƒ‹‚ˇ‚é‚Š‚Ĺ‚ˇ‚ˁB
826 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/27(‰Î) 17:33:47.16 ID:Icjzq3KF
Linux ‚ł͊‹Ť•Ď” LANG ‚É UTF-8 ‚Ş“ü‚Á‚Ä‚Č‚˘‚ĆŠú‘Ň’Ę‚č‚É“Ž‚˘‚Ä‚­‚ę‚Ü‚š‚ńB
łŠm‚É‚Í LANG ‚Ć‚˘‚¤‚ć‚č LC_CTYPE ‚Ĺ‚ˇ‚ށA‚ť‚ę‚Í‚¨‚˘‚Ć‚˘‚āB
‚ŕ‚ľ‚Š‚ľ‚˝‚ç‚ĆŽv‚Á‚āAŽŠ•Ş‚É‚Í–ł—p‚ž‚ĆŽv‚Á‚Ä‚˝ Wine ‚Ĺ klabaster gawk 4.1.3 ‚đ“Ž‚Š‚ľ‚Ä‚Ý‚Ü‚ľ‚˝B
‚Ć‚ą‚ë‚ŞAł‹K•\Œť‚Ƀ}ƒ‹ƒ`ƒoƒCƒg•śŽš‚ŞŒť‚ę‚˝Žž“_‚Ĺ“{‚ç‚ę‚Ü‚ˇB
‚Ç‚¤‚â‚ç LANG ‚Ş–ł‚˘‚ŠALANG=C ‚ś‚á‚Č‚Ż‚ę‚΃}ƒ‹ƒ`ƒoƒCƒg•śŽš‚đŽg‚Ś‚Č‚˘‚悤‚Ĺ‚ˇB
‚ť‚ľ‚ÄŒ‹‹ÇAł‹K•\Œť‚Ě . ‚â length ‚đ UTF-8 ƒ‚[ƒh‚É‚ˇ‚é•ű–@‚ÍŒŠ‚‚Ż‚ç‚ę‚Ü‚š‚ń‚Ĺ‚ľ‚˝B
‹LŽ–‚ĚƒRƒƒ“ƒg‚É‚Í LC_ALL=ja_JP.UTF-8 ‚Ĺ“Ž‚­‚Á‚ď‘‚˘‚Ä‚ ‚é‚̂ɁB
‚Đ‚ĺ‚Á‚Ć‚ľ‚āAWindows ‚Ĺ‚ÍŒ´—“I‚É‚Ĺ‚Ť‚Č‚˘‚Ć‚˘‚¤‚ą‚Ć?
‚ą‚ę‚Í‚˘‚悢‚ć a2p ‚ŞŒťŽŔ“I‚Č‘I‘đŽˆ‚Š?
cc‚ĆŽv‚Á‚˝‚çAo—Í‚ˇ‚é Perl ƒR[ƒh‚ŞŠÔˆá‚Á‚Ä‚Ü‚ˇB

‚ŕ‚¤~ŽQ‚Ĺ‚ˇBUTF-8 ‘Ήž‚Ě gawk ‚đ‚¨–]‚Ý‚Ě•ű‚É‚Í Linux ‚Ö‚Ěˆř‰z‚ľ‚đ‹­‚­‚¨§‚ß‚ľ‚Ü‚ˇB
827 :
2016/09/27(‰Î) 18:24:36.25 ID:JiNhKH2a
cygwin‚âmsys2‚Ěgawk‚đŽg‚¤‚Ě‚Í‚ž‚߂Ȃ́H
828 :
2016/09/27(‰Î) 18:34:39.64 ID:BPXrtVfk
Windows Subsystem for Linux (WSL)‚ł́AUbuntu64‚ĚŽŔsƒtƒ@ƒCƒ‹‚Ş“Ž‚­B
Linux API ‚đAWindows API ‚Ö•ĎŠˇ‚ľ‚ÄŒÄ‚Ńo‚ˇ

Ubuntu‚ĚƒpƒbƒP[ƒW‚ŕAapt-get‚ĹƒCƒ“ƒXƒg[ƒ‹‚Ĺ‚Ť‚é
829 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/27(‰Î) 19:26:43.05 ID:Icjzq3KF
‚ž‚ß‚Ć‚˘‚¤‚ŠAŒŠ‚‚Ż‚ç‚ę‚Č‚Š‚Á‚˝B
‚˝‚ž‚Ĺ‚ł‚Ś Windows ‚Ě‚ą‚Ć‚Č‚ń‚Š’m‚ç‚Č‚˘‚ń‚ž‚Š‚ç‚ą‚ęˆČă–ł—B
‚˘‚˘•ű–@‚đ’m‚Á‚Ä‚˝‚ç‹ł‚Ś‚Ä‚ ‚°‚āB
830 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/27(‰Î) 19:51:11.26 ID:Icjzq3KF
Cygwin ‚ÍŽŽ‚ľ‚Ä‚Ý‚˝‚Ż‚ǃCƒ“ƒXƒg[ƒ‰‚É’šd‚É‚¨’f‚č‚ł‚ę‚˝‚ćB
831 :
822
2016/09/27(‰Î) 23:10:22.59 ID:eGFFwbsN
‚˝‚­‚ł‚ń‚̏î•ń‚ ‚č‚Ş‚Ć‚¤‚˛‚´‚˘‚Ü‚ˇBŒťó‚ĹWindows‚ɍS‚é‚Č‚çABruce”Ĺ3.1.7‚đŒp‘ą‚ľ‚Ä
Žg—p‚ˇ‚é‚ŠACygwin”Ĺ‚Éć‚芡‚Ś‚é‚ŠAWindows Subsystem for Linux‚Ĺ“Žě‚ł‚š‚é‚Š‚Ě
‚˘‚¸‚ę‚Š‚É‚Č‚č‚ť‚¤‚Ĺ‚ˇ‚ˁB

Cygwin‚âWindows7‚Ĺ‚ĚWindows Subsystem for Linux‚́A‚Ç‚ż‚ç‚ŕ•Ę“rƒCƒ“ƒXƒg[ƒ‹‚Ş•K—v
‚Ć‚Ě‚ą‚ƂȂ̂ŁAEę‚ĚŽŠPC‚Í‚Ć‚ŕ‚Š‚­ƒXƒNƒŠƒvƒg”z•zć‚ɁiƒXƒNƒŠƒvƒg‚đ“Ž‚Š‚ˇ‚˝‚ß‚ž‚Ż‚Ɂj
“ą“ü‚ľ‚Ä‚ŕ‚ç‚í‚Č‚˘‚Ć‚˘‚Ż‚Č‚˘‚Ě‚Í‚ż‚ĺ‚Á‚Ć“ď‚ľ‚ť‚¤‚Ĺ‚ˇB
Cygwin‚Ě“ą“üó‹ľ‚ĆWindows10‚ւ̐؂č‘Ö‚ŚŽžŠú‚Ě—lŽq‚đŒŠ‚Â‚ÂA‚ľ‚΂炭Bruce”Ĺ3.1.7‚đ
Žg‚¤‚ą‚Ć‚É‚ľ‚Ü‚ˇB
832 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/09/28(…) 07:26:06.87 ID:6NcLFLen
ŽŔ‚Í•ű–@‚Ş–ł‚˘‚í‚Ż‚Ĺ‚Í‚Č‚˘BƒVƒ“ƒOƒ‹ƒoƒCƒgƒ‚[ƒh‚Č‚ç‚Ĺ‚Ť‚éB‚Ĺ‚ŕ–{“–‚É‚â‚č‚˝‚˘?
–{“–‚ɐ^Œ•‚É•K—v‚Ć‚ľ‚Ä‚˘‚é‚Č‚çA‚ą‚ĚƒXƒNƒŠƒvƒg‚ĹƒeƒXƒg3‚đ‚â‚Á‚Ä‚Ý‚Ä‚Ů‚ľ‚˘B

{
@@c = "[\\000-\\177]|[\\340-\\357][\\200-\\277][\\200-\\277]"
#@ print( length($0));
@@str = $0; print( gsub( c,"0",str));
@@print;
@@sub(/<tag>/, "");
@@sub(/<\/tag>/, "");
@@sub(/hello/, "ABC");
#@ sub(/.‚¤/, "U");
@@sub( sprintf("(%s)‚¤",c),"U")
@@print;
}
833 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/10/01(“y) 22:37:26.49 ID:apxhHWta
‚â‚Á‚Ď‚č klabaster gawk ‚Í‚ć‚­‰đ‚ç‚Č‚˘B

$cat u2.awk
{
@@print( length($0))
@@sub(/‚¤/, "U")
@@print;
}
$LANG=C wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.EUC-JP wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
$LANG=ja_JP.UTF-8 wine ../gawk64.exe -f u2.awk u2.txt > /dev/null
gawk64: u2.awk:3: sub(//, "U")
gawk64: u2.awk:3: ^ unterminated regexp
gawk64: u2.awk:4: sub(//, "U")
gawk64: u2.awk:4: ^ unexpected newline or end of string
$

UTF-8 ‚Łu‚¤v‚Í 3 ƒoƒCƒg‚ž‚Š‚çAƒVƒtƒgJIS‚ʼnđŽß‚ľ‚˝Œ‹‰Ę
‚ť‚ĚŒă‚ë‚Ě / ‚ŕƒ}ƒ‹ƒ`ƒoƒCƒg•śŽš‚Ěˆę•”‚É‚Č‚é‚Ě‚ž‚낤‚ŠB
‚˘‚âAUTF-8 ‚ʼnđŽß‚ľ‚Ä‚­‚ę‚Č‚˘‚ą‚Ć‚É•ś‹ĺ‚đŒž‚˘‚˝‚˘‚ń‚ś‚á‚Č‚˘‚ń‚žB
UTF-8 ‚ŏ‘‚˘‚Ä‚ ‚é‚Ě‚É‚Č‚ş LANG=ja_JP.UTF-8 ‚ĚŽž‚ž‚ŻƒGƒ‰[‚É‚Č‚é‚Ě‚ž‚낤B
834 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/10/02(“ú) 00:14:27.80 ID:lSw/Qfuv
‚ą‚Ě‹LŽ–‚đŒŠ‚é‚Š‚Ź‚č‚Ĺ‚ÍklabasterˆČŠO‚ĚWindows”Ĺgawk‚Ĺ‚ŕƒ_ƒ‚Á‚Ű‚˘‚Ĺ‚ˇ
https://groups.google.com/forum/#!topic/comp.lang.awk/coXxXOpeoXU
835 :
2016/10/08(“y) 21:51:54.06 ID:66+5bUgM
>>749‚Š‚ç‚ĚƒŒƒX‚ŁA$‚މ‰ŽZŽq‚ž‚Á‚˝‚́H@‚Ć‚˘‚¤‚悤‚Č‚Ć‚ą‚ë‚Ş‹C‚É‚Č‚Á‚Ä
­‚ľ’˛‚ׂĂ݂˝i’˛‚ׂ˝‚Ć‚˘‚¤‚Ů‚Ç‚Ěě‹Ć‚Í‚ľ‚Ä‚Č‚˘‚ŠjB

‚Ü‚¸‘ĐBŽčŽ‚ż‚̐”ű‚ĹŠm”FB
wƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKxiƒgƒbƒpƒ“@‰”Ĺ‘ć7üj
‚ł‚˘‚˛‚̂܂Ƃ߂ʼn‰ŽZŽqˆę——‚É‹LÚB–{•ś’†(p8)‚ł́u—“‚͏í‚É$1,$2‚̂悤‚É
ŽQĆ‚ľ‚Č‚­‚Ä‚Í‚˘‚Ż‚Č‚˘‚ĆŽv‚í‚ę‚Ä‚˘‚é‚Š‚ŕ‚ľ‚ę‚Č‚˘‚ށAŽŔ‚Í$‚Ě‚ ‚Ć‚É‚Í,—“‚Ě
”ԍ†‚đŽw‚ľŽŚ‚ˇ‚˝‚ß‚Ě”CˆÓ‚ĚŽŽ‚đ‘‚˘‚Ä‚ŕ‚悢v‚Ə‘‚Š‚ę‚Ä‚˘‚éB‚Ü‚˝Ap46‚É‚Í
u—“•Ď”v‚̍€‚Ɂu“ü—͍s‚Ě—“ifieldj‚Í,$1,$2‚Š‚çŽn‚Ü‚Á‚Ä,$NF‚Ć‚˘‚¤–ź‚ĹŒÄ‚Î‚ę‚év
‚Ć‚Ě‹Lq‚Ş‚ ‚éB

wsed & awk ƒvƒƒOƒ‰ƒ~ƒ“ƒOxiƒAƒXƒL[o”ŋǁ@‰”Łj
‹Œ”ŁB–{•ś’†ip212j‚ŁuƒtƒB[ƒ‹ƒh‚đŽQĆ‚ľ‚˝‚˘‚Ć‚Ť‚ɂ́AƒtƒB[ƒ‹ƒh‰‰ŽZŽq$‚đŽg‚Ś‚΂悢v
‚Ü‚˝ip217j‚ŁuƒtƒB[ƒ‹ƒh‚đŽQĆ‚ˇ‚é‚ɂ̓hƒ‹‹L†($)‰‰ŽZŽq‚đŽg‚¤vAAppendixip471j‚Ĺ
u‚ť‚ę‚ź‚ę‚ĚƒtƒB[ƒ‹ƒh‚́A$1‚Č‚ç‚΍ŏ‰‚ĚƒtƒB[ƒ‹ƒh‚Ě’l‚đŽQĆ‚ľAv‚Ć•\Œť‚ł‚ę‚Ä‚˘‚éB
Appendix‚̉‰ŽZŽqˆę——‚É‹LÚB

wAWK‚đ256”{Žg‚¤‚˝‚ß‚Ě–{xiƒAƒXƒL[o”ŋǁ@‰”Łj
Appendix‚ʼn‰ŽZŽqˆę——‚É‹LÚ‚ł‚ę‚Ä‚˘‚é‚ŞA–{•śip65j‚Łu•Ş‰đ‚ł‚ę‚˝ŠeƒtƒB[ƒ‹ƒh‚́A
$n‚Ć‚˘‚¤•Ď”in‚́AŽn‚ß‚ĚƒtƒB[ƒ‹ƒh‚Š‚珇‚É1,2,3...‚Ć‚Č‚éB‚ŕ‚ż‚ë‚ń‘Ś’l‚Ě‘ă‚í‚č‚ɕϐ”‚đ
Žw’股‚é‚ą‚Ć‚ŕ‰Â”\‚žj‚ĹƒAƒNƒZƒX‚ˇ‚é‚ą‚Ć‚Ş‚Ĺ‚Ť‚év‚Ć‚ ‚éB‘ź‚Ě‰ÓŠ‚Ĺ‚ŕ$n•Ď”‚Ə‘‚˘‚Ä‚ ‚é
‚Ć‚ą‚ë‚Ş‚ ‚éBp66‚ŁuŠeƒtƒB[ƒ‹ƒh‚đ•\‚ˇ$n‚Ĺ‚ ‚é‚ŞA‚Č‚ş‚ą‚ń‚Č–ź‘O‚É‚Č‚Á‚Ä‚˘‚é‚Š‚˛‘ś‚ś‚ž‚낤‚ŠH
ŽŔ‚Í‚ą‚ę‚ŕUNIX•ś‰ť‚Š‚ç‚Ť‚Ä‚˘‚é‚Ě‚žBUNIX‚Ě‘ă•\“I‚ČƒVƒFƒ‹‚Ĺ‚ ‚ésh‚âcshiĹ‹ß‚Ĺ‚Íksh‚â
tcsh‚Š‚ȁHj‚ĚƒVƒFƒ‹ƒXƒNƒŠƒvƒg‚Ě‚Č‚Š‚ĹƒRƒ}ƒ“ƒhƒ‰ƒCƒ“ƒpƒ‰ƒ[ƒ^‚đ•\‚ˇ•Ď”‚Ć‚ľ‚Ä$n‚ŞŽg—p‚ł‚ę‚Ä
‚¨‚či’†—ށj‚ą‚ę‚É‚ ‚í‚š‚Äawk‚Ĺ$n‚ŞŽg—p‚ł‚ę‚Ä‚˘‚é‚悤‚Č‚Ě‚Ĺ‚ ‚év‚Ə‘‚˘‚Ä‚ ‚éB

wAWKŽŔ‘H“ü–ĺxi‹Zp•]˜_ŽĐ@‰”Łj
>>766‚É‚ ‚é‚悤‚É“Á•Ę‚ȕϐ”‚Ć‚ľ‚Ĉľ‚í‚ę‚Ä‚¨‚čAƒŠƒtƒ@ƒŒƒ“ƒX‚É‚ŕ$‚މ‰ŽZŽq‚Ĺ
‚ ‚é‚ą‚Ć‚Ě‹LÚ‚Ş‚Č‚˘B
i‘ą‚­j
836 :
2016/10/08(“y) 22:00:44.45 ID:66+5bUgM
i‘ą‚Ťj
ƒlƒbƒg‚̏î•ńB2016.10.8ŒťÝB
Gnu Awk ƒ†[ƒU[ƒYƒKƒCƒh/The GAWK Manual/Effective AWK Programming
gawk‚̉đŕ‘Bƒo[ƒWƒ‡ƒ“ˆá‚˘‚Ş‚ ‚é‚悤‚ž‚ށA–|–ó”Ĺ‚Ĺ–Ú‚É—Ż‚Ü‚Á‚˝‚ŕ‚́B
u’萔‚Ĺ‚Č‚˘ƒtƒB[ƒ‹ƒh”ԍ†v‚̍€‚Łu‚ ‚éƒtƒB[ƒ‹ƒh‚đŽQĆ‚ˇ‚é‚˝‚߂ɁAawkŒžŒę‚Ĺ‚Ě”CˆÓ‚ĚŽŽ‚đ
`$'‚ĚŒă‚ĹŽg‚¤‚ą‚Ć‚Ş‚Ĺ‚Ť‚év‚Ć‹Lq‚ł‚ę‚Ä‚˘‚éBu‰‰ŽZŽq‚Ě—Dć‡ˆĘv‚̍€‚ł͉‰ŽZŽq‚Ć‚ľ‚Ä
•Ŕ‚ׂç‚ę‚Ä‚˘‚éB

man gawk
–|–ó”ŁAƒŠƒiƒbƒNƒXƒRƒ}ƒ“ƒh‚Ć‚˘‚¤ƒTƒCƒgiwww.linux-cmd.comj‚Š‚çB
u“ü—̓ŒƒR[ƒh’†‚ĚŠeƒtƒB[ƒ‹ƒh‚Ě’l‚́Aś‚Š‚ç $1, $2 “™‚Ć‚˘‚¤–ź‘O‚ĹŽQĆ‚Ĺ‚Ť‚Ü‚ˇB
$0 ‚̓ŒƒR[ƒh‘S‘Ě‚Ĺ‚ˇBƒtƒB[ƒ‹ƒh‚É’l‚đ‘ă“ü‚ˇ‚é‚ą‚Ć‚ŕ‚Ĺ‚Ť‚Ü‚ˇBƒtƒB[ƒ‹ƒh‚͒萔‚ž‚Ż‚Ĺ‚Č‚­A
•Ď”‚É‚ć‚Á‚ÄŽQĆ‚ˇ‚é‚ą‚Ć‚ŕ‚Ĺ‚Ť‚Ü‚ˇBv‚Ć‚Č‚Á‚Ä‚˘‚éB‰‰ŽZŽq‚Ě‚Ć‚ą‚ë‚É‹LÚ‚ ‚čB

AWK Users JP
ƒTƒCƒg’†uawk Šî‘b•ś–@Ĺ‘Źƒ}ƒXƒ^[v‚Ěƒy[ƒW‚Łu“ÁŽę•Ď”v‚̍€‚É$0,$1`$NF‚Ěŕ–žB
ƒtƒB[ƒ‹ƒhŽQĆ‚ĚŒę‚Í‚Č‚˘B‚Ü‚˝AƒŠƒtƒ@ƒŒƒ“ƒX“I‚ȉ‰ŽZŽq‚Ě‚Ü‚Ć‚ß‚Í‚Č‚˘iHjB
ƒy[ƒWă•”‚Ɂu‚ą‚Ě•ś‘‚͏‘‚Ť‚Š‚Ż‚Ĺ‚ˇv‚Ć‚ ‚é‚̂ŁA–˘Ž”ő‚Ć‚˘‚¤‚ą‚Ć‚ž‚낤‚ŠB

IBM Knowledge Center
awkƒRƒ}ƒ“ƒh‚Ěƒy[ƒWiwww.ibm.com/support/knowledgecenter/ja/ssw_aix_71/
com.ibm.aix.cmds1/awk.htmj‚ł́uƒŒƒR[ƒh‚ĆƒtƒB[ƒ‹ƒh‚É‚ć‚éƒtƒ@ƒCƒ‹ˆ—v‚̍€‚Ĺ
uŠeƒtƒB[ƒ‹ƒh‚̓tƒB[ƒ‹ƒh•Ď”‚É‚ć‚Á‚ÄŽQĆ‚ł‚ę‚Ü‚ˇBƒŒƒR[ƒh‚̍ŏ‰‚ĚƒtƒB[ƒ‹ƒh‚É‚Í $1 •Ď”A
2 ”Ô–Ú‚ĚƒtƒB[ƒ‹ƒh‚É‚Í $2 •Ď”‚Ć‚˘‚¤‚悤‚ɁA•Ď”‚ŞŠ„‚č“–‚Ä‚ç‚ę‚Ü‚ˇBv‚Ć‚Ě‹LqB­‚ľ‚¤‚ľ‚ë‚Ě
•űAuƒtƒB[ƒ‹ƒh•Ď”v‚̍€‚Ĺ‚ŕuƒtƒB[ƒ‹ƒh•Ď”‚́A$ (ƒhƒ‹‹L†) ‚Ć‚ť‚ę‚É‘ą‚­”’l‚Ü‚˝‚͐”’lŽŽ‚Ĺ
Žw’č‚ľ‚Ü‚ˇBv‚Ć‚ ‚éB$‚މ‰ŽZŽq‚Ĺ‚ ‚é‚ą‚Ć‚Ě‹LÚ‚Í‚Č‚˘B

‚Ä‚ČŠ´‚ś‚ŁAwƒvƒƒOƒ‰ƒ~ƒ“ƒOŒžŒęAWKx‚Ĺ‚ŕu—“•Ď”v‚Ć‚˘‚¤•\Œť‚Ş‚ ‚čAŒë‰đ‚ľ‚ť‚¤‚ČŠ´‚ś‚Í‚ˇ‚éB
‚Ü‚˝A256”{–{‚ɏ‘‚˘‚Ä‚ ‚é‚悤‚ɃVƒFƒ‹ƒXƒNƒŠƒvƒg’†‚Ěƒpƒ‰ƒ[ƒ^‚Ć‚ľ‚Ä$n‚Ş‚ ‚é‚ą‚Ć‚Š‚çA$n‚Ş
i“Á•Ę‚ȁj•Ď”‚Ć‚ľ‚Ä”FŽŻ‚ł‚ę‚Ä‚ľ‚Ü‚Á‚Ä‚˘‚é‚Ě‚Ĺ‚Í‚Č‚˘‚ŠA‚Ć‚ŕ‘z‘œ‚ˇ‚éBŒÂlƒTƒCƒg‚Ěawk‚̉đŕ
ƒy[ƒW‚ł́A$n‚Ć‚˘‚¤•Ď”‚ɃtƒB[ƒ‹ƒh‚Ş‘ă“ü‚ł‚ę‚é‚Ćŕ–ž‚ľ‚Ä‚˘‚é‚Ć‚ą‚ë‚ŕ‚ ‚Á‚˝B‚ť‚̂悤‚É—‰đ‚ľ‚Ä
ƒXƒNƒŠƒvƒg‚đ‘‚˘‚Ä‚ŕ‚ł‚ľ‚Ä•s“s‡‚Í‚Č‚˘‚ž‚낤‚ȁA‚Ć‚ÍŽv‚¤‚ށB
837 :
2016/10/08(“y) 23:11:50.50 ID:ZMh6U7O9
L”Í‚Č’˛¸‰łBGawk‚Ěrefcard‚Ĺ‚ŕ‚ż‚á‚ń‚Ćoperator‚ÉŠÜ‚Ü‚ę‚Ä‚˘‚é‚Č‚ B
‰‰ŽZŽq‚Ć–žŠm‚É”FŽŻ‚ľ‚Ä‚˘‚Č‚­‚Ä‚ŕA$‚ĚŒă‚ÉŽŽOK‚ĆŽv‚Á‚Ä‚˘‚ę‚΍ˇ‚ľŽx‚Ś‚Č‚ł‚ť‚¤B
838 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/10/18(‰Î) 23:10:18.54 ID:TQpGgbw6
gawk4‚Ŋ֐”ƒ|ƒCƒ“ƒ^‚Ý‚˝‚˘‚Č‚ŕ‚ń‚ޒljÁ‚ł‚ę‚Ü‚ľ‚˝‚Ż‚ǁA‚ą‚ęlength‚Ć‚Šsubstr‚Ě
‘gž‚݊֐”‚â@load‚ľ‚˝ŽŠědll‚̊֐”‚Ć‚Š‚É‚ŕŽg‚Ś‚é‚ń‚Ĺ‚ˇ‚Ë
ˆÄŠO•Ö—˜‚Š‚ŕ

@load "hage.dll"
@BEGIN{
@kumi = "length"
@func = "hagefunc"
@ng[1] = "substr"
@print @kumi("ABC")
@print @func("œc Ü ƒ~ ")
@print @ng[1]("XYZ", 1, 1) # ”z—ń‰z‚ľ‚ɌĂڂ¤‚Ć‚ľ‚˝‚çsyntax errorEEEŽc”O
}
839 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/10/21(‹ŕ) 17:10:59.85 ID:MQQBNMPM
>>756
‚ą‚¤‚˘‚¤‰ß‘aƒXƒŒ‚Ĺ–ł‘Ę‚É“Ë‚Á‚Š‚Š‚Á‚Ä‚­‚é‚â‚‚ނŠ‚‚­‚ń‚ž‚ŞŽ€‚Ë
840 :
2016/11/23(…) 00:01:26.03 ID:bt3mTQnz
>>839
ƒu[ƒƒ‰ƒ“‚Š‚ć‚—‚—‚—
841 :
2016/11/23(…) 01:18:15.98 ID:noM2Pdp3
_‚¨‚Í‚°‚ž[I^
842 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2016/11/30(…) 02:56:38.28 ID:PeC/aWZc
843 :
‚b‰SŽŇ
2017/02/28(‰Î) 13:18:15.09 ID:Mb8mQo1M
‚‚—‚‹ƒXƒNƒŠƒvƒg‚đ‚bƒ\[ƒX‚É•ĎŠˇ‚ľ‚ăRƒ“ƒpƒCƒ‹‚ˇ‚é‚˝‚߂́u‚‚—‚‹‚v‚Ć‚˘‚¤ƒc[ƒ‹‚Ĺ‚Ĺ‚Ť‚é‚ž‚ŻŠČ’P‚É‚t‚s‚e|‚WƒTƒ|[ƒg‚ł‚š‚é•ű–@‚đ’m‚č‚˝‚˘‚Ĺ‚ˇB
ƒlƒbƒg‚ĹŽUX’˛‚ׂ܂ľ‚˝‚Ş‚Č‚˘‚悤‚Ĺ‚ˇH
844 :
2017/03/02(–Ř) 00:28:53.73 ID:CDxvUfiY
‚ą‚ĚƒXƒŒ‚ŕ‚P‚OŽü”N‚Š
845 :
2017/03/05(“ú) 09:28:55.73 ID:EQCsqksH
>>843
‚ť‚ę‚Ş‚ ‚Č‚˝‚ĚŒťÝ‚ĚŽŔ—Í‚ž‚Á‚˝‚Ć‚˘‚¤‚ą‚Ć‚Ĺ‚ˇ
‚¨”ć‚ę—l‚Ĺ‚ľ‚˝
846 :
2017/03/05(“ú) 14:45:26.28 ID:KmKKYedf
gawk‚ɑΉž‚ľ‚Ä‚é‚Č‚ç‘ĺä•v‚Á‚Ä‚ą‚Ć‚Š‚ȁH
ascii‚ľ‚Šl‚Ś‚Ä‚˘‚Č‚˘‚Č‚çAƒ\[ƒX‘Sƒ`ƒFƒbƒNcB
—v‚ˇ‚é‚ɁA“ú–{Œę‰ť‚ˇ‚é‚ń‚ž‚낤‚Ż‚ǁB

‘S‘R•Ę‚ĚŒžŒę•ĎŠˇ‚É‚ż‚ĺ‚Á‚Ć™ů‚ń‚ž‚ą‚Ć‚Ş‚ ‚é‚ń‚ž‚Ż‚ǁA
ť•i‰ť‚ľ‚ż‚á‚Á‚Ä‚Š‚çƒ_ƒuƒ‹ƒoƒCƒgl—ś‚ľ‚Ä‚Č‚˘‚ą‚Ć‚Ş‚í‚Š‚Á‚āA‚Š‚Č‚č–Ę“|‚ž‚Á‚˝B

‚Ć‚č‚ ‚Ś‚¸•ĎŠˇ‚ľ‚Ä‚Š‚çAƒ\[ƒXŒŠ‚Ä’ź‚ˇ‚Ů‚¤‚Ş‘‚Š‚Á‚˝‚čiÎ

‚Ş‚ń‚΂Á‚ĂˁB
847 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2017/03/06(ŒŽ) 11:39:31.22 ID:FdaYmB9f
awk‚Ł@$1,$2...$6 ‚ą‚ń‚ȏo—Í‚đŤ‰ş‚É‚ľ‚˝‚˘‚ń‚ž‚Ż‚ǁ@‚Ç‚¤‚ˇ‚ę‚΂˘‚˘‚Ĺ‚ˇ‚Š‚ˁH
470230
470290
Ť
002347
002479
848 :
2017/03/06(ŒŽ) 12:33:46.83 ID:FW5jfGh1
GNU awk ‚Ě asort() ‚đŽg‚¤‚Ć‚ŠB

printf '470230\n470290\n' |
gawk -vFS= -vOFS= '{
for(i=1;i<=NF;i++){
arr[i]=$i
};
asort(arr);
for(i=1;i<=NF;i++){
$i=arr[i]
};
print
}'
849 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2017/03/06(ŒŽ) 15:19:43.83 ID:FdaYmB9f
‚ ‚č‚Ş‚Ć‚¤
gawk ‚˘‚ę‚Č‚˘‚Ĺ‚Č‚ń‚Ć‚Š‚Č‚ç‚Č‚˘‚Š‚Č
850 :
2017/03/06(ŒŽ) 17:28:40.15 ID:FW5jfGh1
‚¤`‚ńA‚ť‚¤‚Č‚é‚Ć awk ‚đŽg‚í‚Č‚­‚Ä‚ŕ‚˘‚˘‚Š‚Č

printf '470230\n470290\n' |
while read -r n
do
echo "$n" | grep -o . | sort -n | tr -d '\n'; echo
done
851 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2017/03/06(ŒŽ) 19:23:27.89 ID:08XsJPyW
>>840
‚ž‚Š‚çƒu[ƒƒ‰ƒ“‚Ć‚Š‚ť‚¤‚˘‚¤‚ĚŠÖŒW‚Č‚˘‚Š‚玀‚Ë‚Á‚ÄŒž‚Á‚Ä‚ń‚ž‚ëƒJƒX
Ž€‚Ë
852 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2017/03/06(ŒŽ) 19:24:30.15 ID:08XsJPyW
>>844
”S’…‚Ş10”NˆĘ‰„–˝‚ľ‚Ä‚ŕ‰˝‚ŕ‚ˇ‚˛‚­‚Ë‚Ś‚ć
“Ë‚Á‚Š‚Š‚Á‚Ä‚Ť‚˝‚Ô‚ż‚ą‚낡‚źŽG‹›Ž€‚Ë>>840
853 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2017/03/06(ŒŽ) 19:26:33.18 ID:08XsJPyW
>>840
ƒu[ƒƒ‰ƒ“‚Ć‚Š‚ś‚á‚Č‚­‚ÄŽ€‚Ë‚Á‚ÄŒž‚Á‚Ä‚ń‚ž‚Š‚玀‚˃{ƒP
854 :
2017/03/07(‰Î) 08:17:48.93 ID:6Hf5Xh2e
‚¨”ć‚ę—l‚Ĺ‚ľ‚˝
855 :
ƒfƒtƒHƒ‹ƒg‚Ě–ź–ł‚ľ‚ł‚ń
2017/03/09(–Ř) 21:48:39.65 ID:0T9qj2kA
˜A‘z”z—ń‚Ĺ
echo '470230' | awk 'BEGIN{FS=""}{for(i=1;i<=NF;i++){a[$i]++}for(i=0;i<=9;i++){for(j=1;j<=a[i];j++){printf("%s", i)}}printf("\n")}'
002347
856 :
2017/03/10(‹ŕ) 00:18:57.87 ID:+B1nKlhG
Šů‚ɔے肳‚ę‚Ä‚˘‚é‚Şgawk4‚Ş‚ŕ‚ľŽg‚Ś‚˝‚ç
awk '{ORS="";PROCINFO["sorted_in"]="@val_num_asc";x=split($0,a,"");for (i in a)print a[i];print "\n"}'
857 :
2017/03/10(‹ŕ) 04:05:38.25 ID:wGo6zQ56
Ĺ‹ß‚Ě gawk ‚Č‚çƒCƒ“ƒNƒ‹[ƒhƒtƒ@ƒCƒ‹‚Ş—pˆÓ‚ł‚ę‚Ä‚Ä join ‚Ć‚ŠŽg‚Ś‚˝‚č

gawk -vFS= -vOFS= -i join.awk '{split($0,a,"");asort(a);print join(a,1,length(a),SUBSEP)}'
305KB

V’…ƒŒƒX‚Ě•\ŽŚ

šƒXƒ}ƒz”ŁšĄŒfŽŚ”‚ɖ߂遥‘S•”‘O100ŽŸ100ĹV50

–ź‘O:E-mail: